Application of NAT10 as target spot in diagnosis and treatment of acute myelogenous leukemia with high expression of NAT10

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of NAT10 as a target spot in diagnosis and treatment of acute myelogenous leukemia with high expression of NAT10. The invention discloses that the NAT10 can be used as a diagnosis and treatment target of the acute myelogenous leukemia with high expression of the NAT10 for the first time, and the acute myelogenous leukemia with high expression of the NAT10 can be prevented and / or treated by adopting the NAT10 inhibitor; by detecting the content, the expression quantity and / or the activity of the NAT10, the purposes of diagnosis, monitoring, curative effect evaluation and / or prognosis evaluation of the acute myelogenous leukemia with high expression of the NAT10 can be achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of NAT10 as a target in the diagnosis and treatment of acute myeloid leukemia with high NAT10 expression. Background Art

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous hematological malignancy, and its treatment includes multiple strategies such as chemotherapy, targeted therapy, and hematopoietic stem cell transplantation. Currently, chemotherapy remains the core of AML treatment, using drugs to rapidly reduce the leukemia cell load, induce remission, and provide a basis for subsequent stem cell transplantation or other treatments. However, due to the high heterogeneity of hematological tumors, AML patients often have different genetic backgrounds and clinical characteristics, which leads to great differences in the response of different patients to chemotherapy drugs. Therefore, the development of personalized treatment plans for specific subtypes or mutation characteristics is of great significance for the precise treatment of AML.

[0003] Fludarabine is a chemotherapy drug widely used in the treatment of hematological tumors, mainly for chronic lymphocytic leukemia (CLL) and some non-Hodgkin's lymphomas. In addition, FLAG therapy (fludarabine, cytarabine, granulocyte colony-stimulating factor (G-CSF)) with fludarabine as the main ingredient is also often used as a second-line drug for patients with relapsed or refractory AML. Although fludarabine has shown good efficacy in CLL, its application in other hematological malignancies such as AML is still uncertain.

[0004] As an adenosine analog, fludarabine can be absorbed by cells and incorporated into DNA chains. At present, the mechanism of action of fludarabine is mainly believed to be to exert anti-tumor effects by inhibiting DNA synthesis and inducing cell apoptosis, but its specific targets have not yet been fully clarified. This makes the indications of fludarabine in some cases need further research and confirmation, especially in complex hematological tumors such as AML, where individual differences in patients and heterogeneity of the disease may affect the efficacy and safety of fludarabine. Therefore, it is of great significance to clarify the therapeutic targets of fludarabine, conduct in-depth discussions on its efficacy, optimal use scheme, and combined use with other treatments, in order to provide patients with more accurate and effective treatment options. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide use of a NAT10 inhibitor in the preparation of a drug for preventing and / or treating acute myeloid leukemia with high NAT10 expression.

[0006] The second aspect of the present invention aims to provide the use of a substance for detecting NAT10 in the preparation of a product for the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression.

[0007] The third aspect of the present invention aims to provide the use of NAT10 as a target in screening drugs for preventing and / or treating acute myeloid leukemia with high expression of NAT10.

[0008] The fourth aspect of the present invention aims to provide a use of a NAT10 inhibitor in preparing a MENIN inhibitor or in inhibiting the expression of MENIN for non-therapeutic purposes in vitro.

[0009] The fifth aspect of the present invention aims to provide a method for preventing and / or treating acute myeloid leukemia with high expression of NAT10.

[0010] The sixth aspect of the present invention aims to provide a method for diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high expression of NAT10.

[0011] The seventh aspect of the present invention aims to provide a pharmaceutical composition.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] The first aspect of the present invention provides use of a NAT10 inhibitor in the preparation of a medicament for preventing and / or treating acute myeloid leukemia with high NAT10 expression.

[0014] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia.

[0015] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

[0016] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML) and / or FLT3 mutant acute myeloid leukemia.

[0017] In some embodiments, the NAT10-overexpressing acute myeloid leukemia comprises MENIN inhibitor-resistant acute myeloid leukemia.

[0018] In the present invention, NAT10 refers to N-acetyltransferase 10. The Gene ID of human NAT10 in NCBI (https: / / www.ncbi.nlm.nih.gov / ) is 55226, and the Gene ID of mouse Nat10 is 98956. NAT10 is a member of the GCN5-related N-acetyltransferase (GANT) superfamily, and contains multiple domains such as a nuclear localization signal region, an acetyltransferase functional region, and an RNA binding region. NAT10 can participate in the acetylation modification of histones, tubulins, p53 / TP53 and MDM2 proteins in vitro, and promote proteasome degradation through acetylation modification to regulate centrosome replication during mitosis. It is also the only acetyltransferase in the human body that catalyzes acetylcytosine modification (N4-acetylcytidine, ac4C) on RNA. It has been found that it can catalyze ac4C modification on 18SrRNA and tRNA. Recent studies have also found that NAT10 can catalyze ac4C modification in the CDS region of mRNA in HeLa cell lines, thereby enhancing mRNA stability and promoting translation.

[0019] In the present invention, MENIN inhibitor-resistant acute myeloid leukemia refers to acute myeloid leukemia that is resistant or insensitive to clinically commonly used MENIN inhibitors (such as VT P50469, Revumenib (SNDX-5613), Ziftomenib (KO-539), BMF-219, DSP-5336, BN104).

[0020] In the present invention, MENIN protein, encoded by menin 1 (MEN1) gene, is a widely expressed nuclear protein that interacts with DNA replication and repair proteins, chromatin modification proteins, and multiple transcription factors. The accession number of the human gene MEN1 is 4221, and the accession number of the mouse Men1 gene is 17283.

[0021] In some embodiments, the FLT3 mutation comprises at least one of a FLT3-ITD mutation, a FLT3-TKD mutation, and a FLT3-ITD-TKD mutation; further a FLT3-ITD mutation.

[0022] In some embodiments, the MLL gene rearranged acute myeloid leukemia (MLLr AML) comprises at least one of MLL-PTDAML, MLL-AF9 AML, MLL-ELL AML, MLL-AF10 AML, MLL-AF17 AML, MLL-AF6 AML, MLL-ENL AML, MLL-AF1Q AML, MLL-CBP AML, MLL-AF1P AML, and MLL-AFX1 AML; further comprises at least one of MLL-AF9 AML, MLL-ENL AML, and MLL-AF10 AML; and further comprises MLL-AF9 AML.

[0023] In some embodiments, the MENIN inhibitor-resistant acute myeloid leukemia carries MENIN-M327I and / or MENIN-G331R mutations.

[0024] In the present invention, the MENIN-M327I mutation or the MENIN-G331R mutation refers to the following mutations of MENIN (the accession number of the human gene MEN1 is 4221): M327I or G331R.

[0025] In some embodiments, the NAT10 inhibitor inhibits the expression of MENIN.

[0026] In some embodiments, the NAT10 inhibitor prevents and / or treats MENIN inhibitor-resistant acute myeloid leukemia by inhibiting the expression of MENIN.

[0027] In some embodiments, the NAT10 inhibitor comprises at least one of a substance that inhibits NAT10 activity, a substance that degrades NAT10, and a substance that reduces the expression level of NAT10; and further comprises at least one of a substance that inhibits NAT10 activity and a substance that reduces the expression level of NAT10.

[0028] In some embodiments, the substance that reduces the expression level of NAT10 comprises at least one of (a1)-(a3):

[0029] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting NAT10;

[0030] (a2) a nucleic acid molecule expressing (a1);

[0031] (a3) An expression cassette, vector, transgenic cell line, or microorganism comprising (a2).

[0032] In some embodiments, the substance that inhibits NAT10 activity comprises at least one of (b1)-(b3):

[0033] (b1) Antibodies that specifically bind to NAT10;

[0034] (b2) a ligand protein or polypeptide that specifically binds to NAT10;

[0035] (b3) Non-protein compounds that specifically bind to NAT10.

[0036] In some embodiments, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0037] In some embodiments, the (a1) is a shRNA targeting NAT10.

[0038] In some embodiments, the antisense sequence of the shRNA targeting NAT10 is AAATAGCTTCACAACTTTGCG, or ATAGTCACTGTGTACAATTGC.

[0039] In some embodiments, the substance that inhibits the activity of NAT10 is a non-protein compound that specifically binds to NAT10.

[0040] In some embodiments, the non-protein compound that specifically binds to NAT10 comprises at least one of Remodelin (CAS No.: 949912-58-7), fludarabine phosphate, fludarabine, and fludarabine triphosphate, or a pharmaceutically acceptable salt thereof; further comprises at least one of fludarabine phosphate, fludarabine, and fludarabine triphosphate, or a pharmaceutically acceptable salt thereof; further comprises at least one of fludarabine phosphate and fludarabine, or a pharmaceutically acceptable salt thereof; and further comprises fludarabine, or a pharmaceutically acceptable salt thereof.

[0041] In the present invention, Fludarabine Phosphate (PF-ara-A), chemical name: 9-β-D-arabinofuranosyl-2-fluoroadenine-5'-phosphate, i.e. 9-β-Arabinofuranosyl-2-fluoroadenine-5'-monophosphate, is a synthetic adenosine nucleoside analogue in the form of phosphorylated prodrug, CAS: 75607-67-9, molecular formula: C 10 H 13 FN5O7P, molecular weight: 365.2, structural formula is as follows:

[0042]

[0043] Fludarabine (F-ara-A), chemical name: 9-beta-D-arabinofuranosyl-2-fluoro-9H-purin-6-amine, is a product of fludarabine phosphate that is rapidly dephosphorylated by serum phosphatase after entering the body. CAS: 21679-14-1, molecular formula: C 10 H 12 FN5O4, molecular weight: 285.23, structural formula is as follows:

[0044]

[0045] Fludarabine triphosphate (F-ara-ATP), F-ara-A is transported into cells and converted into its main active metabolite, CAS: 74832-57-8, molecular formula: C 10 H 15 F5O 13 P3, molecular weight: 525.17, structural formula is as follows:

[0046]

[0047] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes MLL gene rearranged acute myeloid leukemia (MLLr AML) and / or FLT3 mutation acute myeloid leukemia, and the drug further includes: a MENIN inhibitor; that is, the application is: the use of a NAT10 inhibitor and a MENIN inhibitor in the preparation of a drug for preventing and / or treating acute myeloid leukemia with high NAT10 expression, and the acute myeloid leukemia with high NAT10 expression includes MLL gene rearranged acute myeloid leukemia (MLLr AML) and / or FLT3 mutation acute myeloid leukemia.

[0048] In some embodiments, the MENIN inhibitor comprises at least one of a substance that inhibits MENIN activity, a substance that degrades MENIN, and a substance that reduces the expression level of MENIN; and further comprises a substance that inhibits MENIN activity.

[0049] In some embodiments, the substance that reduces the expression level of MENIN comprises at least one of (c1)-(c3):

[0050] (c1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting MENIN;

[0051] (c2) a nucleic acid molecule expressing (c1);

[0052] (c3) an expression cassette, a vector, a transgenic cell line, or a microorganism comprising (c2).

[0053] In some embodiments, the substance that inhibits MENIN activity comprises at least one of (d1)-(d3):

[0054] (d1) an antibody that specifically binds to MENIN;

[0055] (d2) a ligand protein or polypeptide that specifically binds to MENIN;

[0056] (d3) Non-protein compounds that specifically bind to MENIN.

[0057] In some embodiments, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0058] In some embodiments, the substance that inhibits the activity of MENIN is a non-protein compound that specifically binds to MENIN.

[0059] In some embodiments, the non-protein compound that specifically binds to MENIN comprises at least one of VTP50469, Revumenib (SNDX-5613), Ziftomenib (KO-539), BMF-219, DSP-5336, BN104, or a pharmaceutically acceptable salt thereof; and further comprises VTP50469, or a pharmaceutically acceptable salt thereof.

[0060] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes MLL gene rearranged acute myeloid leukemia (MLLr AML) and / or FLT3 mutation acute myeloid leukemia, and the drug further comprises: when the MENIN inhibitor is used, the molar ratio of the NAT10 inhibitor to the MENIN inhibitor is (0-3, excluding 0): (0-8, excluding 0); further (1-3): (0.25-8); further (1-3): (0.5-8); further (1-3): (1-8); further (1-2): (2-8); further 1.75:8.

[0061] In some embodiments, the pharmaceutically acceptable salt comprises at least one of a metal salt, an ammonium salt, a salt formed with an organic base, a salt formed with an inorganic acid, a salt formed with an organic acid, a salt formed with a basic amino acid, and a salt formed with an acidic amino acid.

[0062] In some embodiments, the metal salt comprises at least one of an alkali metal salt (eg, sodium salt, potassium salt, etc.), an alkaline earth metal salt (eg, calcium salt, magnesium salt, barium salt, etc.), and an aluminum salt.

[0063] In some embodiments, the salt formed with an organic base comprises a salt formed with one or more of the following organic bases: trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine.

[0064] In some embodiments, the salt formed with an inorganic acid comprises a salt formed with one or more of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid.

[0065] In some embodiments, the salt formed with an organic acid comprises a salt formed with one or more of the following organic acids: formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.

[0066] In some embodiments, the salt formed with a basic amino acid comprises a salt formed with one or more of the following basic amino acids: arginine, lysine, ornithine.

[0067] In some embodiments, the salt formed with the acidic amino acid comprises a salt formed with one or more of the following acidic amino acids: aspartic acid, glutamic acid.

[0068] In some embodiments, the drug further comprises other active ingredients for preventing and / or treating acute myeloid leukemia with high expression of NAT10.

[0069] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia, the other active ingredients for preventing and / or treating the acute myeloid leukemia with high NAT10 expression include at least one of dabigatran etexilate (CN118526495A), 3-hydroxyflavone (CN115040504A), and an inhibitor of long non-coding RNA LAMP5-AS1 (CN111733237A).

[0070] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes FLT3 mutation acute myeloid leukemia, the other active ingredients for preventing and / or treating the acute myeloid leukemia with high NAT10 expression include at least one of Salvigenin (CN118340763A), Coumarin7 (CN118340772A), Nigakinone (CN118340778A), Foretinib (CN115137730A), Chelidonine (CN114469950A), and Isoliquiritigenin (CN110123796A).

[0071] In some embodiments, the medicament further comprises a pharmaceutically acceptable excipient.

[0072] In some embodiments, the pharmaceutically acceptable excipient includes at least one of a diluent, an excipient, a binder, a wetting agent, a surfactant, a lubricant, and a disintegrant.

[0073] In some embodiments, the dosage form of the drug is a dosage form suitable for children or a dosage form suitable for adults.

[0074] In some embodiments, the dosage form is selected from a dosage form for enteral administration or a dosage form for parenteral administration.

[0075] In some embodiments, the dosage form for administration via the gastrointestinal tract comprises at least one of powders, tablets, granules, capsules, sustained-release agents, solutions, dry suspensions, effervescent tablets, emulsions, suspensions, syrups, drops, and chewable tablets.

[0076] In some embodiments, the non-intestinal dosage form comprises an injection dosage form (e.g., an injection, including multiple injections such as intravenous injections, intramuscular injections, subcutaneous injections, intradermal injections and intracavitary injections); a respiratory tract dosage form (such as a spray, an aerosol, a powder aerosol, etc.); a skin dosage form (such as an external solution, a lotion, a liniment, an ointment, a plaster, a paste, a patch, etc.); a mucosal dosage form (such as eye drops, nasal drops, eye ointments, gargles, sublingual tablets, adhesive tablets, patches, etc.); and a cavity dosage form (such as suppositories, aerosols, effervescent tablets, drops, pills, etc., used in the rectum, vagina, urethra, nasal cavity, ear canal, etc.).

[0077] In some embodiments, the drug is administered to an animal.

[0078] In some embodiments, the animal is a mammal; further selected from humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and further selected from humans.

[0079] In some embodiments, as an active ingredient of the prepared drug, the mass content of NAT10 inhibitor in the drug is 0.1%-20%, further 1%-10%, for example 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%.

[0080] The second aspect of the present invention provides the use of a substance for detecting NAT10 in the preparation of a product for diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression.

[0081] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia.

[0082] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

[0083] In some embodiments, the FLT3 mutation comprises at least one of a FLT3-ITD mutation, a FLT3-TKD mutation, and a FLT3-ITD-TKD mutation; further a FLT3-ITD mutation.

[0084] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes MLL gene rearranged acute myeloid leukemia (MLLr AML), the diagnosis of the acute myeloid leukemia with high NAT10 expression is to distinguish patients with MLL gene rearranged acute myeloid leukemia from patients with non-MLL gene rearranged acute myeloid leukemia (non-MLLr AML) and / or healthy people.

[0085] In some embodiments, the MLL gene rearranged acute myeloid leukemia comprises MLL-AF9 AML, MLL-ENLAML, and MLL-AF6 AML.

[0086] In some embodiments, the non-MLL gene rearranged acute myeloid leukemia (non-MLLr AML) includes inv(16) AML, t(8;21) AML, and t(15;17) AML.

[0087] In some embodiments, when the NAT10-overexpressing acute myeloid leukemia includes FLT3-mutated acute myeloid leukemia, the diagnosis of the NAT10-overexpressing acute myeloid leukemia is to distinguish between patients with FLT3-mutated acute myeloid leukemia and patients with FLT3 wild-type acute myeloid leukemia and / or healthy people.

[0088] In some embodiments, when the NAT10-overexpressing acute myeloid leukemia includes MENIN inhibitor-resistant acute myeloid leukemia, the diagnosis of the NAT10-overexpressing acute myeloid leukemia is to distinguish between MENIN inhibitor-resistant acute myeloid leukemia patients and MENIN inhibitor-sensitive acute myeloid leukemia patients and / or healthy people.

[0089] In some embodiments, the MENIN inhibitor-resistant acute myeloid leukemia carries MENIN-M327I and / or MENIN-G331R mutations.

[0090] In some embodiments, the MENIN inhibitor-sensitive acute myeloid leukemia carries wild-type MENIN (does not carry a MENIN mutation).

[0091] In some embodiments, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested.

[0092] In some embodiments, the body fluid comprises at least one of blood, lymph, pleural effusion, cerebrospinal fluid, joint fluid, ascites, saliva, lymph, and body fluid.

[0093] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spots, and whole blood.

[0094] In some embodiments, the excreta comprises at least one of urine, feces, and tears.

[0095] In some embodiments, the subject to be tested includes animals; further includes mammals, such as humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice.

[0096] In some embodiments, the subject to be tested comprises a human.

[0097] In some embodiments, the method for detecting a substance for NAT10 comprises quantitatively detecting a substance for NAT10.

[0098] In some embodiments, the substance for detecting NAT10 comprises a substance for detecting NAT10 at the gene level and / or protein level.

[0099] In some embodiments, the substance comprises a substance for one or more detection techniques or methods selected from the following groups: immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immuno-PCR technology, biotin-avidin technology.

[0100] In some embodiments, the immunohistochemistry method comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, co-immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology.

[0101] In some embodiments, the substance for detecting NAT10 is selected from at least one of a substance specific to NAT10, a probe specific to NAT10, a gene chip, a protein chip, and a PCR primer.

[0102] In some embodiments, the substance specific for NAT10 comprises any one of (i1)-(i4):

[0103] (i1) an antibody that specifically binds to NAT10;

[0104] (i2) a ligand protein or polypeptide that specifically binds to NAT10;

[0105] (i3) non-protein compounds that specifically recognize NAT10;

[0106] (i4) Nucleic acid aptamer that specifically recognizes NAT10.

[0107] In some embodiments, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0108] In some embodiments, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip.

[0109] In some embodiments, the product further comprises other substances for detecting the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression.

[0110] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia, the substances for detecting other diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression include at least one of a substance for detecting serine integration factor 2 (CN112662769A), a substance for detecting long non-coding RNA LAMP5-AS1 (CN111733237A), etc.

[0111] In some embodiments, the product further comprises auxiliary detection reagents for gene expression levels, and the auxiliary detection reagents for gene expression levels include: reaction reagents for visualizing the amplicons corresponding to the primers, RNA extraction reagents, reverse transcription reagents, cDNA amplification reagents, standard substances used to prepare standard curves, and at least one of positive controls.

[0112] In some embodiments, the product further comprises an auxiliary detection reagent for protein expression, and the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance used to prepare a standard curve, and a positive control substance.

[0113] The third aspect of the present invention provides the use of NAT10 as a target in screening drugs for preventing and / or treating acute myeloid leukemia with high expression of NAT10.

[0114] In some embodiments, the use is for non-diagnostic or therapeutic purposes.

[0115] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearrangement acute myeloid leukemia, FL T3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia.

[0116] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

[0117] In some embodiments, the FLT3 mutation comprises at least one of a FLT3-ITD mutation, a FLT3-TKD mutation, and a FLT3-ITD-TKD mutation; further a FLT3-ITD mutation.

[0118] In some embodiments, the MLL gene rearranged acute myeloid leukemia (MLLr AML) comprises at least one of MLL-PTD AML, MLL-AF9 AML, MLL-ELL AML, MLL-AF10 AML, MLL-AF17 AML, MLL-AF6 AML, MLL-ENL AML, MLL-AF1Q AML, MLL-CBP AML, MLL-AF1P AML, and MLL-AFX1 AML; and further comprises at least one of MLL-AF9 AML, MLL-ENL AML, and MLL-AF6 AML.

[0119] In some embodiments, the MENIN inhibitor-resistant acute myeloid leukemia carries MENIN-M327I and / or MENIN-G331R mutations.

[0120] A fourth aspect of the present invention provides use of a NAT10 inhibitor in preparing a MENIN inhibitor or in inhibiting the expression of MENIN for non-therapeutic purposes in vitro.

[0121] In some embodiments, the NAT10 inhibitor is the NAT10 inhibitor in the first aspect of the present invention.

[0122] In some embodiments, the MENIN inhibitor is a substance that inhibits the expression of MENIN.

[0123] In some embodiments, the inhibiting the expression of MENIN is inhibiting the expression of MENIN in MOLM13 cells.

[0124] A fifth aspect of the present invention provides a method for preventing and / or treating acute myeloid leukemia with high expression of NAT10, comprising administering an effective amount of a drug to a subject, wherein the drug is the drug in the first aspect of the present invention.

[0125] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearrangement acute myeloid leukemia, FL T3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia.

[0126] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

[0127] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML) and / or FLT3 mutant acute myeloid leukemia.

[0128] In some embodiments, the NAT10-overexpressing acute myeloid leukemia comprises MENIN inhibitor-resistant acute myeloid leukemia.

[0129] In some embodiments, the MLL gene rearranged acute myeloid leukemia (MLLr AML) is the MLL gene rearranged acute myeloid leukemia (MLLr AML) in the first aspect of the present invention.

[0130] In some embodiments, the FLT3 mutant acute myeloid leukemia is the FLT3 mutant acute myeloid leukemia in the first aspect of the present invention.

[0131] In some embodiments, the MENIN inhibitor-resistant acute myeloid leukemia is the MENIN inhibitor-resistant acute myeloid leukemia in the first aspect of the present invention.

[0132] In some embodiments, the subject is an animal.

[0133] In some embodiments, the animal is a mammal; further selected from humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and further selected from humans.

[0134] A sixth aspect of the present invention provides a method for diagnosing, monitoring, evaluating therapeutic efficacy, and / or evaluating prognosis of acute myeloid leukemia with high expression of NAT10, comprising the step of detecting the content, expression level and / or activity of NAT10 in a test sample.

[0135] In some embodiments, the acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearrangement acute myeloid leukemia, FL T3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia.

[0136] In some embodiments, the NAT10-highly expressed acute myeloid leukemia includes MLL gene rearranged acute myeloid leukemia (MLLr AML), FLT3 mutant acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

[0137] In some embodiments, the MLL gene rearranged acute myeloid leukemia (MLLr AML) is the MLL gene rearranged acute myeloid leukemia (MLLr AML) in the second aspect of the present invention.

[0138] In some embodiments, the FLT3 mutant acute myeloid leukemia is the FLT3 mutant acute myeloid leukemia in the second aspect of the present invention.

[0139] In some embodiments, the MENIN inhibitor-resistant acute myeloid leukemia is the MENIN inhibitor-resistant acute myeloid leukemia in the second aspect of the present invention.

[0140] In some embodiments, the test sample is the test sample in the second aspect of the present invention.

[0141] In some embodiments, the method further comprises the step of outputting diagnostic, monitoring, or evaluation information based on the obtained detection results.

[0142] In some embodiments, detecting the content, expression level and / or activity of NAT10 in a test sample is achieved by the product of the second aspect of the present invention.

[0143] A seventh aspect of the present invention provides a pharmaceutical composition comprising a NAT10 inhibitor and a MENIN inhibitor.

[0144] In some embodiments, the NAT10 inhibitor is the NAT10 inhibitor in the first aspect of the present invention.

[0145] In some embodiments, the MENIN inhibitor is the MENIN inhibitor in the first aspect of the present invention.

[0146] In some embodiments, the molar ratio of the NAT10 inhibitor to the MENIN inhibitor is (0-3, excluding 0): (0-8, excluding 0); further (1-3): (0.25-8); further (1-3): (0.5-8); further (1-3): (1-8); further (1-2): (2-8); further 1.75:8.

[0147] In some embodiments, the pharmaceutical composition is used to prevent and / or treat acute myeloid leukemia with high NAT10 expression, wherein the acute myeloid leukemia with high NAT10 expression includes MLL gene rearranged acute myeloid leukemia (MLLrAML) and / or FLT3 mutation acute myeloid leukemia.

[0148] In some embodiments, the MLL gene rearranged acute myeloid leukemia (MLLr AML) and FLT3 mutation acute myeloid leukemia are the MLL gene rearranged acute myeloid leukemia (MLLr AML) and FLT3 mutation acute myeloid leukemia in the first aspect of the present invention.

[0149] In some embodiments, the pharmaceutical composition further comprises other active ingredients for preventing and / or treating acute myeloid leukemia with high expression of NAT10.

[0150] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia, the other active ingredients for preventing and / or treating the acute myeloid leukemia with high NAT10 expression include at least one of dabigatran etexilate (CN118526495A), 3-hydroxyflavone (CN115040504A), and an inhibitor of long non-coding RNA LAMP5-AS1 (CN111733237A).

[0151] In some embodiments, when the acute myeloid leukemia with high NAT10 expression includes FLT3 mutation acute myeloid leukemia, the other active ingredients for preventing and / or treating the acute myeloid leukemia with high NAT10 expression include at least one of Salvigenin (CN118340763A), Coumarin7 (CN118340772A), Nigakinone (CN118340778A), Foretinib (CN115137730A), Chelidonine (CN114469950A), and Isoliquiritigenin (CN110123796A).

[0152] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0153] In some embodiments, the pharmaceutically acceptable excipient includes at least one of a diluent, an excipient, a binder, a wetting agent, a surfactant, a lubricant, and a disintegrant.

[0154] The beneficial effects of the present invention are:

[0155] The present invention discloses for the first time that NAT10 can be used as a diagnostic and therapeutic target for acute myeloid leukemias with high NAT10 expression, such as MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia. By adopting NAT10 inhibitors, acute myeloid leukemias with high NAT10 expression, such as MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia, can be prevented and / or treated; and the purpose of diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemias with high NAT10 expression, such as MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia, can be achieved by detecting the content, expression amount and / or activity of NAT10. BRIEF DESCRIPTION OF THE DRAWINGS

[0156] Figure 1The results show that NAT10 is the target of fludarabine phosphate (PF-ara-A), fludarabine (F-ara-A), and fludarabine triphosphate (F-ara-ATP): a shows that both PF-ara-A and F-ara-ATP can dock with the acetyl-CoA binding pocket of NAT10; b shows that both PF-ara-A and F-ara-ATP can improve the stability of NAT10 in vitro (drug affinity reaction targeted stability test); c shows that both PF-ara-A and F-ara-ATP can improve the stability of NAT10 in vitro (thermodynamic stability test); d shows that fludarabine significantly reduced the level of cellular RNA ac4C.

[0157] Figure 2 The results showed that NAT10 was specifically upregulated in MLL gene rearranged acute myeloid leukemia and FLT3 mutation acute myeloid leukemia: a showed that the expression of NAT10 in acute myeloid leukemia was significantly higher than that in healthy subjects and myelodysplastic syndrome; b showed that the expression of NAT10 in MLL gene rearranged acute myeloid leukemia was significantly higher than that in healthy subjects or other subtypes of AML (non-MLLr AML); c showed that the expression of NAT10 in FLT3 mutant acute myeloid leukemia was significantly higher than that in FLT3 wild-type acute myeloid leukemia; d showed that compared with normal human peripheral blood PBMC or AML cell line Kasumi-1 (without MLLr or FLT3-ITD mutations), the expression of NAT10 was significantly increased in MOLM13 (carrying MLL-AF9 and FLT3-ITD mutations), MonoMac6 (carrying MLL-AF9), and THP-1 (carrying MLL-AF9); the expression level of NAT10 in primary AML patient leukemia cells carrying MLLr fusion gene (Patient#1, Patient#2, Patient#3) or PDX cells (PDX#1) with FLT3-ITD mutation genetic background was also significantly increased compared with normal human peripheral blood PBMC; e showed that the expression of NAT10 in mouse hematopoietic stem progenitor cells (HSPC) transformed by MLL oncogenic fusion gene was significantly upregulated (n=5).

[0158] Figure 3The results showed that inhibiting the expression of NAT10 can prevent and / or treat MLL gene rearrangement acute myeloid leukemia and FLT3 mutation acute myeloid leukemia: a showed that shNAT10-1 and shNAT10-2 can inhibit the expression of NAT10; b showed that knocking down NAT10 in the AML cell line MOLM13 carrying the MLL-AF9 fusion gene and the FLT3-ITD mutation genetic background can significantly inhibit cell growth; c showed that knocking down NAT10 in primary AML patient leukemia cells carrying the MLL-AF9 fusion gene or patient-derived tumor xenograft (PDX) cells with the FLT3-ITD mutation genetic background can significantly inhibit cell growth; d showed that knocking down NAT10 can significantly inhibit the ability of MLL-AF9 to transform mouse HSPC cells (n=2); e showed that knocking down NAT10 can significantly inhibit the ability of MLL-AF9 to transform mouse HSPC cells (n=2); f showed that knocking down NAT10 can significantly prolong overall survival; g showed that knocking down NAT10 can significantly prolong overall survival.

[0159] Figure 4 The results showed that fludarabine can significantly inhibit the growth of human cell lines carrying MLLr and / or FLT3-ITD, primary cells of AML patients carrying MLLr, and PDX cells carrying FLT3-ITD: a showed that fludarabine can significantly inhibit the growth of human cell lines MOLM13, MonoMac6, and THP-1 carrying MLLr and / or FLT3-ITD; b showed that fludarabine can significantly inhibit the growth of primary cells of AML patients carrying MLLr, and PDX cells carrying FLT3-ITD; c showed that fludarabine has better inhibitory effect on AML cell lines MOLM13, MonoMac6, and THP-1 carrying MLLr and / or FLT3-ITD mutations than on AML cell lines NB4 and Kasumi-1 not carrying MLLr or FLT3-ITD mutations; d showed that fludarabine inhibited the colony formation of mouse leukemia cells in a concentration-dependent manner (n=2).

[0160] Figure 5 The results show that fludarabine phosphate can prevent and / or treat MLL gene rearrangement acute myeloid leukemia: a shows that fludarabine phosphate can significantly improve the survival time of C1498 allogeneic transplanted AML mice; b shows that fludarabine phosphate can significantly alleviate the splenomegaly of C1498 allogeneic transplanted AML mice; c shows that fludarabine phosphate has no effect on the body weight of C1498 allogeneic transplanted AML mice.

[0161] Figure 6It shows that inhibiting the expression, content and / or activity of NAT10 can inhibit the expression of MENIN: among them, a shows that fludarabine can inhibit the expression of MENIN; b shows that knocking down NAT10 in MOLM13 cells can downregulate the expression of MENIN; c shows the protein schematic diagram of MENIN-WT, MENIN-M327I, and MENIN-G331R; d shows that MOLM13 cells stably expressing MENIN-WT wild type, MENIN-M327I mutant, or MENIN-G331R mutant were successfully constructed.

[0162] Figure 7 The inhibitory effects of fludarabine and Revumenib on MOLM13 cells stably expressing MENIN-WT wild-type, MENIN-M327I mutant, or MENIN-G331R mutant are shown: a shows that MOLM13 cells stably expressing MENIN-M327I mutant or MENIN-G331R mutant are significantly less sensitive to Revumenib than MOLM13 cells stably expressing MENIN-WT wild-type; b shows that fludarabine has a significant inhibitory effect on MOLM13 cells stably expressing MENIN-M327I mutant or MENIN-G331R mutant. The IC50 in MOLM13 cells expressing the 327I mutant or the MENIN-G331R mutant was basically consistent with that in MOLM13 cells stably expressing the MENIN-WT wild type; c showed that the expression of NAT10 in MOLM13 cells overexpressing the MENIN mutant was significantly higher than that in MOLM13 cells overexpressing the MENIN wild type or healthy human PBMCs; d showed that knocking down NAT10 in both MENIN-resistant and non-resistant cells significantly inhibited cell proliferation, ***, P<0.001.

[0163] Figure 8 It was shown that the simultaneous use of NAT10 inhibitor and MENIN inhibitor VTP50469 in MOLM13 cells had a significant combined effect. DETAILED DESCRIPTION

[0164] The present invention is further described in detail below through specific examples.

[0165] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0166] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials and reagents used in the examples are commercially available unless otherwise specified. The manufacturers of the reagents used are indicated, and similar products from other manufacturers are substitutes.

[0167] The quantitative tests in the following examples were performed in triplicate unless otherwise specified.

[0168] Drug dissolution and storage

[0169] Fludarabine (F-ara-A, S1491, Selleck) and Revumenib (S8996, Selleck) were dissolved in DMSO (Sigma-Aldrich) at a concentration of 10 mM as a stock solution. They were diluted to 10× drug working solution using RPMI 1640 medium containing 10% FBS and added to cells to make the final drug concentration 1×. In animal experiments, mice were intraperitoneally injected with fludarabine phosphate (PF-ara-A, MedChem Express, HY-B0028). Fludarabine phosphate was dissolved in DMSO at a concentration of 150 mM as a stock solution, and then diluted to 2 mg / mL with normal saline and injected intraperitoneally into mice.

[0170] Cell line source

[0171] HEK293T (CRL-3216), THP-1 (TIB-202), Kasumi-1 (CRL-2724), and C1498 (TIB-49) were purchased from the American Type Culture Collection (ATCC). MOLM13 (ACC-554), MonoMac6 (ACC-124), and NB4 (ACC-207) were purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ). All cell lines used were authenticated by STR analysis.

[0172] MTT assay

[0173] The MTT experiment was performed by inoculating cells on the 4th day after infection into a 96-well cell culture plate, adding MTT dye on the first, second, third, and fourth days and incubating for 4 hours before terminating. The cell growth curve was drawn by analyzing the absorbance values.

[0174] For drug experiments, 10× drug working solution or control was added after inoculating cells to make the final drug concentration 1×. After 3 days of culture, MTT dye was added and incubated for 4 hours before termination. Cell growth curves were drawn by analyzing absorbance values ​​and IC50 of drugs was calculated to evaluate the effect of drugs on target cell growth. The evaluation of drug combination effects was calculated on the SynergyFinder+ (https: / / synergyfinder.org) website.

[0175] Mouse HSPC cell isolation, transformation and colony formation assay (CFA)

[0176] From 5 to 7 weeks old wild type, Nat10 + / + CreERT2(WT) or Nat10 fl / fl Bone marrow (BM) cells were collected from CreERT2 (cKO) mice, and hematopoietic stem / progenitor cells (HSPC) were enriched from the bone marrow cells using CD117 magnetic beads (130-091-224, Miltenyi Biotec).

[0177] HSPC cells were transformed by one or two rounds of centrifugal infection with retrovirus carrying Vector empty vector, MLL-AF9, MLL-AF10, MLL-ENL fusion genes (plasmid information from published literature: Weng H, Huang H, Wu H, et al. METTL14 inhibits shematopoietic stem / progenitor differentiation and promotes leukemogenesis via mRNA m6A modification. Cell stem cell 2018, 22 (2): 191-205). The transformed cells were inoculated in mouse methylcellulose matrix gel (HSC006, R&D), which was supplemented with 10 ng / mL of mouse recombinant interleukin-3 (IL-3), 10 ng / mL of human recombinant interleukin-6 (IL-6), 10 ng / mL of mouse granulocyte-macrophage colony stimulating factor (GM-CSF) and 50 ng / mL of mouse stem cell factor (SCF). The above growth factors were purchased from Sino Biological or PeproTech. The clones were cultured at 37°C for 5-7 days and the first generation cells were collected for detection of Nat10 expression.

[0178] When necessary, (Z)-4-hydroxytamoxifen (Sigma-Aldrich) dissolved in ethanol was added to a final concentration of 1 μM to knock down Nat10, or during viral infection, Nat10-shRNA (the antisense strands of shNat10-1 and shNat10-2 were AAATAGCT TCACAACTTTGCG (SEQ ID NO: 1) or ATAGTCACTGTGTACAATTGC (SEQ ID NO: 2)) lentivirus was added to knock down Nat10. For serial passage detection, clones were collected every 5-7 days and then re-seeded in methylcellulose medium.

[0179] In the experiment of detecting the effect of drugs on clone formation, 10× drug working solution or control solvent should be added to the matrix gel to make the final drug concentration 1×. The number of colonies is counted after 7 days of culture to evaluate the effect of drugs on the colony formation ability of leukemia stem and progenitor cells.

[0180] Bone marrow transplantation in first generation AML mice

[0181] The 0.2×10 6 Donor cells transformed by MLL-AF9 and knocked down Nat10 and 1.0×10 collected from B6.SJL (CD45.1) or C57BL / 6 (CD45.2) mice 6 Normal bone marrow cells were transplanted into lethally irradiated (500 cGy twice, 86 cGy / min) 7- to 9-week-old B6.SJL (CD45.1) or C57BL / 6 (CD45.2) recipient mice by tail vein injection. fl / fl For bone marrow transplantation of CreERT2 bone marrow cells, 0.2×10 6 Donor cells from CFA and 1.0×10 from B6.SJL (CD45.1) 6 The mice were combined with normal bone marrow cells for transplantation. Two weeks after transplantation, recipient mice were injected intraperitoneally with tamoxifen (75 mg / kg, T5648, Sigma-Aldrich) five times every other day to induce Nat10 gene knockout. When mice showed signs of systemic disease, such as apathy, huddled posture, inability to eat, disheveled hair, or self-mutilation, the animals were immediately killed by CO2 inhalation or cervical dislocation.

[0182] C1498 allograft model construction

[0183] 1.0×10 6 Live C1498 cells were transplanted into 7- to 9-week-old C57BL / 6 recipient mice irradiated with sublethal doses (300 cGy, 86 cGy / min) by tail vein injection. One week after transplantation, the recipient mice began to receive fludarabine phosphate treatment (Fludarabine phosphate, HY-B0028, MedChem Express) at a dose of 200 mg / kg for a total of 10 times (5 consecutive days with a 5-day interval). The experiment was terminated on the 50th day of observation, and the survival time of the mice was recorded. The mice were dissected at the end of the experiment (the time when the mice became ill or reached the end of the experiment) to observe the size of the spleen. The weight of the mice was monitored every other day during the administration period.

[0184] AML patient cells and PDX cell construction

[0185] AML patient samples were obtained by purifying leukemic mononuclear cells (MNCs) from patient bone marrow samples (with MLLr gene genetic background) by Ficoll (Solarbio). Normal human peripheral blood mononuclear cells were obtained by purifying mononuclear cells (MNCs) by Ficoll (Solarbio). PDX cells were obtained by purifying 1.0×10 6 Bone marrow leukemia cells from a living AML patient carrying the FLT3-ITD mutation were injected into NSG immunodeficient mice via the tail vein. After 3 months of observation, when the mice showed obvious signs of disease, the leukemia cells in the mouse bone marrow were collected and sorted using hCD45 (130-045-801, Miltenyi Biotec) magnetic beads to separate the human leukemia cells, namely PDX cells.

[0186] Drug affinity reaction targeted stability test

[0187] Collect 1×10 7 MOLM13 cells were washed with precooled PBS and then lysed on ice with 200 μL M-PER buffer (78501, Thermo Fisher Scientific), and a protease inhibitor cocktail (04693116001, Roche) and a phosphatase inhibitor cocktail (P1082, Beyotime) were added to the lysate for 10 minutes. The supernatant was then transferred to a new tube at 4°C with 18,000 × g centrifugation for 10 minutes and mixed with 10 × TNC buffer (500 mMTris-HCl, pH 8.0, 500 mM NaCl, 100 mM CaCl2). Protein concentration was determined using BCA assay (BL521A, Biosharp). 300 μg of lysate was incubated with Remodelin (S7641, Selleck), fludarabine phosphate (PF-ara-A, MedChem Express) or fludarabine triphosphate (F-ara-ATP, MedChem Express) at concentrations ranging from 0 to 200 μM for 1-2 hours at room temperature. Pronase (10165921001, Roche, 1:400-1:500) digestion was then performed at room temperature for 30 minutes. The samples were then immediately placed on ice. SDS loading buffer was added and the samples were subjected to protein immunoblotting. ACTB (β-actin, 66009-1-Ig, Proteintech) was used as a negative control.

[0188] Thermodynamic stability test

[0189] Collect 1×10 7MonoMac6 cells were treated with 500 μM Remodelin (S7641, Selleck), 500 μM Fludarabine (Selleck), or DMSO (Sigma-Aldrich) for 2 h. Equal amounts of cells were collected and washed twice with PBS and then resuspended in 0.7 mL of PBS supplemented with a protease inhibitor cocktail (04693116001, Roche). The samples were aliquoted into 12 different PCR tubes, 50 μL in each tube. The samples were then heated at the specified temperature for 3 min in a preheated thermal cycler and immediately allowed to equilibrate to room temperature. Finally, the samples underwent 3-5 freeze-thaw cycles of dry ice and room temperature to lyse the cells and were centrifuged at 20,000 × g for 20 min at 4 °C. The supernatant was mixed with 5× SDS loading buffer and heated for protein immunoblotting. The band intensity of the target protein was quantified and graphed using Tan on Image software.

[0190] Dot blot

[0191] RNA was mixed with 3 volumes of RNA incubation buffer (65.7% formamide (Dingguo), 7.77% formaldehyde (Guangzhou Chemical Reagent Factory) and 1.33×MOPS (Shanggong Biotechnology)) and denatured at 65°C for 5 minutes, then placed on ice for 2 minutes and mixed with 1 volume of 20×SSC. Subsequently, the RNA sample was spotted onto a Hybond-N+ membrane (RPN303B, G-CLONE) using a Bio-Dot instrument (Bio-Rad). After UV cross-linking, the membrane was stained with 0.02% methylene blue trihydrate (MB) (McLean) in 0.3 M sodium acetate (Sigma-Aldrich). The membrane was then washed with Tris-buffered saline (TBST, Biosharp) containing Tween (Solarbio) and blocked with 5% skim milk powder (Beyotime) in TBST for 1 hour at room temperature. After three TBST washes, the membrane was incubated with anti-ac4C antibody (1:1000, ab252215, Abcam) at 4°C overnight. Next, the membrane was washed three times with TBST again and incubated with HRP-labeled rabbit anti-IgG secondary antibody (1:10000, SA00001-2, Proteintech) for 1 hour at room temperature. After three TBST washes, the membrane was immunoblotted with Femto-Sensitive ECL solution (MK-01000, MIKX). The grayscale quantitative values ​​shown are relative levels corrected with the control (MB).

[0192] Western blot (WB)

[0193] The cells were collected and washed twice with PBS and then directly lysed with 1× SDS buffer at 95°C for 10 min. Equal amounts of cell lysates were separated by SDS-PAGE and transferred to PVDF membranes (Merck Millipore). The membranes were blocked with 5% skim milk powder (Beyotime) in TBST for 1 h at room temperature and then washed three times with TBST. Subsequently, the membranes were incubated with primary antibodies overnight at 4°C and washed three times with TB ST. After incubation with HRP-labeled secondary antibodies (1:10000, Proteintech) for 1 h at room temperature, the membranes were washed again with TBST three times and immunoblotted using Femto-Sensitive ECL solution (MK-01000, MIKX). Protein immunoblot signals were quantified using Tanon Image software. The grayscale quantitative values ​​shown are relative levels after internal reference correction.

[0194] Example 1. Diagnosis and treatment of MLL gene rearrangement acute myeloid leukemia and FLT3 mutation acute myeloid leukemia

[0195] 1. Fludarabine phosphate (also known as PF-ara-A, CAS: 75607-67-9) is a synthetic adenosine nucleoside analog. As a prodrug, it is rapidly dephosphorylated by serum phosphatases to free F-ara-A (CAS: 21679-14-1), which is then transported into cells and converted into its 5'-triphosphate form, F-ara-ATP (fludarabine triphosphate), which is the main active metabolite. Molecular docking experiments showed that both fludarabine phosphate and F-ara-ATP can dock with the acetyl-CoA binding pocket of NAT10 ( Figure 1 The drug affinity responsive target stability assay (DARTS) and the thermodynamic stability assay (CEllular Thermal Shift Assay, CETSA) unexpectedly found that fludarabine phosphate, fludarabine and F-ara-ATP could improve the stability of NAT10 in vitro, suggesting that fludarabine phosphate, fludarabine and F-ara-ATP could target NAT10 ( Figure 1 Dot blot showed that fludarabine significantly reduced the level of cellular RNA ac4C in the MOLM13 cell line ( Figure 1 (d) further illustrates that NAT10 is an important target of fludarabine.

[0196] 2. Through data analysis, it was observed that the expression level of NAT10 in bone marrow mononuclear cells (BM-MNCs) of patients with acute myeloid leukemia (AML) was higher than that in healthy controls and patients with myelodysplastic syndrome (MDS). Figure 2 Furthermore, it was found that the expression of MLL in t(11q23) / MLL rearranged (MLLr) acute myeloid leukemia (MLL-AF9(AM050804.1) AML, MLL-ENL(AM050805.1) AML, MLL-AF6 AML) was significantly higher than that in other subtypes of AML (non-MLLr AML: inv(16) AML, t(8;21) AML, and t(15;17) AML) and healthy controls ( Figure 2 b), and the expression in FLT3-ITD mutation cases was also higher than that in FLT3 wild-type AML cases ( Figure 2 In addition, Western blot results showed that compared with normal human peripheral blood PBMC or AML cell line Kasumi-1 (without MLLr and / or FLT3-ITD mutations), NAT10 expression was significantly increased in AML cell lines including MOLM 13 (carrying MLL-AF9 and FLT3-ITD mutations), MonoMac6 (carrying MLL-AF9), and THP-1 (carrying MLL-AF9) ( Figure 2 d). The expression level of NAT10 in primary AML patient leukemia cells carrying the MLLr fusion gene (Patient#1, Patient#2, Patient#3) or patient-derived tumor xenograft (PDX) cells (PDX#1) with a genetic background of FLT3-ITD mutation was also significantly increased compared with that in normal human peripheral blood PBMC ( Figure 2 (d) Transformation of mouse hematopoietic stem cells (HSPCs) with the MLL oncogenic fusion gene significantly activated the expression of NAT10 ( Figure 2 (e)

[0197] Knocking down NAT10 (using the above-mentioned shNat10-1 and shNat10-2) in the AML cell line MOLM13 carrying the MLL-AF9 fusion gene and the FLT3-ITD mutation genetic background can significantly inhibit cell growth ( Figure 3Knockdown of NAT10 (using the above-mentioned shNat10-1 and shNat10-2) in primary AML patient leukemia cells carrying the MLLr fusion gene or patient-derived tumor xenograft (PDX) cells with a genetic background of FLT3-ITD mutation can significantly inhibit cell growth ( Figure 3 Middle c). Knockdown or knockout of Nat10 can significantly inhibit the ability of MLL-AF9 to transform mouse HSPC cells ( Figure 3 d and e), the cells were transplanted into recipient mice, and the overall survival of recipient mice in the Nat10 knockdown or knockout groups was significantly prolonged compared with the control group ( Figure 3 f and g).

[0198] These research results indicate that NAT10 plays an important role in the occurrence and development of MLLr and FLT3-ITD mutant AML: NAT10 can be used as a diagnostic marker for MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation (such as FLT3-ITD mutation) acute myeloid leukemia, and reducing the expression of NAT10 can achieve the purpose of preventing and / or treating MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation (such as FLT3-ITD mutation) acute myeloid leukemia.

[0199] 3. Human cell lines MOLM13 cells, MonoMac6 cells, THP-1 cells carrying MLLr and / or FLT3-ITD, human cell lines NB4 cells and Kasumi-1 cells without MLLr and / or FLT3-ITD (i.e., human cell lines NB4 cells and Kasumi-1 cells without MLLr and / or FLT3-ITD mutations), primary cells of AML patients carrying MLLr (Patient), or PDX cells carrying FLT3-ITD (PDX), and normal human donor peripheral blood mononuclear cells (PBMC, Healthy) were cultured at 1×10 5The cells were inoculated into 96-well plates at a concentration of 1 μM / mL, and fludarabine (F-ara-A) at the corresponding concentrations (final concentrations were 0.5 μM, 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, and 32 μM, respectively) was added, and the final volume of each well was 100 uL. After 72 hours of culture, MTT assay was performed to detect cell activity. The culture medium for MOLM13 cells and NB4 cells was RPMI 1640 medium containing 10% fetal bovine serum (FBS). The culture medium for Kasumi-1 cells was RPMI 1640 medium containing 20% ​​fetal bovine serum (FBS). For MonoMac6 cells, 1× non-essential amino acids (Thermo Fisher Scientific), 1 mM sodium pyruvate (Thermo Fisher Scientific), 10 mM HEPES (Ther mo Fisher Scientific), and 9 μg / mL insulin (Thermo Fisher Scientific) were added to the regular RPMI-1640 medium. For THP-1 cells, 2.5 g / L D-glucose solution (Thermo Fisher Scientific), 0.11 g / L sodium pyruvate (Thermo Fisher Scientific), 2.383 g / L HEPES (Thermo Fisher Scientific), and 1×2-mercaptoethanol (Thermo Fisher Scientific) were added to the regular RPMI-1640 medium. Primary cells from AML patients, PDX cells, and normal human PBMCs were cultured in RPMI1640 medium supplemented with 20% fetal bovine serum (FBS) and 100 ng / mL stem cell factor (SCF, PeproTech), 100 ng / mL Flt-3 ligand (Flt-3L, Pepro Tech), 50 ng / mL thrombopoietin (TPO, PeproTech), 10 ng / mL interleukin-3 (IL-3, PeproTech), and interleukin-6 (IL-6, Sino Biological).

[0200] The results are as follows Figure 4As shown in a, b, and c: the IC50 of human cell line MOLM13 cells carrying MLLr and / or FLT3-ITD, primary cells of AML patients carrying MLLr, or PDX cells carrying FLT3-ITD is significantly lower than that of normal human PBMC cells, and the inhibitory effect of fludarabine on human cell line MOLM13 cells, MonoMac6 cells, and THP-1 cells carrying MLLr and / or FLT3-ITD is significantly better than that on human cell line NB4 cells and Kasumi-1 cells not carrying MLLr or FLT3-ITD, indicating that fludarabine specifically has a good inhibitory effect on the growth of human cell lines, primary cells of AML patients, and PDX cells carrying MLLr and / or FLT3-ITD.

[0201] 4. Perform in vitro colony formation on leukemia cells from mice with AML induced by transplantation of malignant HSPC cells transformed by MLL-AF9, and count 4×10 4 cells, inoculated into 3 mL mouse methylcellulose matrix gel, added 10 ng / mL mouse recombinant interleukin-3 (IL-3), 10 ng / mL human interleukin-6 (IL-6), 10 ng / mL mouse granulocyte-macrophage colony stimulating factor (GM-CSF) and 50 ng / mL mouse stem cell factor (SCF), and added fludarabine (F-ara-A, final concentrations of 10 and 20 μM, respectively) or control solvent, observed for 7 days, and counted the number of colonies. Results are shown in Figure 4 In the figure (d), fludarabine significantly inhibited the colony formation of mouse leukemia cells in a concentration-dependent manner.

[0202] 5. 1.0×10 6 The syngeneic transplantation model was constructed by transplanting live C1498 cells into 7- to 9-week-old C57BL / 6 recipient mice irradiated with sublethal doses (300 cGy, 86 cGy / min) via tail vein injection. One week after transplantation, the recipient mice began to be treated with fludarabine phosphate (Fludarabine phosphate, HY-B0028, MedChemExpress, Fludarabine) by intraperitoneal injection at a dose of 200 mg / kg for 5 consecutive days, followed by a 5-day interval, and then a second round of 5-day continuous administration.

[0203] Results Figure 5 As shown: Compared with the control group (solvent group), the survival time of mice treated with fludarabine phosphate was significantly better than that of the control group, and the spleen enlargement of mice was significantly alleviated. There was no significant difference in the body weight of mice treated with fludarabine phosphate and the control group.

[0204] The above results indicate that NAT10 can be used as a diagnostic marker for MLL gene rearrangement acute myeloid leukemia or FLT3 mutation (e.g., FLT3--ITD mutation) acute myeloid leukemia, and that the purpose of preventing and / or treating MLL gene rearrangement acute myeloid leukemia or FLT3 mutation (e.g., FLT3--ITD mutation) acute myeloid leukemia can be achieved by inhibiting the expression, content and / or activity of NAT10.

[0205] In addition, NAT10 inhibitor fludarabine (final concentrations of 0 μM, 1 μM, 1.75 μM, 2 μM, and 3 μM, respectively) and MENIN inhibitor VTP50469 (Selleck, S8934) (final concentrations of 0 μM, 0.25 μM, 0.5 μM, 1 μM, 2 μM, 4 μM, and 8 μM, respectively) were added simultaneously to MOLM13 cells (ACC-554, carrying MLL-AF9 and FLT3-ITD mutations) to detect the combined effect on the inhibitory effect on cell activity.

[0206] In addition, the simultaneous use of NAT10 inhibitor and MENIN inhibitor VTP50469 in MOLM13 cells had a significant combined effect ( Figure 8 , Synergy score greater than 0, indicating that the two have synergistic synergy, and the larger the Synergy score, the more obvious the synergy), that is, NAT10 inhibitor and MENIN inhibitor VTP50469 have synergistic effects in preventing and / or treating MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation (such as FLT3-ITD mutation) acute myeloid leukemia; wherein, when the final concentration of NAT10 inhibitor fludarabine is 1-2 μM, and the final concentration of MENIN inhibitor VTP50469 is 2-8 μM, its Synergy score is 12.52-29.19, the combined effect is good (greater than 10 means a good combined effect), and the combined inhibition efficiency of MOLM13 cells is 38.9-90%; when the final concentration of NAT10 inhibitor fludarabine is 1.75 μM, and the final concentration of MENIN inhibitor VTP50469 is 8 μM, its Synergy score is 12.52-29.19, the combined effect is good (greater than 10 means a good combined effect), and the combined inhibition efficiency of MOLM13 cells is 38.9-90%; when the final concentration of NAT10 inhibitor fludarabine is 1.75 μM, and the final concentration of MENIN inhibitor VTP50469 is 8 μM, its Synergy score is 12.52-29.19, the combined effect is good (greater than 10 means a good combined effect), and the combined inhibition efficiency of MOLM13 cells is 38.9-90%. The score was 29.19, the combined effect was the best, and the combined inhibition efficiency on MOLM13 cells was 88.8%.

[0207] Example 2. Diagnosis and treatment of MENIN inhibitor-resistant acute myeloid leukemia

[0208] 1. Treat MOLM13 cells with fludarabine (2 μM) for 72 hours, collect the cells, and detect the protein expression of MENIN by western blot. It was found that the expression of MENIN was significantly inhibited ( Figure 6Knockdown of NAT10 in MOLM13 cells (using the above shNat10-1 (sh1), shNat10-2 (sh2)) can also significantly inhibit the protein expression of MENIN ( Figure 6 b). That is, the protein expression of MENIN can be significantly inhibited by inhibiting the expression, content and / or activity of NAT10.

[0209] 2. MENIN inhibitors, such as Revumenib (SNDX-5613), VTP50469, etc., have become promising therapeutic drugs for MLL rearrangement or NP M1 mutant AML. However, patients often develop resistance to MENIN inhibitors due to somatic mutations of MENIN (4221) (e.g., M327I or G331R) (information from published literature: Perner F, Stein EM, Wenge DV, et al. MEN1 mutations mediate clinical resistance to menininhibition. Nature 2023, 615 (7954): 913-919). Given that NAT10 inhibitors can effectively reduce the level of MENIN, this example explores the potential of NAT10 inhibitors in overcoming MENIN inhibitor resistance.

[0210] The overexpression vectors of wild-type and mutant (M327I and G331R) MENIN and MOLM13 cells containing the vectors were constructed as follows: primers (forward primer: TGACGACAAGGAATTCATGGGGCTGAAGGCCG (SEQ ID NO: 3) and reverse primer: GATCCCTAGGGAATTTCAGAGGCCTTTGCGCTG (SEQ ID NO: 4)) were designed to amplify the full-length sequence of the CDS region of MENIN (4221) from the cDNA of MOLM13, and inserted into the pCL20C vector 2×FLAG to construct the pCL20C-MENIN-WT expression plasmid. The wild-type plasmid was subjected to point mutation using the Site-Directed Mutagenesis Kit (New England Biolabs, #E0554) to construct pCL20C-MENIN-M327I and G331R mutant plasmids. Lentivirus packaging uses psPAX2 and pMD2.G series plasmids, that is, pCL20C-MENIN expression plasmid (pCL20C-MENIN-WT expression plasmid, pCL20C-MENIN-M327I mutant plasmid, or pCL20C-MENIN-G331R mutant plasmid) is co-transfected with psPAX2 and pMD2G into 293T cells, and the cell culture supernatant of 48-72 hours is collected to infect MOLM13 cells. After 48 hours, MOLM13 cells successfully transfected with the MENIN gene are screened by 10 μg / mL blasticidin to obtain MOLM13 cells stably expressing the MENIN-WT wild type, MENIN-M327I mutant, or MENIN-G331R mutant ( Figure 6 (c and d).

[0211] The above cells were inoculated in a 24-well plate, and Revumenib was added to make the final concentrations of 0nM, 320nM, 640nM, 1280nM, and 2560nM, respectively. The final volume of each well was 100μL, and the cell concentration was 1×10 5 / mL, cell passage was performed every 3 days, and corresponding concentrations of Revumenib were continuously added. MTT assay, cell counting and statistics were performed on the 12th day, and the curve was drawn.

[0212] The results are as follows Figure 7 As shown in a: MOLM13 cells stably expressing MENIN-M327I mutant or MENIN-G331R mutant are significantly less sensitive to Revumenib than MOLM13 cells stably expressing MENIN-WT wild type. At the same time, it further shows that MOLM13 cells stably expressing MENIN-M327I mutant or MENIN-G331R mutant can be used as a MENIN inhibitor-resistant cell model.

[0213] The above cells were inoculated in 96-well plates, and corresponding concentrations of fludarabine (F-ara-A) were added (final concentrations were 0 μM, 2 μM, 4 μM, 8 μM, and 16 μM, respectively). The final volume of each well was 100 μL, and the cell concentration was 1×10 5 / mL, cultured for 72 hours, performed MTT assay, cell counting and statistics, and drew curves.

[0214] The results are as follows Figure 7As shown in b: The IC50 of Fludarabine in MOLM13 cells stably expressing MENIN-M327I mutant or MENIN-G331R mutant is basically the same as that in MOLM13 cells stably expressing MENIN-WT wild type. The above results suggest that Fludarabine has a good therapeutic effect on MENIN inhibitor-resistant cells.

[0215] The difference in NAT10 expression in healthy human PBMC cells and MOLM13 cells overexpressing wild-type and mutant MENIN was detected. Figure 7 As shown in middle c: The expression level of NAT10 in MOLM13 cells overexpressing MENIN mutant was significantly higher than that in MOLM13 cells overexpressing MENIN wild type or healthy human PBMCs.

[0216] The wild-type and mutant overexpressing MOLM13 cells of MENIN were infected with NAT10-shRNA (NAT10-shRNA is the above-mentioned shNat10-1 and shNat10-2) lentivirus to knock down NAT10, and the MTT experiment was performed to detect the effect on cell activity. Figure 7 Figure d shows that knocking down NAT10 can significantly inhibit the proliferation of both MENIN-resistant cells and non-resistant cells, that is, reducing the expression of NAT10 can achieve the purpose of preventing and / or treating MENIN inhibitor-resistant acute myeloid leukemia.

[0217] The above results indicate that NAT10 can be used as a diagnostic marker for MENIN inhibitor-resistant acute myeloid leukemia, and the purpose of preventing and / or treating MENIN inhibitor-resistant acute myeloid leukemia can be achieved by inhibiting the expression, content and / or activity of NAT 10.

[0218] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of NAT10 inhibitors in the preparation of drugs for preventing and / or treating acute myeloid leukemia with high NAT10 expression.

2. The use according to claim 1, characterized in that: The NAT10 inhibitor comprises at least one of a substance that inhibits NAT10 activity, a substance that degrades NAT10, and a substance that reduces the expression level of NAT10; further comprises at least one of a substance that inhibits NAT10 activity, and a substance that reduces the expression level of NAT10; Preferably, the substance that reduces the expression level of NAT10 comprises at least one of (a1)-(a3): (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting NAT10; (a2) a nucleic acid molecule expressing (a1); (a3) an expression cassette, vector, transgenic cell line, or microorganism comprising (a2); Preferably, the substance that inhibits NAT10 activity comprises at least one of (b1)-(b3): (b1) Antibodies that specifically bind to NAT10; (b2) a ligand protein or polypeptide that specifically binds to NAT10; (b3) non-protein compounds that specifically bind to NAT10; Preferably, the (a1) is a shRNA targeting NAT10; Preferably, the antisense strand sequence of the shRNA targeting NAT10 comprises AAATAGCTTCACAACTTTGCG (SEQ ID NO: 1), or ATAGTCACTGTGTACAATTGC (SEQ ID NO: 2); Preferably, the non-protein compound that specifically binds to NAT10 comprises at least one of Remodelin, fludarabine phosphate, fludarabine, and fludarabine triphosphate, or a pharmaceutically acceptable salt thereof; further preferably comprises at least one of fludarabine phosphate, fludarabine, and fludarabine triphosphate, or a pharmaceutically acceptable salt thereof; further preferably comprises at least one of fludarabine phosphate and fludarabine, or a pharmaceutically acceptable salt thereof; further preferably comprises fludarabine, or a pharmaceutically acceptable salt thereof; Preferably, the acute myeloid leukemia with high expression of NAT10 includes at least one of MLL gene rearranged acute myeloid leukemia, FLT3 mutated acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia; Preferably, the acute myeloid leukemia with high expression of NAT10 includes MLL gene rearranged acute myeloid leukemia, FLT3 mutated acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia; Preferably, the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation acute myeloid leukemia; Preferably, the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation acute myeloid leukemia, and the drug further comprises: a MENIN inhibitor; Preferably, the MENIN inhibitor comprises at least one of a substance that inhibits MENIN activity, a substance that degrades MENIN, and a substance that reduces the expression level of MENIN; further preferably, it comprises a substance that inhibits MENIN activity; Preferably, the substance that reduces the expression level of MENIN comprises at least one of (c1)-(c3): (c1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting MENIN; (c2) a nucleic acid molecule expressing (c1); (c3) an expression cassette, vector, transgenic cell line, or microorganism comprising (c2); Preferably, the substance that inhibits MENIN activity comprises at least one of (d1)-(d3): (d1) an antibody that specifically binds to MENIN; (d2) a ligand protein or polypeptide that specifically binds to MENIN; (d3) non-protein compounds that specifically bind to MENIN; Preferably, the substance that inhibits the activity of MENIN is a non-protein compound that specifically binds to MENIN; Preferably, the non-protein compound that specifically binds to MENIN comprises at least one of VTP50469, Revumenib, Ziftomenib, BMF-219, DSP-5336, BN104, or a pharmaceutically acceptable salt thereof; further preferably comprises VTP50469, or a pharmaceutically acceptable salt thereof; Preferably, the FLT3 mutation comprises at least one of a FLT3-ITD mutation, a FLT3-TKD mutation, and a FLT3-ITD-TKD mutation; more preferably, the FLT3-ITD mutation.

3. The use according to any one of claims 1-2, characterized in that: The drug further comprises other active ingredients for preventing and / or treating acute myeloid leukemia with high expression of NAT10; Preferably, the drug further comprises a pharmaceutically acceptable excipient; Preferably, the pharmaceutically acceptable excipients include at least one of a diluent, an excipient, a binder, a humectant, a surfactant, a lubricant, and a disintegrant; Preferably, the dosage form of the drug is a dosage form suitable for children or a dosage form suitable for adults; Preferably, the dosage form is selected from a dosage form for gastrointestinal administration or a dosage form for parenteral administration; Preferably, the dosage form for administration via the gastrointestinal tract comprises at least one of powder, tablet, granule, capsule, sustained-release agent, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet; Preferably, the non-gastrointestinal administration dosage form comprises at least one of an injection dosage form, a respiratory tract administration dosage form, a skin administration dosage form, a mucosal administration dosage form, and a cavity administration dosage form; Preferably, the drug is administered to an animal; Preferably, the mass content of the NAT10 inhibitor in the drug is 0.1%-20%.

4. Use of a substance for detecting NAT10 in the preparation of a product for the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression.

5. The use according to claim 4, characterized in that: The substance for detecting NAT10 includes a substance for detecting NAT10 at the gene level and / or protein level; Preferably, the substance comprises a substance for one or more detection techniques or methods selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance, immuno-PCR, biotin-avidin technology; Preferably, the immunohistochemistry method comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunocoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology; Preferably, the substance for detecting NAT10 is selected from at least one of: a substance specific to NAT10, a probe specific to NAT10, a gene chip, a protein chip, and a PCR primer; Preferably, the substance specific for NAT10 comprises any one of (i1)-(i4): (i1) an antibody that specifically binds to NAT10; (i2) a ligand protein or polypeptide that specifically binds to NAT10; (i3) non-protein compounds that specifically recognize NAT10; (i4) Nucleic acid aptamer that specifically recognizes NAT10.

6. The use according to any one of claims 4 to 5, characterized in that: The product is a reagent, a test kit, a test plate, a test strip, a device, a system, or a chip; Preferably, the product further comprises detecting other substances for diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of acute myeloid leukemia with high NAT10 expression; Preferably, the product further comprises a gene expression auxiliary detection reagent, wherein the gene expression auxiliary detection reagent comprises: a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard substance for preparing a standard curve, and at least one of a positive control substance; Preferably, the product further comprises an auxiliary detection reagent for protein expression, wherein the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance for preparing a standard curve, and a positive control substance; Preferably, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested; Preferably, the subject to be tested includes an animal.

7. Application of NAT10 as a target in screening drugs for preventing and / or treating acute myeloid leukemia with high NAT10 expression.

8. The use according to any one of claims 4 to 7, characterized in that: The acute myeloid leukemia with high NAT10 expression includes at least one of MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, and MENIN inhibitor-resistant acute myeloid leukemia; Preferably, the acute myeloid leukemia with high NAT10 expression includes MLL gene rearrangement acute myeloid leukemia, FLT3 mutation acute myeloid leukemia, or MENIN inhibitor-resistant acute myeloid leukemia.

9. The use according to claim 8, characterized in that: The FLT3 mutation includes at least one of a FLT3-ITD mutation, a FLT3-TKD mutation, and a FLT3-ITD-TKD mutation; further, it is a FLT3-ITD mutation.

10. Use of NAT10 inhibitors in the preparation of MENIN inhibitors or in vitro non-therapeutic inhibition of MENIN expression; Preferably, the NAT10 inhibitor is the NAT10 inhibitor described in claim 2.

11. A pharmaceutical composition comprising a NAT10 inhibitor and a MENIN inhibitor.

12. The pharmaceutical composition according to claim 11, characterized in that The NAT10 inhibitor is the NAT10 inhibitor described in claim 2; Preferably, the MENIN inhibitor is the MENIN inhibitor described in claim 2; Preferably, the molar ratio of the NAT10 inhibitor to the MENIN inhibitor is (0-3, excluding 0): (0-8, excluding 0); more preferably (1-3): (0.25-8); more preferably (1-3): (0.5-8); more preferably (1-3): (1-8); more preferably (1-2): (2-8); Preferably, the pharmaceutical composition is used for preventing and / or treating acute myeloid leukemia with high expression of NAT10, wherein the acute myeloid leukemia with high expression of NAT10 includes MLL gene rearrangement acute myeloid leukemia and / or FLT3 mutation acute myeloid leukemia; Preferably, the pharmaceutical composition further comprises other active ingredients for preventing and / or treating acute myeloid leukemia with high expression of NAT10; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

Images