InDel4 molecular marker for identifying cold tolerance of rice at sprouting stage and application thereof

By using PCR amplification and electrophoresis experiments with the InDel4 molecular marker and its primer pairs, the time and cost issues of identifying cold tolerance in rice bud stage were solved, realizing a rapid, low-cost, and highly specific identification method suitable for rice breeding and production practices.

CN119859706BActive Publication Date: 2025-11-25CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510211917.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2025-11-25
Estimated Expiration
2045-02-25

AI Technical Summary

Technical Problem

Current technologies require lengthy low-temperature culture experiments and specialized personnel to identify the cold tolerance of rice buds, and lack rapid, low-cost identification methods.

Method used

The cold tolerance of rice during the germination stage was rapidly identified by using the InDel4 molecular marker and its primer pairs through PCR amplification and electrophoresis experiments. Primer pairs were designed to perform PCR amplification using the specific site of the InDel4 molecular marker located in the CTS4 coding region of rice, and the bands were distinguished by agarose gel electrophoresis.

Benefits of technology

This method enables rapid, low-cost, and highly specific identification of cold tolerance in rice buds, applicable to breeding and production practices, and the results are consistent with those of low-temperature experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119859706B_ABST
    Figure CN119859706B_ABST
Patent Text Reader

Abstract

The application discloses an InDel4 molecular marker for identifying cold tolerance of rice at the bud stage and application thereof, relates to the field of genetic engineering, and discloses that the InDel4 molecular marker is located in a rice gene CTS4 The coding region; the InDel4 molecular marker comprises three point positions, namely a first point position located at positions 283-331 of the sequence SEQ ID No. 1, a second point position located at positions 389-391 of the sequence SEQ ID No. 1, and a third point position located at positions 482-484 of the sequence SEQ ID No. 1. The primers provided in the application are used for identifying rice with different cold tolerance at the bud stage, and the results show that rice materials with strong cold tolerance at the bud stage and rice materials with weak cold tolerance at the bud stage have specific differences, and the rice materials with strong cold tolerance at the bud stage have larger bands than the rice materials with weak cold tolerance at the bud stage; the primers designed in the application can effectively amplify specific gene fragments of the rice, and the specific gene fragments are distinguished through agarose gel electrophoresis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to an InDel4 molecular marker for identifying cold tolerance in rice bud stage and its application. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) originates from tropical and subtropical regions and is highly sensitive to low temperatures; low-temperature disasters can severely impact rice yield and quality. With the promotion and application of direct-seeding rice technology, low-temperature injury during the germination stage has become one of the major abiotic stresses restricting rice production. Rice varieties with strong cold tolerance during the germination stage can resist low-temperature stress, which is of great significance for reducing rice chilling losses and promoting direct-seeding rice cultivation. Therefore, predicting the cold tolerance trait during the germination stage in rice is crucial during variety breeding.

[0003] Currently, researchers often determine the cold tolerance of a new rice variety or breeding material during the budding stage through lengthy and complex low-temperature cultivation experiments, identifying cold tolerance traits under suitable low-temperature conditions. This entire process takes at least 2-3 weeks and requires specialized technicians to perform cold tolerance phenotypic identification. Therefore, in breeding practice, it is necessary to find a rapid method for identifying the cold tolerance of rice budding stages. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, this invention provides an InDel4 molecular marker for identifying cold tolerance during the germination stage of rice and its application. This molecular marker can identify rice materials with different cold tolerance during the germination stage. In practical applications, only PCR combined with electrophoresis is required, resulting in low cost, high throughput, and good specificity, making it suitable for breeding and production practices.

[0005] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0006] This invention provides an InDel4 molecular marker for rice, wherein the InDel4 molecular marker is located in the rice gene as shown in SEQ ID No. 1. CTS4 The coding region; the InDel4 molecular marker includes three sites: the first site located at positions 283-331 of SEQ ID No. 1; the second site located at positions 389-391 of SEQ ID No. 1; and the third site located at positions 482-484 of SEQ ID No. 1.

[0007] A primer pair for amplifying the InDel4 molecular marker described above is provided, comprising the forward primer as shown in SEQ ID No. 2: 5'-CCTGAGTCACAAGCACGAAA-3'; and the reverse primer as shown in SEQ ID No. 3: 5'-AACCGGTTGCACAGGTAGTC-3'.

[0008] This invention provides an application of the aforementioned InDel molecular marker or the aforementioned primer pair in detecting the cold tolerance of rice during the germination stage.

[0009] A kit for detecting the cold tolerance of rice during the germination stage is provided, the kit containing the primer pairs described above.

[0010] A method for detecting the cold tolerance of rice during the germination stage is provided, comprising the following steps:

[0011] S1: Extract genomic DNA from the rice sample to be tested;

[0012] S2: Using the extracted genomic DNA as a template, perform PCR amplification using the primer pairs described above;

[0013] S3: Perform electrophoresis detection on the PCR amplification products. If an electrophoretic band identical to the InDel4 molecular marker mentioned above appears, the rice sample to be tested is rice with cold resistance during the germination stage; otherwise, the rice sample to be tested is rice without cold resistance during the germination stage.

[0014] Furthermore, the PCR amplification system in step S2 is as follows: 5 μL of 2× Phanta Max Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 1 μL of template DNA, and 3 μL of double-distilled water.

[0015] Furthermore, the PCR amplification program was as follows: preheating at 95℃ for 3 min; 34 cycles: denaturation at 95℃ for 30 s, annealing at 58℃ for 40 s, extension at 72℃ for 30 s; and final extension at 72℃ for 5 min.

[0016] Furthermore, the electrophoresis procedure was as follows: 4% agarose gel electrophoresis, constant voltage 250V, 500A, electrophoresis time 15min.

[0017] This invention provides an application of the aforementioned InDel4 molecular marker or the aforementioned primer set in rice germplasm resource analysis or molecular marker-assisted breeding.

[0018] The beneficial effects of this invention are as follows:

[0019] The primers provided in this invention were used to identify rice varieties with different cold tolerance at the budding stage. The results showed that rice materials with strong cold tolerance at the budding stage and those with weak cold tolerance at the budding stage had specific differences. The bands of rice materials with strong cold tolerance at the budding stage were larger than those of rice materials with weak cold tolerance at the budding stage. The primers designed in this invention can effectively amplify specific gene fragments of rice and distinguish them by agarose gel electrophoresis.

[0020] The InDel molecular marker provided by this invention only requires PCR amplification combined with agarose gel electrophoresis in practical applications, which is low in cost, high in throughput, and high in specificity, and is suitable for rice breeding and production practices. Attached Figure Description

[0021] Figure 1 The image shows the electrophoresis results of the PCR amplification products in Example 1.

[0022] Figure 2 This is an electrophoresis result of the PCR amplification products from Example 2. Detailed Implementation

[0023] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0024] Unless otherwise specified in the examples, the conditions were performed under standard conditions or as recommended by the manufacturer. Reagents and instruments used without a manufacturer's name were all commercially available products. The indica rice variety 9311 used in the examples is deposited at the Rice Research Center, College of Agriculture, China Agricultural University; the cold-tolerant infiltration line Ra17 is described in "Wang Shanshan, Locational Study of QTLs Related to Cold Tolerance in Annual Wild Rice during Sprouting and Seedling Stages, Master's Thesis, 2016"; the annual wild rice TK212 is deposited at the Rice Research Center, College of Agriculture, China Agricultural University; Yuanjiang common wild rice, Chaling common wild rice, rice GC2, and rice Teqing are all deposited at the Rice Research Center, College of Agriculture, China Agricultural University.

[0025] Example 1

[0026] Download the indica rice variety 9311 and the annual wild rice TK212 from the Plant Genome Database (https: / / phytozome-next-jm6g.jgi.doe.gov). CTS4 Genome sequence;

[0027] Comparison revealed a 49bp insertion and two 3bp insertions in the annual wild rice TK212. Based on the insertion sequences, forward primers were designed as shown in SEQ ID NO.2: 5'-CCTGAGTCACAAGCACGAAA-3'; and reverse primers were designed as shown in SEQ ID NO.3: 5'-AACCGGTTGCACAGGTAGTC-3'.

[0028] Genomic DNA was collected from annual wild rice TK212, cold-sensitive indica rice variety 9311, and cold-resistant introgression line Ra17, and amplified using designed primer pairs. Specifically, when each rice variety reached the two-leaf-one-heart stage, leaves were collected, and genomic DNA was extracted using a modified CTAB method.

[0029] The amplification system consisted of: 5 μL of 2× Phanta Max Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 1 μL of template DNA, and 3 μL of double-distilled water.

[0030] The PCR amplification program was as follows: preheating at 95℃ for 3 min; 34 cycles: denaturation at 95℃ for 30 s, annealing at 58℃ for 40 s, extension at 72℃ for 30 s; and final extension at 72℃ for 5 min.

[0031] Sanger sequencing was performed on the amplified products. The cold-sensitive indica rice variety 9311 had a 537bp band as shown in SEQ ID NO.4, and the cold-resistant introgression line Ra17 had a 592bp band as shown in SEQ ID NO.1.

[0032] The differences between the cold-resistant infiltration line Ra17 and the indica rice variety 9311 were determined using InDel molecular markers, including the first locus at positions 283-331 of SEQ ID No. 1: GCTTTTTTTTTTTCGAGCTATTAATAAGCTGGATTTAACAATAAAAATTC; the second locus at positions 389-391 of SEQ ID No. 1: CCT; and the third locus at positions 482-484 of SEQ ID No. 1: AGG.

[0033] The amplification products were subjected to 4% agarose gel electrophoresis. The electrophoresis program was: 4% agarose gel electrophoresis, constant voltage 250V, 500A, electrophoresis time 15min. The results are as follows: Figure 1 As shown, by Figure 1 It can be seen that the product of the indica rice variety 9311 is a relatively small band. The cold-resistant introgression line Ra17 and the annual wild rice TK212 both have a larger band. Since the size of the electrophoretic bands is consistent, the specific bands of the cold-resistant gene can be distinguished by electrophoresis.

[0034] Example 2

[0035] One-year-old wild rice TK212, indica rice 9311, Yuanjiang common wild rice, Chaling common wild rice, rice GC2, and rice Teqing were used for verification.

[0036] The above-mentioned rice varieties were cultivated until they had two leaves and one heart, and the leaves were collected. Genomic DNA was extracted from them using a modified CTAB method.

[0037] Using rice genomic DNA as a template, PCR amplification was performed using the primer pairs, amplification system, and procedure designed in Example 1 to obtain amplification products. The amplified PCR products were then analyzed by agarose gel electrophoresis and a gel imaging system. The electrophoresis results are shown in the figure below. Figure 2 Among them, 1-6 are the electrophoresis results of Yuanjiang common wild rice, Chaling common wild rice, annual wild rice, 9311, GC2, and Teqing, respectively. Figure 2 It can be seen that the bands of Yuanjiang common wild rice, Chaling common wild rice, and annual wild rice TK212 are similar, and all are larger than those of indica rice 9311, rice GC2, and rice Teqing. The bands of indica rice 9311, rice GC2, and rice Teqing are similar.

[0038] Low-temperature experiments were conducted on the six rice varieties mentioned above. The specific steps were as follows: Plump seeds were selected and dried in a 42℃ oven for 2 days to break dormancy. The dormancy-broken seeds were then disinfected by soaking in a 20% sodium hypochlorite solution for 30 minutes, followed by rinsing several times with deionized water until no odor remained. The seeds were then placed in a 37℃ incubator for 2 days. After the seeds began to sprout, they were transferred to disposable plastic petri dishes with a diameter of 90 mm (lined with a layer of sterile filter paper and 15-20 mL of sterile deionized water) and placed in a light incubator (temperature 28℃, humidity 70%, light conditions set to 16h light / 8h dark) until the sprout length reached approximately 5 mm. Thirty seeds with sprout lengths of approximately 5 mm were selected from each petri dish and subjected to low-temperature dark treatment at 4℃ for 4 days. After the low-temperature treatment, the seeds were allowed to recover at 28℃ for 7 days. The number of healthy seedlings was counted, and the seedling survival rate was calculated. The statistical results are shown in Table 1.

[0039] Table 1

[0040]

[0041] According to Table 1 and Figure 2 It was found that the Yuanjiang common wild rice, Chaling common wild rice, and TK212, which showed larger bands in the electrophoresis results, all had a seedling survival rate of over 90% after low-temperature testing. In contrast, the 9311, GC2, and Teqing varieties, which showed smaller bands in the electrophoresis results, had a seedling survival rate of no more than 20% after low-temperature testing. The low-temperature test results were consistent with the molecular marker identification results, demonstrating the ability to specifically identify the cold tolerance of rice during the germination stage.

[0042] In summary, the molecular markers, primers, and identification methods provided by this invention can specifically identify the cold tolerance of rice during the germination stage, providing practical value for rice breeding.

Claims

1. The application of a primer pair for amplifying InDel molecular markers in detecting cold tolerance during rice germination, characterized in that, The InDel molecular marker is located in the rice gene as shown in SEQ ID No.

1. CTS4 Encoding area; The InDel molecular marker is a combination of three sites: the first site located at positions 283-331 of SEQ ID No. 1: GCTTTTTTTTTCGAGCTATTAATAAGCTGGATTTAACAATAAAAATTC; the second site located at positions 389-391 of SEQ ID No. 1: CCT; and the third site located at positions 482-484 of SEQ ID No. 1: AGG. If all three sites are inserted, the rice is a type of rice with cold tolerance during the budding stage. Primer pairs include the forward primer shown in SEQ ID No. 2 and the reverse primer shown in SEQ ID No.

3.

2. A method for detecting the cold tolerance of rice during the germination stage, characterized in that, Includes the following steps: S1: Extract genomic DNA from the rice sample to be tested; S2: Using the extracted genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1; S3: Perform electrophoretic detection on the PCR amplification products. If an electrophoretic band identical to the InDel molecular marker described in claim 1 appears, then the rice sample to be tested is rice with cold resistance during the germination stage.

3. The method according to claim 2, characterized in that, The PCR amplification system in step S2 is as follows: 5 μL of 2×Phanta Max Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 1 μL of template DNA, and 3 μL of double-distilled water.

4. The method according to claim 3, characterized in that, The PCR amplification program was as follows: preheating at 95℃ for 3 min; 34 cycles: denaturation at 95℃ for 30 s, annealing at 58℃ for 40 s, extension at 72℃ for 30 s; and final extension at 72℃ for 5 min.

5. The method according to claim 2, characterized in that, The electrophoresis procedure was as follows: 4% agarose gel electrophoresis, constant voltage 250V, 500A, electrophoresis time 15min.

6. An application of the primer pair for amplifying InDel molecular markers as described in claim 1 in germplasm resource analysis of cold tolerance during rice budding stage or in marker-assisted breeding of cold tolerance during rice budding stage.

Citation Information

Patent Citations

  • Molecular marker of cold-tolerant gene CTES11b in rice bud stage and application of molecular marker

    CN115961078A

  • KR20210066090A