Application of compound in preparation of skin and / or scalp care product

Abstract

The invention discloses application of a compound in preparation of a skin and / or scalp care product, the structural formula of the compound is # imgabs0, and compared with retinoic acid, the compound provided by the invention has higher cell safety concentration and lower irritation, has a more excellent effect in the aspect of cell damage repair, and has a better cell moisturizing effect; compared with the retinyl phytosphingosine, the compound provided by the invention has a better effect in the aspects of inhibiting the activity of elastase and improving type I collagen; compared with retinoyl phytosphingosine, the compound provided by the invention shows a better effect in the aspects of resisting lipid peroxidation and inhibiting malassezia reproduction, and also has better stability. The compound provided by the invention has good application value in the field of preparing cosmetics, medicines and health care products with corresponding effects or indications.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of a compound in preparing skin and / or scalp care products. Background Art

[0002] Vitamin A is a fat-soluble vitamin, among which vitamin A1 (retinol) can improve the softness and smoothness of the skin; adding retinol to skin care products has a good effect on improving acne and wrinkles. However, retinol contains many unsaturated bonds in its structure and is very sensitive to light, oxygen, etc., and its application in cosmetic formulas is limited, such as being easily oxidized in the air and easily inactivated under light. The irritation and instability of retinol limit its addition amount in cosmetics, and at the same time, the excellent anti-aging and acne-removing effects of retinol cannot be fully exerted.

[0003] Retinoic acid (RA) is an intermediate product of vitamin A metabolism in the body. It plays an important role in cell growth, differentiation and organogenesis, mainly affecting bone growth and promoting epithelial cell proliferation, differentiation, keratin dissolution and other metabolic effects. Retinoic acid can reduce melanin formation and reduce skin pigmentation. It can be used to treat acne vulgaris, ichthyosis, various keratinization abnormalities and hyperpigmentation skin diseases, and psoriasis. However, topical retinoic acid may cause skin irritation symptoms, such as burning, erythema and desquamation, which may make skin lesions more obvious.

[0004] As an important physiological lipid in the skin, ceramide has attracted special attention from researchers for its unique skin care effect. As the main component of intercellular lipids in the stratum corneum of the skin, ceramide not only acts as a second messenger molecule in the sphingomyelin pathway, but also plays an important role in the formation process of the epidermal stratum corneum. It has the functions of maintaining the skin barrier, soothing, moisturizing, anti-aging, whitening and disease treatment. In order to solve the irritation problem of retinol / retinoic acid, the invention patent CN202310186304.0 reported that retinoic acid and phytosphingosine docked to form retinoic acid phytosphingosine have been significantly improved in terms of irritation, and also showed good efficacy in repairing the skin barrier, anti-aging, anti-acne and other aspects. However, stability research experiments show that retinoyl phytosphingosine has obvious degradation after being stored at room temperature for a period of time, which will have a greater impact on the stability of the product in the formula, and will also affect the efficacy of the product.

[0005] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides an application of a compound in the preparation of skin and / or scalp care products, so as to solve the problem of instability of existing products containing retinol / retinoic acid.

[0007] The technical solution adopted by the present invention to solve the above technical problems is as follows:

[0008] In a first aspect of the present invention, a compound is provided for use in preparing a skin and / or scalp care product, wherein the compound has the structural formula:

[0009] In a second aspect of the present application, a composition is provided for use in preparing a skin and / or scalp care product, wherein the composition comprises a compound having the structural formula:

[0010]

[0011] Preferably, the skin and / or scalp care product is a cosmetic, medicine or health product for repairing the skin barrier.

[0012] Preferably, the skin and / or scalp care product is an anti-aging cosmetic, medicine or health product.

[0013] Preferably, the skin and / or scalp care product is a cosmetic, medicine or health product for resisting lipid peroxidation.

[0014] Preferably, the skin and / or scalp care product is a cosmetic, medicine or health product that inhibits scalp fungi.

[0015] The third aspect of the present invention provides a skin and / or scalp care product, wherein the raw material of the skin and / or scalp care product comprises a compound having the following structural formula:

[0016]

[0017] In a fourth aspect of the present application, a cosmetic, medicine or health product for repairing the skin barrier and / or anti-aging is provided, wherein the raw materials of the cosmetic, medicine or health product for repairing the skin barrier and / or anti-aging include a compound having the following structural formula:

[0018]

[0019] In a fifth aspect of the present application, a cosmetic, medicine or health product for resisting lipid peroxidation is provided, wherein the raw material of the cosmetic, medicine or health product for resisting lipid peroxidation includes a compound having the following structural formula:

[0020] In a sixth aspect of the present application, a cosmetic, medicine or health product for inhibiting scalp fungus is provided, wherein the raw materials of the cosmetic, medicine or health product for inhibiting scalp fungus include a compound having the following structural formula:

[0021] Beneficial effects:

[0022] The present invention discloses an application of a compound in the preparation of skin and / or scalp care products. Compared with retinoic acid, the compound provided by the present invention has a higher cell safety concentration and lower irritation, has a more excellent effect in cell damage repair, and has a better cell moisturizing effect; compared with retinoyl phytosphingosine, the compound provided by the present invention shows a better effect in inhibiting elastase activity and improving type I collagen; compared with retinoyl phytosphingosine, the compound provided by the present invention shows a better effect in resisting lipid peroxidation and inhibiting the reproduction of Malassezia, and has better stability. The compound provided by the present invention has a good application value in the field of preparing cosmetics, medicines, and health products with corresponding efficacy or indications. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results of the cell migration ability test in Example 2;

[0024] Figure 2 This is a bar graph of the cell proliferation activity test results in Example 3;

[0025] Figure 3 This is a bar graph of the test results of AQP3 water channel protein in Example 4;

[0026] Figure 4 This is a bar graph of the elastase inhibition rate in Example 5;

[0027] Figure 5 This is a bar graph of the collagen Col-I activity test in Example 6;

[0028] Figure 6 This is a bar graph of the anti-lipid peroxidation expression test of Example 7;

[0029] Figure 7 This is a stability comparison test chart of Example 9. DETAILED DESCRIPTION

[0030] The present invention provides an application of a compound in the preparation of a skin and / or scalp care product. To make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] An embodiment of the present invention provides an application of a compound in the preparation of a skin and / or scalp care product, wherein the compound has the structural formula:

[0032] An embodiment of the present invention provides an application of a composition in the preparation of a skin and / or scalp care product, wherein the composition comprises a compound having the structural formula:

[0033]

[0034] In some embodiments, the skin and / or scalp care product is a cosmetic, medicine or health product for repairing the skin barrier.

[0035] In some embodiments, the skin and / or scalp care product is an anti-aging cosmetic, medicine or health product.

[0036] In some embodiments, the skin and / or scalp care product is a cosmetic, medicine or health product for resisting lipid peroxidation.

[0037] In some embodiments, the skin and / or scalp care product is a cosmetic, medicine or health product that inhibits scalp fungi.

[0038] The embodiment of the present invention provides a skin and / or scalp care product, characterized in that the raw material of the skin and / or scalp care product includes a compound having the following structural formula:

[0039]

[0040] The embodiment of the present invention provides a cosmetic, medicine or health product for repairing the skin barrier and / or anti-aging. The raw materials of the cosmetic, medicine or health product for repairing the skin barrier and / or anti-aging include a compound with the following structural formula:

[0041]

[0042] The embodiment of the present invention provides a cosmetic, medicine or health product for resisting lipid peroxidation. The raw material of the cosmetic, medicine or health product for resisting lipid peroxidation includes a compound having the following structural formula:

[0043] The embodiment of the present invention provides a cosmetic, medicine or health product for inhibiting scalp fungus. The raw materials of the cosmetic, medicine or health product for inhibiting scalp fungus include a compound with the following structural formula:

[0044] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments, and are only for illustrating the present invention but not limiting the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0045] Example 1

[0046] A preparation method of a compound comprises the following steps:

[0047]

[0048] Under nitrogen protection, retinoic acid 1.0 eq. (10 mmol), (2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline) (EEDQ) 1.2 eq. (12 mmol) were added to a 100 mL round-bottom flask, 30 mL tetrahydrofuran (THF) was added, and then stirred at room temperature for 1 hour, and then sphingosine (9.5 mmol) was added to the reaction system, and stirred at room temperature for 26 hours until sphingosine completely disappeared. Post-treatment: quenching with water, extraction with dilute hydrochloric acid, and extraction with saturated brine. The organic layer was separated, dried, filtered and concentrated in vacuo. The residue thus obtained was purified by hanging a silica gel column to obtain the compound with a yield of 70%.

[0049] 1 H NMR (400 MHz, CDCl 3 )δ6.94(dd,J=15.0,11.3Hz,1H),6.30-6.19(m,3H),6.17-6.09(m,2H),5.85-5.75(m,1H),5.74(s,1H), 5.56(dd,J=15.4,6.4Hz,1H),4.37(s,1H),3.98(dt,J=7.5,3.9Hz,2H),3.74(t,J=7.4Hz,1H),2.70(t,J =5.9Hz,2H),2.37(d,J=1.1Hz,3H),2.05(dt,J=12.1,6.4Hz,4H),1.99(d,J=1.1Hz,3H),1.71(d,J=1.0H z,3H),1.62(dd,J=7.4,4.7Hz,2H),1.51-1.40(m,2H),1.25(s,20H),1.03(s,6H),0.88(t,J=6.7Hz,3H).

[0050] Example 2

[0051] Cell scratch test was used to detect the effect of the compound prepared in Example 1 on promoting cell migration

[0052] The cell scratch test is an in vitro test method for studying cell migration. When keratinocytes grow to a fused monolayer state, a blank area (scratch) is artificially created on the fused monolayer of cells. The cells at the edge of the scratch will gradually enter the blank area to heal the "scratch", simulating the migration process of epidermal keratinocytes to a certain extent. By observing the state of cells in the scratch area at different times, the migration ability of cells can be judged. It is an important method in in vitro experiments to study skin wound healing and repair.

[0053] Steps:

[0054] 1. Marking the culture plate. First, use a marker pen to evenly mark horizontal lines on the back of the 6-well plate, approximately every 0.5 to 1 cm, across the holes, with at least 5 lines in each hole. Be careful not to make the lines too thick.

[0055] 2. Add about 5×10 5 cells (different cell numbers vary and are adjusted according to the growth rate of the cells). The inoculation principle is that the fusion rate reaches 100% after overnight.

[0056] 3. Cell streaking. On the second day, use the tip of the pipette to scratch the cell layer perpendicular to the cell plane along the line drawn on the back of the plate on the first day (it is best to use the same pipette tip between different wells).

[0057] 4. Wash the cells. After the scratch is completed, wash the cells three times with sterile PBS to wash away the cells that are not attached to the wall, that is, the cells that are scratched during the scratching process. The gaps left after the scratching are clearly visible, and then replace with fresh serum-free culture medium.

[0058] 5. Cell culture and observation. The sample (compound prepared in Example 1 and retinoic acid) was diluted with culture medium (concentration was 10 mg / L) and added to the cell culture dish. The cells were placed in a 37°C, 5 wt% CO 2 After culture in an incubator for 24 h, the cells were removed and the width of the scratches was measured under a microscope. The scratches were photographed and the healing rate was calculated using Image J software.

[0059] The results are as follows Figure 1 As shown, the compound prepared in Example 1 exhibits a more obvious repair effect on cell damage compared to retinoic acid, and has a better potential to enhance the skin barrier and promote wound healing.

[0060] Example 3

[0061] MTT assay was used to detect the effects of the compound prepared in Example 1 and retinoic acid on the viability of Hacat cells

[0062] HaCaT cells were cultured at 1×104 The cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 hours, the supernatant was discarded, 100 μL of culture medium containing samples (compounds prepared in Example 1, retinoic acid) of different concentrations was added, and the culture medium was removed after further incubation for 24 hours. 100 μL of MTT was added to each well, and the absorbance at 450 nm was measured to calculate the cell survival rate = A 给药孔 / A 空白孔 ×100%.

[0063] The results are as follows Figure 2 As shown, the cell viability of the retinoic acid group decreased significantly with the increase of retinoic acid concentration, and the cell survival rate was only 10.25% at a concentration of 125 mg / L; while the cell viability of the Example 1 compound group did not decrease significantly with the increase of the compound concentration, and the cell survival rate was 82.42% at a concentration of 125 mg / L. Compared with retinoic acid, the compound of Example 1 had no toxic side effects on human keratinocytes within a higher concentration range, showing good biosafety.

[0064] Example 4

[0065] AQP3 cell method to detect the moisturizing effect of retinoic acid and the compound of Example 1

[0066] Aquaporin 3 (AQP3) is a transporter protein factor on the cell membrane that is responsible for the transport of substances such as water, glycerol and urea. It is mainly expressed in keratinocytes and skin fibroblasts. AQP3 is not only involved in skin moisturizing and barrier function, but also plays an important role in skin damage and repair, healing and anti-aging. It is an important guarantee for maintaining normal skin morphology and function.

[0067] Human keratinocytes HaCat cells were cultured at a density of 1×10 4 100 μL of samples (retinoic acid and compound of Example 1) diluted with DMEM medium were added. The blank control group and the model group were both DMEM medium without drug, and each group had 3 replicates. The experimental group and the model group were dried in a clean bench at a wind speed of 0.4 m / s for 20 min, and then incubated in a 5% CO 2 , incubate at 37°C for 24 h. After the reaction, 50 μL of the cell supernatant was taken and the AQP3 cytokine expression was detected using an AQP3 kit.

[0068] The results are as follows Figure 3As shown, the AQP3 expression level of the blank control group was set to 100. When the concentration of retinoic acid was 7.8125 mg / L and 15.625 mg / L, its expression level was 0.86 and 1.73 times that of the control group, respectively; when the concentration of Example 1 compound was 7.8125 mg / L and 15.625 mg / L, its expression level was 3.26 and 3.79 times that of the control group, respectively. The results show that the effect of retinoic acid on AQP3 enhancement is far less than that of the compound of Example 1.

[0069] Example 5

[0070] Elastase inhibition assay to test anti-aging effects

[0071] Elastase inhibition method: Take 2 mL of 2 mg / mL elastase solution, add samples of different concentrations (compound of Example 1 and retinoyl phytosphingosine), vortex thoroughly, shake on a shaker at 37°C and 400 r / min for 20 min, immediately add 5 mL of 0.5 mol / L phosphate buffer at pH 6.0, vortex mix, take an appropriate amount of the mixed solution into a 2 mL centrifuge tube, centrifuge at 9391×g for 10 min, accurately pipette 200 μL of the supernatant into a 96-well plate, measure the absorbance at a wavelength of 495 nm with an enzyme reader, and simultaneously perform a spectral scan from 400 to 800 nm.

[0072] The substrate plus enzyme solution was used as the blank control group, the substrate plus enzyme and sample solution was used as the enzyme inhibition group, and the substrate plus sample without enzyme solution was used as the background subtraction group. Each group was set up with 3 replicates. Inhibition rate (%) = [1-(An

[0073] -An') / (A0-A0')]×100%, where A0 is the absorbance when enzyme is added but no sample is added, A0' is the absorbance when only substrate is added but no sample and enzyme are added, An is the absorbance when only sample solution is added, and An' is the absorbance when sample is added but no enzyme is added. If An'>An, it shows a promoting effect, and the promotion rate (%)=[1-(An'-An) / (A0-A0')]×100%.

[0074] The results are as follows Figure 4 As shown, at the concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L and 31.25 mg / L, the inhibition rates of retinoyl phytosphingosine on elastase were 24.53%, 32.57%, 33.48% and 38.25% respectively; the inhibition rates of the compound of Example 1 on elastase were 30.91%, 42.71%, 43.01% and 44.88%.

[0075] The elastase inhibition rate was concentration-dependent with the compound of Example 1, indicating that the compound of Example 1 has the potential to enhance skin elasticity, and that the compound of Example 1 has a higher elastase inhibition efficiency than retinoyl phytosphingosine.

[0076] Example 6

[0077] Collagen Col-I activity detection

[0078] HFF-1 cells were cultured at 1×10 6 The cells were seeded at a density of 1000 cells / well in a 6-well plate in an atmosphere of 5% CO 2 , incubated overnight at 37°C. After 24 hours, the supernatant was discarded, and 100 μL of culture medium containing samples of different concentrations (compounds of Example 1 and retinoyl phytosphingosine) was added. The blank control group was a DMEM culture medium without drugs, and the positive control was 0.025 mM EGCG. After 24 hours of administration, total RNA was extracted from 3 replicate wells in each group, and the RNA was reverse transcribed into cDNA, and quantified by fluorescence quantitative PCR instrument.

[0079] Primer sequences:

[0080] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0081] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0082] The results are as follows Figure 5 As shown, the relative mRNA expression of Col-I in the blank control group was set to 101.00, the expression of the positive control group was 130.30, and the relative expression of Col-I of Example 1 compound at concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 108.60, 121.20, 134.80, and 141.80, respectively; the relative expression of Col-I of retinoyl phytosphingosine at concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 101.40, 111.30, 118.70, and 133.70, respectively.

[0083] The content of collagen Col-I is closely related to the elasticity and toughness of the skin. Both the compound of Example 1 and retinoyl phytosphingosine can increase the expression of Col-1 and improve the elasticity and toughness of the skin, and the dose dependence is obvious. Compared with retinoyl phytosphingosine, the compound of Example 1 shows a more significant effect of increasing the content of Col-I, and improves the elasticity and toughness of the skin more significantly.

[0084] Example 7

[0085] Anti-lipid peroxidation expression detection

[0086] Lipid peroxidation is the process of ROS oxidizing biological membranes after enhanced oxygen stress, which changes the fluidity and permeability of cell membranes, and ultimately leads to changes in cell structure and function. The TBARS method measures lipid peroxidation expression based on the thiobarbituric acid reactant generated by the reaction of lipid peroxides with TBA.

[0087] Dissolve 3 g of lecithin in 300 mL of PBS (10 mmol / L, pH 7.4); add 75 g of TCA (trichloroacetic acid), 1.875 g of TBA (thiobarbituric acid), and 10.5 mL of concentrated HCl into 500 mL of pure water at once to obtain a TCA-TBA-HCl mixed solution, and mix well; add 1 mL of lecithin, 1 mL of FeSO 4 Solution (400 μM), 1 mL ascorbic acid solution (400 μM), and then add 1 mL sample solution (retinoyl phytosphingosine, Example 1 compound) of different concentrations; mix well and place in a constant temperature water bath (37°C) in a dark place for 60 minutes; then add 2 mL TCA-TBA-HCl mixed solution and place in a water bath at 90-100°C for 15 minutes; cool rapidly at 4000 r / min, take the supernatant and measure the absorbance at 535 nm. Inhibition rate (%) = [(A blank - A sample) / A blank] × 100%.

[0088] The results are as follows Figure 6 As shown, the blank control group was set at 2.44, the positive control group (50 mg / mL squalene) was 18.52%, and at the concentrations of 10 mg / L, 25 mg / L, and 50 mg / L, the lipid peroxidation inhibition rates of retinoyl phytosphingosine were 7.03%, 13.29%, and 23.26%, and the lipid peroxidation inhibition rates of the compound of Example 1 were 11.96%, 25.88%, and 35.06%. The results showed that both retinoyl phytosphingosine and the compound of Example 1 could significantly inhibit the expression of lipid peroxidation, and the inhibitory effect of the compound of Example 1 was more significant.

[0089] Example 8

[0090] Malassezia inhibition test

[0091] Malassezia is a temperature-sensitive fungus that coexists with human skin. It is lipophilic and reproduces in skin oils. Overproduction of Malassezia can cause skin diseases such as Malassezia folliculitis, seborrheic dermatitis, and tinea versicolor.

[0092] The antibacterial test was carried out by the Oxford cup method: 100 μL of the diluted bacterial suspension was inoculated on the surface of the Malassezia solid culture medium plate and evenly spread with an applicator, and a sterile Oxford cup was placed in a culture dish with tweezers. 100 μL of a certain concentration of sample solution (retinoyl phytosphingosine and the compound of Example 1) was drawn into the Oxford cup. Incubated in a 37°C constant temperature incubator for 48 hours, the antibacterial zone was measured and the data was recorded by taking photos. The blank control was normal saline without drug, and the positive control was 2% pyrithione zinc.

[0093] The results are shown in Tables 1 and 2 below. The inhibition zone of the blank group was 7.54 mm, and the inhibition zone of the positive control group was 10.92 mm, indicating that the method is reliable. Under the action of retinoyl phytosphingosine at concentrations of 0.25 mg / mL, 0.5 mg / mL, and 10.9 mm, respectively, the inhibition zone did not change significantly, and was 7.72 mm and 7.91 mm, respectively; under the action of the compound of Example 1 at concentrations of 0.25 mg / mL and 0.5 mg / mL, respectively, the inhibition zone increased significantly, and was 8.89 mm and 10.6 mm, respectively, in a dose-dependent manner. This shows that the compound of Example 1 has a good effect of inhibiting Malassezia, while retinoyl phytosphingosine does not show an effect of inhibiting Malassezia. Through research and exploration, the present invention has found that the compound of Example 1 has a new use of antibacterial, which is a type of biological activity that has not been found in previous ceramide compounds.

[0094] Table 1 Inhibitory effect of retinoyl phytosphingosine on Malassezia

[0095]

[0096] Table 2 Inhibitory effect of the compounds in Example 1 on Malassezia

[0097]

[0098] Example 9

[0099] Example 1 Stability Study of Compounds and Retinoyl Phytosphingosine

[0100] 5 g of each of the compound of Example 1 and retinoyl phytosphingosine samples were taken and stored in a dark, sealed container at room temperature (25±2°C). Samples were taken on the 1st, 3rd, 7th and 30th days, and the purity changes were tested by liquid chromatography PDA at a wavelength of 210 nm. The results are shown in FIG. Figure 7 The purity of the retinoyl phytosphingosine shown is 91.70%, 55.58%, 34.06%, 25.00%, respectively, and the purity decreased by 66.70% within 30 days; the purity of the compound in Example 1 is 92.40%, 91.70%, 92.60%, 92.00%, respectively, and the purity decreased by 0.40% within 30 days.

[0101] From the above results, it can be seen that the compound of Example 1 has better stability than retinoyl phytosphingosine and can be better applied to the formulation system.

[0102] Compared with the compound of Example 1, retinoyl phytosphingosine can form an intramolecular hydrogen bond with the hydroxyl group at the 3rd position due to the presence of the hydroxyl group at the 4th position, thereby enhancing the nucleophilicity of the hydroxyl group at the 3rd position, which in turn makes it easier for the hydroxyl group at the 3rd position to attack the α, β-unsaturated amide fragment on the same face or attack the carbonyl group of the amide to undergo an intramolecular ester exchange side reaction, resulting in the instability of the product.

[0103] Example 10

[0104] 2% Example 1 compound nanoemulsion anti-aging efficacy test

[0105] The compound of Example 1 was prepared into 2% nanoemulsion and its inhibitory effect on elastase was tested.

[0106] Preparation process: The formula of 2% Example 1 compound nanoemulsion is as shown in Table 3. The oil phase (caprylic / capric triglyceride, hexyldecanol, retinoic acid ceramide, tocopheryl acetate, polyglycerol-10 myristate) and the aqueous phase (water, glycerol, hydrogenated lecithin, 1,2-hexanediol, p-hydroxyacetophenone) are stirred and heated separately to dissolve completely; then the oil phase is added to the aqueous phase for emulsification, stirred evenly, and homogenized under high pressure to obtain a nanoemulsion product.

[0107] Table 32% Example 1 Compound Nanoemulsion Formulation

[0108]

[0109]

[0110] At the concentrations of 5.0 mg / L, 10.0 mg / L, 15.0 mg / L and 30.0 mg / L, the inhibition rates of the prepared nanoemulsion on elastase were 27.58%, 36.37%, 39.42% and 43.45%, respectively, indicating that the product has good anti-aging effects.

[0111] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. Use of a compound in the preparation of skin and / or scalp care products, wherein the compound has the structural formula:

2. Use of a composition in the preparation of a skin and / or scalp care product, the composition comprising a compound having the structural formula:

3. The use according to claim 1 or 2, characterized in that: The skin and / or scalp care product is a cosmetic, medicine or health product for repairing the skin barrier.

4. The use according to claim 1 or 2, characterized in that: The skin and / or scalp care product is an anti-aging cosmetic, medicine or health product.

5. The use according to claim 1 or 2, characterized in that: The skin and / or scalp care product is a cosmetic, medicine or health product for resisting lipid peroxidation.

6. The use according to claim 1 or 2, characterized in that: The skin and / or scalp care product is a cosmetic, medicine or health product for inhibiting scalp fungi.

7. A skin and / or scalp care product, characterized in that: The raw materials of the skin and / or scalp care products include compounds having the following structural formula:

8. A cosmetic, medicine or health product for repairing skin barrier and / or anti-aging, characterized in that: The raw materials of the cosmetics, medicines or health products for repairing skin barrier and / or anti-aging include compounds with the following structural formula:

9. A cosmetic, medicine or health product for resisting lipid peroxidation, characterized in that: The raw materials of the cosmetics, medicines or health products for resisting lipid peroxidation include compounds having the following structural formula:

10. A cosmetic, medicine or health product for inhibiting scalp fungus, characterized in that: The raw materials of the cosmetics, medicines or health products for inhibiting scalp fungi include compounds with the following structural formula:

Images