Application of slabcg45 gene in improving the orobanche resistance and yield of tomato

Abstract

The application belongs to the technical field of biology and particularly relates to application of SlABCG45 gene in improving orobanche resistance and yield of tomato. A method for improving orobanche resistance and yield of tomato plants in an orobanche parasitic environment is provided, which comprises: reducing content of SlABCG45 protein in the tomato plants or inhibiting expression of a gene coding the SlABCG45 protein in the tomato plants; the amino acid sequence of the SlABCG45 protein is shown as SEQ ID NO:3. The method can realize balance of orobanche parasitic resistance and growth and development of the tomato plants, and then significantly improve the yield of the tomato in the orobanche parasitic environment.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to application of SlABCG45 gene in improving broomrape resistance and yield of tomato. BACKGROUND

[0002] Broomrape (Orobanche and Phelipanche spp.) is a kind of annual holoparasitic weed parasitizing on plant roots, having no root organs and chlorophyll, and having haustoria. The leaves of broomrape are small and have no petiole, and thus cannot perform photosynthesis. All the nutrients and water required for growth of broomrape are obtained from the host plants, and thus the parasitism of broomrape can cause great harm to the growth of the host. The inflorescences of broomrape are spicate, and the clock-shaped calyx of each flower contains one capsule, and each plant of broomrape produces about 100,000-1,000,000 seeds. Different broomrapes can be classified and identified by using ITS (Internal transcribed spacer) sequence determination analysis technology, and can be divided into two categories of Phelipanche and Orobanche. Phelipanche mainly includes P. aegyptiaca and P. ramose, and can cause serious harm to economic crops such as tomato, melon, potato, tobacco and rape. Orobanche mainly includes O. cumana, O. cernua, O. minor and O. crenata, and can parasitize sunflower, broad bean, alfalfa and chickpea. Broomrapes are various and widely distributed.

[0003] In the world, broomrape causes serious harm to the yield of important crops, and has become one of the important factors restricting the sustainable development of the processing tomato industry in China. SUMMARY

[0004] The inventors found that SlABCG45 gene is related to the broomrape resistance and yield of tomato by quantitatively evaluating the parasitic phenotype of natural population of tomato in the field contaminated by broomrape seeds and performing whole genome association analysis. SlABCG45 gene encodes an ABCG family transporter protein (SlABCG45 protein), and experiments show that SlABCG45 protein is involved in the process of excretion of strigolactones outside the roots of tomato. Strigolactones are a kind of plant hormones mainly synthesized in the roots of plants and excreted into the soil, and can induce the germination of broomrape seeds in the soil. Further research proves that knocking out SlABCG45 gene can significantly improve the broomrape resistance and yield of tomato plants in the broomrape parasitic environment.

[0005] Based on the above research results, the application provides a method for improving the orobanche resistance of tomato plants in an orobanche parasitic environment and the yield of tomatoes, comprising: reducing the content of SlABCG45 protein in the tomato plants or inhibiting the expression of the coding gene of the SlABCG45 protein in the tomato plants; the amino acid sequence of the SlABCG45 protein is shown as SEQ ID NO: 3.

[0006] Preferably, the nucleotide sequence of the coding gene of the SlABCG45 protein is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] Preferably, the method is achieved by editing the coding gene of the SlABCG45 protein through a CRISPR gene editing system.

[0008] Preferably, the CRISPR gene editing system is a CRISPR-Cas9 system; the target sequence of the coding gene of the SlABCG45 protein used in the CRISPR-Cas9 system is target sequence 1 or target sequence 2; the nucleotide sequence of the target sequence 1 is shown as SEQ ID NO: 10; the nucleotide sequence of the target sequence 2 is shown as SEQ ID NO: 11.

[0009] Preferably, the method is achieved by introducing the coding gene of sgRNA targeting the target sequence 1 or the target sequence 2 and the coding gene of Cas9 into the tomato plants to obtain transgenic plants with improved orobanche resistance and tomato yield in an orobanche parasitic environment.

[0010] The application also provides a product for improving the orobanche resistance of tomato plants in an orobanche parasitic environment and the yield of tomatoes, which is used for reducing the content of SlABCG45 protein in the tomato plants or inhibiting the expression of the coding gene of the SlABCG45 protein in the tomato plants; the amino acid sequence of the SlABCG45 protein is shown as SEQ ID NO: 3.

[0011] Preferably, the nucleotide sequence of the coding gene of the SlABCG45 protein is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] Preferably, the product is a reagent required for editing the coding gene of the SlABCG45 protein by using a CRISPR gene editing system.

[0013] Preferably, the CRISPR gene editing system is a CRISPR-Cas9 system; the reagent is reagent 1 or reagent 2.

[0014] The reagent 1 is a composition composed of R1) or R2) and Cas9:

[0015] R1) an sgRNA targeting the target sequence 1;

[0016] R2) an sgRNA targeting the target sequence 2;

[0017] The reagent 2 is a recombination vector containing the coding gene of R1) or R2) and the coding gene of Cas9.

[0018] The application also relates to the use of the SlABCG45 protein or the coding gene of the SlABCG45 protein in improving the orobanche resistance and tomato yield of tomato plants in an orobanche parasitic environment.

[0019] Experiments show that, compared with wild-type tomato plants, tomato plants with the SlABCG45 gene knocked out not only exhibit enhanced orobanche resistance in an orobanche parasitic environment, but also increase the tomato yield by about 33% to 36% (Example 3). Therefore, the method of the application can achieve a balance between orobanche parasitic resistance and growth and development, thereby significantly improving the yield of tomatoes in an orobanche parasitic environment. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A field orobanche parasitism investigation process of different tomato materials in Example 1 is shown. A is a schematic diagram of field tomato planting, and B is a flowchart of orobanche parasitism phenotype investigation and correction.

[0021] Figure 2 Identification of key genes affecting orobanche parasitism in tomatoes by using genome-wide association analysis (GWAS) and transcriptome data in Example 1 is shown. A is a Manhattan plot drawn by using a mixed linear model, B is a significant SNP site in the region (56.482-56.780 Mb) of the most significant peak on chromosome 8 in the Manhattan plot, and linkage disequilibrium analysis of SNPs in the 200Kb interval is performed. In A and B, the observed value-Log 10 (P) = 8.638. C is a quantile plot (QQ plot) for measuring the data quality of GWAS. D is the response of candidate genes in the region to phosphorus deficiency treatment. Genes with more than 2-fold induction of expression are represented by red and blue, respectively.

[0022] Figure 3 SlABCG45 and SlABCG44 proteins are located on the cell membrane and have strigolactone transport activity. The numerical values in the bar chart in A represent the mean ± standard deviation (n = 3); *** represents a student's t-test P < 0.001, and * represents a student's t-test P < 0.05. FM4-64 is a cell membrane dye in B, and the scale is 20 μm.

[0023] Figure 4Genome editing information of tomato SlABCG45 gene edited materials (Slabcg45-1, Slabcg45-3 and Slabcg45-4), SlABCG44 gene edited materials (Slabcg44-1 and Slabcg44-3) and SlCCD8 gene edited material (Slccd8-1); wherein the PAM sequence is represented in blue, and the inserted or deleted bases are represented in red; Slabcg45-1 and Slabcg44-1 were created in the background of wild currant tomato S. pimpinellifolium PI365967; Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 were created in the background of cultivated tomato S. lycopersicum cv. Moneymaker.

[0024] Figure 5 The content of strigolactones secreted by tomato wild type (WT), SlABCG45 gene edited material (Slabcg45-1) and SlABCG44 gene edited material (Slabcg44-1) is shown. The numerical value represents the mean ± standard deviation (n = 3), and *** represents Student's t test P < 0.001.

[0025] Figure 6 The parasitic phenotype of tomato wild type (WT) and mutants Slabcg45-3, Slabcg45-4, Slabcg44-3, Slccd8-1 in the field contaminated by striga seeds is shown. A is the field photo of tomato wild type (WT) and mutants Slabcg45-3, Slabcg44-3 and Slccd8-1, and the yellow arrow points to the striga parasitizing on the tomato plant. The upper left corner is an enlarged view of striga. Due to the shielding of field materials, there are still some striga that cannot be indicated with arrows, but they have been counted and plotted in B. B is the total number of striga parasitizing in each plot, wherein the numerical value represents the mean ± standard deviation (n = 4), and *** represents Student's t test P < 0.001.

[0026] Figure 7Fruit phenotype and yield phenotype of tomato wild type (WT) and mutants Slabcg45-3, Slabcg45-4, Slabcg44-3, Slccd8-1. A: fruit phenotype of tomato wild type (WT), mutants Slabcg45-3 and Slccd8-1, B: average size of fruits per plant, C: number of red fruits (red fruit) per plant, D: number of green fruits (green fruit) per plant, E: number of all fruits (total fruit) per plant, F: weight of red fruits per plant, G: weight of green fruits per plant, H: weight of all fruits (total fruit) per plant; scale in A is 2.5 cm; values in B represent mean ± standard deviation (n = 10); values in C-H represent mean ± standard deviation (n = 24). *** indicates student t-test P < 0.001, * indicates student t-test P < 0.05, ns indicates student t two-tailed test P value greater than 0.05 (no significant difference).

[0027] Sequence Description

[0028] SEQ ID NO: 1 genomic sequence of SlABCG45 gene;

[0029] SEQ ID NO: 2 coding sequence (CDS) of SlABCG45 gene;

[0030] SEQ ID NO: 3 amino acid sequence of SlABCG45 protein;

[0031] SEQ ID NO: 4 genomic sequence of SlABCG44 gene;

[0032] SEQ ID NO: 5 coding sequence (CDS) of SlABCG44 gene;

[0033] SEQ ID NO: 6 amino acid sequence of SlABCG44 protein;

[0034] SEQ ID NO: 7 genomic sequence of SlCCD8 gene;

[0035] SEQ ID NO: 8 coding sequence (CDS) of SlCCD8 gene;

[0036] SEQ ID NO: 9 amino acid sequence of SlCCD8 protein;

[0037] SEQ ID NO: 10 target sequence 1 of SlABCG45 gene in CRISPR gene editing;

[0038] SEQ ID NO: 11 target sequence 2 of SlABCG45 gene in CRISPR gene editing;

[0039] SEQ ID NO: 12 Target sequence 1 of SlABCG44 gene in CRISPR gene editing;

[0040] SEQ ID NO: 13 Target sequence 2 of SlABCG44 gene in CRISPR gene editing;

[0041] SEQ ID NO: 14 Target sequence 1 of SlCCD8 gene in CRISPR gene editing;

[0042] SEQ ID NO: 15 Target sequence 2 of SlCCD8 gene in CRISPR gene editing;

[0043] SEQ ID NO: 16 Target sequence 3 of SlCCD8 gene in CRISPR gene editing;

[0044] SEQ ID NO: 17- SEQ ID NO: 50 Nucleotide sequences of primers used in examples. DETAILED DESCRIPTION

[0045] The present application will be further described in conjunction with examples. It should be understood that the following examples are only used to illustrate the present application, and are not used to limit the scope of the present application.

[0046] The cultivated tomato S. lycopersicum cv. Moneymaker and wild cherry tomato S. pimpinellifolium PI365967 used in the following examples are described in the literature “Zhang, S., Yu, H., Wang, K., et al. (2018). Detection of major loci associated with the variation of important agronomic traits between Solanum pimpinellifolium and cultivated tomatoes. Plant J. 95: 312-323.” and are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0047] The experimental methods in the following examples are all routine methods, and are performed according to the techniques or conditions described in the literature of the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available, unless otherwise specified.

[0048] The quantitative tests in the following examples are all set up with three repeated experiments, and the results are averaged.

[0049] The following examples use GraphPad Prism 8 statistical software to process data, and the experimental results are expressed as mean ± standard deviation, using two-tailed Student's t test, P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), ns (not significant).

[0050] Example 1. Identification of key genes for resistance to Orobanche parasitism in tomato

[0051] 1. Field parasitism survey

[0052] The population used in this study contains 152 tomato materials with good genome sequencing quality, one of which belongs to wild tomato, and the other 151 belong to the Solanum lycopersicum var. cerasiforme branch. These materials have different geographical origins and contain rich genetic diversity. The genomic information of the population can be referred to the literature “Zhu, G., Wang, S., Huang, Z., et al. (2018). Rewiring of the Fruit Metabolome in Tomato Breeding. Cell 172: 249-261.e12”. The number of Orobanche on each tomato (Orobanche parasitism) reflects the resistance level of tomato. The Orobanche parasitism of the population was surveyed in the field in Xinjiang contaminated by Orobanche seeds. In order to eliminate the error caused by the uneven distribution of Orobanche seeds in different plots, we designed 5 small areas, and each area randomly planted the population, and each material planted 16 single plants. The total number of Orobanche on each tomato material in each small area was divided by the number of tomatoes planted in the small area to represent the parasitism phenotype of the material. At the same time, in order to further improve the accuracy of the data, the parasitism phenotypes of part of the materials were investigated again in the field in Xinjiang in 2021 and 2022, and in the greenhouse under controllable conditions in 2023. The phenotypic data of the above three years were used to calibrate the field survey data in 2015, and finally the calibrated 152 data were used for whole genome association analysis (GWAS) Figure 1 ).

[0053] 2. Whole genome association analysis

[0054] Figure 2 A-2C shows the results of whole genome association analysis of the Orobanche parasitism of 152 tomato materials. On the Manhattan plot Figure 2 A), it can be seen that there is a signal significantly associated with the phenotype on chromosome 8, and the SNP significance of the highest point of the signal is P = 4.66 x 10 -14significantly associated with the degree of parasitism. Linkage disequilibrium (LD) analysis of the interval where the signal was found showed that the most associated SNP fell within a 200 Kb interval, which contained 21 candidate genes. There were 23 SNPs that were significantly associated with the degree of parasitism beyond the threshold (P < 2.301387 x 10 -9 ). One of them fell in an intron of the gene Solyc08g067560, 16 SNPs fell in introns or coding regions of the gene Solyc08g067620, and the remaining 6 SNPs fell in intergenic regions. Solyc08g067560 encodes a protein of unknown function.

[0055] Solyc08g067620 encodes an ABCG family protein SlABCG45, which contains 13 transmembrane domains. Solyc08g067620 is referred to as the SlABCG45 gene, and its genomic sequence is shown in SEQ ID NO: 1, and its coding sequence (CDS) is shown in SEQ ID NO: 2. The amino acid sequence of the SlABCG45 protein encoded by the SlABCG45 gene is shown in SEQ ID NO: 3.

[0056] 3. Identification of candidate genes using transcriptome analysis (RNA-seq)

[0057] The lack of phosphorus in the soil environment can exacerbate the degree of parasitism of Orobanche. Given the close relationship between phosphorus deficiency and parasitism, the candidate genes were analyzed using the transcriptome data of the tomato root system in response to phosphorus deficiency. The process of the phosphorus deficiency treatment test is as follows: (1) Sterilization of tomato seeds: In a clean bench, tomato seeds were soaked in 70% alcohol for 1 minute, and after the alcohol was poured out, they were washed with sterilized water for 3 times. Then the tomato seeds were soaked in 30% bleaching liquid for 20 minutes, and after pouring out, they were washed with sterilized water for 5 times. The tomato seeds were transferred to a culture dish, a little water was retained to keep it moist, and it was placed in a 4°C refrigerator for two days. (2) In a sterile environment, 1 / 2MS solid medium was prepared, and the tomato seeds were sown on the medium, 25°C, 16 / 8 hour light cycle, and cultured for 10 days. (3) Normal phosphorus and phosphorus-deficient 1 / 2Hoagland liquid medium was prepared, and the tomato seedlings were transplanted from the solid medium to the glass tube, 25°C, 16 / 8 hour light cycle, and water-cultured for 10 days. (4) The root tissue of tomato was collected, dried with toilet paper, and then wrapped in tin foil paper, and stored in liquid nitrogen.

[0058] 1 / 2MS solid medium (1L): 2.2g MS salt and 10g sucrose were dissolved in 990mL distilled water, the pH value was adjusted to 5.8-6.0 with 1M KOH, and the volume was made up to 1L, then 8g imported agar powder was added, and high-pressure steam sterilization was performed for 15 minutes.

[0059] 1 / 2 Hoagland liquid medium (500 mL): Potassium nitrate (500x) 101 g, calcium nitrate tetrahydrate (500x) 236 g, iron sodium ethylenediaminetetraacetate (1000x) 4.15 g, magnesium sulfate heptahydrate (500x) 153 g. Microelements (10000x): boric acid 0.05 g, manganese chloride tetrahydrate 0.035 g, zinc sulfate heptahydrate 0.13 g, copper sulfate pentahydrate 0.09 g, molybdate 0.016 g. Potassium dihydrogen phosphate (1000x) 89 g. Adjust pH to 5.8-6.2. If the phosphate-free medium is configured, do not add potassium dihydrogen phosphate.

[0060] The tomato root RNA extraction process is as follows, and the reagents and experimental consumables used in the RNA extraction process have been removed RNase. (1) Grind the tomato root tissue sample into a uniform powder in a liquid nitrogen environment. (2) Weigh about 100 mg of powder into a 2 mL centrifuge tube, add 1 mL of Trizol to each centrifuge tube, vortex uniformly, and then stand at room temperature for 5 minutes. (3) Add 200 μL of chloroform to each centrifuge tube, shake vigorously for 15 seconds, and then stand at room temperature for 2-3 minutes. (4) Centrifuge at 12000 rpm for 10 minutes at 4°C. Take 600 μL of supernatant and transfer it to a new 1.5 mL centrifuge tube. Add 600 μL of isopropanol to each centrifuge tube. Mix well and stand at room temperature for 10 minutes. (5) Centrifuge at 12000 rpm for 10 minutes at 4°C. Remove the supernatant and observe the white precipitate. Wash the precipitate with 70% (v / v) ethanol once at room temperature for 10 minutes, and wait for the precipitate to dry. (6) Resuspend the precipitate with an appropriate amount of RNase-free water, and then measure the nucleic acid concentration with a Nanodrop. Send the RNA sample to BGI's DNBSEQ-T7 platform for transcriptome sequencing, and use 2 μg of library for each sample.

[0061] According to the transcriptome data, the candidate gene Solyc08g067620 (SlABCG45) has the most significant response to phosphate deficiency, and the gene is up-regulated by more than 40 times after phosphate deficiency. Figure 2 D). Therefore, SlABCG45 is considered to be a candidate gene affecting the degree of Orobanche parasitism.

[0062] 4. SlABCG45 has strigolactone transport activity

[0063] A protein highly homologous to SlABCG45 protein was found in tomato by protein sequence alignment, which is Solyc08g067610 with an amino acid sequence similarity of 91.54%. The Solyc08g067610 gene is referred to as SlABCG44 gene, the genomic sequence of which is shown as SEQ ID NO: 4, and the coding sequence (CDS) is shown as SEQ ID NO: 5. The amino acid sequence of SlABCG44 protein encoded by SlABCG44 gene is shown as SEQ ID NO: 6.

[0064] The transport activity of SlABCG45 and SlABCG44 proteins was detected using Xenopus oocytes. The CDS sequence of SlABCG45 gene (SEQ ID NO: 2) and the CDS sequence of SlABCG44 gene (SEQ ID NO: 5) were synthesized by Hongxun Biotechnology Co., Ltd., and the CDS sequences of SlABCG45 and SlABCG44 genes were amplified using primers SlABCG45-XO-F / R and SlABCG44-XO-F / R, respectively, and homologously recombined into the African Xenopus oocyte expression vector pG2 with a BamHI / HindIII enzyme site to obtain the recombinant vectors SlABCG45-pG2 and SlABCG44-pG2. The vector pG2 is described in the doctoral thesis “Qin Li. Research on the structure and activation mechanism of slow anion channel SLAH s[D]. Beijing: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 2021.”

[0065] SlABCG45-XO-F: 5'-GATCAATTCCCCGGGGATCCATGGAGGGTGGTGGAGAT-3'

[0066] (SEQ ID NO: 17);

[0067] SlABCG45-XO-R:

[0068] 5'-GGTAACCAGATCAAGCTTCTATCTTTTCTGGAAGTTAAATGCTT-3' (SEQ ID NO: 18);

[0069] SlABCG44-XO-F: 5'-CAATTCCCCGGGGATCCATGGAGGGTGGTGAAAATCTTGTG-3' (SEQ ID NO: 19);

[0070] SlABCG44-XO-R:

[0071] 5'-GGTAACCAGATCAAGCTTCTATCTTTTCTGGAAGTTGAATGC-3' (SEQ ID NO: 20).

[0072] The preparation of cRNA mainly includes plasmid linearization, purification of linearized DNA, transcription reaction and purification of cRNA. The specific steps are as follows: (1) using MluI enzyme to cut pG2 vector containing the target gene (SlABCG45-pG2 and SlABCG44-pG2), 50 μL of the enzyme cutting system contains 5 μg of vector plasmid, 5 μL of enzyme cutting buffer and 1.5 μL of MluI-HF enzyme, and the rest is supplemented with ddH2O. Incubate in a 37°C water bath for 3 hours. (2) Add 450 μL of DNase / RNase water to the enzyme cutting product, then add 500 μL of phenol / chloroform / isoamyl alcohol (25:24:1, pH 7.8), vortex well, and centrifuge at 14000 rpm for 10 minutes. (3) After centrifugation, take the supernatant to a sterile DNase / RNase-free 1.5 mL centrifuge tube, add 50 μL of sodium acetate (pH 5.2), and mix well. (4) Add 1 mL of pre-cooled anhydrous ethanol to it, mix well, and then stand at 4°C for 10 minutes. Then centrifuge at 14000 rpm for 20 minutes at 4°C. (5) After centrifugation, discard the supernatant, add 300 μL of 70% ethanol to the centrifuge tube, gently invert the centrifuge tube 6-8 times, and centrifuge at 14000 rpm for 10 minutes at 4°C. After centrifugation, discard the supernatant and wait for the remaining ethanol to evaporate at room temperature. (6) Prepare 50 μL of transcription reaction system: 8 μL of cap structure mimic, 5 μL of transcription buffer, 5 μL of DTT, 2 μL of rNTP mixture, 2 μL of RNase inhibitor, 2 μL of T7 RNA polymerase, and the rest is supplemented with DNase / RNase-free water. Add the above reaction solution to the centrifuge tube in (5), and incubate in a 37°C constant temperature incubator for 3 hours. (7) After the reaction is completed, purify the cRNA, steps (2)-(5), the pH of phenol / chloroform / isoamyl alcohol in step (2) is changed to 5.2. (8) Add appropriate amount of DNase / RNA water to dissolve the cRNA, and store at -80°C after aliquoting.

[0073] cRNA injection and substrate injection: Under a microscope, select healthy oocytes and arrange them in a gridded petri dish, ready for microinjection. Inject 36 nL of SlABCG45 or SlABCG44 cRNA (36 ng) into each frog egg, and simultaneously inject an equal volume of sterile DNase / RNA-depleted water as a control. After adjusting the syringe scale, fill the injection needle with vegetable oil, minimizing air bubbles. Inject sequentially from left to right under the microscope. After injection, place three cells per well into a 24-well culture plate and incubate at 18°C ​​for 40 hours. Then, inject 23 nL (1.7 ng) of orobanchol (a natural form of strigolactone) into the frog eggs in the same manner. After 2.5 hours, collect the efflux fluid from the frog eggs for substrate content detection.

[0074] Purification and enrichment of strigolactones in frog egg efflux: (1) Add frog egg efflux to a pre-equilibrated Oasis HLB column (Waters). After all the fluid has flowed out, wash the column 2-3 times with ddH2O. (2) After the column has dried slightly, elute the strigolactones into a 5mL Eppendorf tube with 2mL acetone and dry with nitrogen. (3) Redissolve the strigolactones in 2mL 50% acetonitrile, and then use it for mass spectrometry detection.

[0075] like Figure 3 As shown in Figure A, in the frog egg cell system, both SlABCG45 and SlABCG44 proteins have the activity of transporting the natural form of strigolactone orobanchol.

[0076] Subcellular localization vector construction: Using SlABCG45-pG2 as a template, the fragment was amplified with primers SlABCG45-YFP-F / R and homologously recombined into vector YFP-HA to obtain the recombinant vector SlABCG45-YFP-HA; using SlABCG44-pG2 as a template, the fragment was amplified with primers SlABCG44-YFP-F / R and homologously recombined into vector YFP-HA to obtain the recombinant vector SlABCG44-YFP-HA. Vector YFP-HA is described in the literature "Wang, X., Liu, Z., Sun, S., et al. (2021). SISTER OF TM3activates FRUITFULL1 to regulate inflorescence branching intomato. Hortic. Res. 8: 1-15."

[0077] SlABCG45-YFP-F:5'-GGACTCTTGAGGATCCATGGAGGGTGGTGGAGAT-3' (SEQ ID NO: 21);

[0078] SlABCG45-YFP-R:

[0079] 5’-TCGACAGATCCCCGGGTACCTCTTTTCTGGAAGTTAAATGCT-3’ (SEQ ID NO: 22);

[0080] SlABCG44-YFP-F: 5’-GGACTCTTGAGGATCCATGGAGGGTGGTGAAAATCTTGTG-3’ (SEQ ID NO: 23);

[0081] SlABCG44-YFP-R:

[0082] 5’-TCGACAGATCCCCGGGTACCTCTTTTCTGGAAGTTGAATGCTTTG-3’ (SEQ ID NO: 24).

[0083] The recombinant vectors SlABCG45-YFP-HA and SlABCG44-YFP-HA were introduced into Agrobacterium AGL1 by electroporation, respectively, to obtain recombinant Agrobacterium AGL1-SlABCG45-YFP and AGL1-SlABCG44-YFP. The recombinant Agrobacterium AGL1-SlABCG45-YFP and AGL1-SlABCG44-YFP were used to infect tomato callus (wild Vitis vinifera L. PI365967) respectively, and the tomato transgenic materials 35S:SlABCG45-YFP and 35S:SlABCG44-YFP were obtained by tissue culture method.

[0084] To indicate the cell membrane location, the roots of the transgenic materials 35S:SlABCG45-YFP and 35S:SlABCG44-YFP were soaked in 8 mM FM4-64 for 1 minute, then washed clean with water and then pressed into slices for observation. The roots were imaged using a laser scanning confocal microscope (Zeiss LSM 980 inverted microscope), with an argon laser wavelength of 514 nm (YFP) and 510 nm (FM4-64). YFP used an emission filter of 508-570 nm, and FM4-64 used an emission filter of 750 nm. Image analysis was performed using ZEN lite software.

[0085] As Figure 3As shown in Fig. B, both SlABCG45-YFP and SlABCG44-YFP were colocalized with the membrane localization dye FM4-64, indicating that SlABCG45 and SlABCG44 proteins were localized on the cell membrane. Based on the above, it is believed that SlABCG45 and SlABCG44 proteins are strigolactone transport proteins localized on the cell membrane.

[0086] Example 2. Creation of CRISPR gene editing materials

[0087] 1. Construction of CRISPR knockout vector

[0088] The website CRISPR-P v2.0 tool (http: / / cbi.hzau.edu.cn / CRISPR2 / ) was used to find the target sequence of the genes SlABCG45, SlABCG44 and SlCCD8 and design primers. SlCCD8 (Solyc08g066650) is a known strigolactone synthesis gene, the genomic sequence of which is shown as SEQ ID NO: 7, and the coding sequence (CDS) is shown as SEQ ID NO: 8. The amino acid sequence of SlCCD8 protein is shown as SEQ ID NO: 9. The target sequences are as follows:

[0089] SlABCG45 target sequence 1: 5'-AGCTCGATTTGGTGGAAAGG-3' (SEQ ID NO: 10)

[0090] SlABCG45 target sequence 2: 5'-GTCAGCGTGGAATGACGGG-3' (SEQ ID NO: 11)

[0091] SlABCG44 target sequence 1: 5'-GGCATATGCTCTGCCTACT-3' (SEQ ID NO: 12)

[0092] SlABCG44 target sequence 2: 5'-GATTCGAGGCAGACGTTGGG-3' (SEQ ID NO: 13)

[0093] SlCCD8 target sequence 1: 5'-CCGGGTCGAGCCACAAAGAA-3' (SEQ ID NO: 14)

[0094] SlCCD8 target sequence 2: 5'-TATTTCTTGCCTAAATAAGC-3' (SEQ ID NO: 15)

[0095] SlCCD8 target sequence 3: 5'-GCGGAGCTTGTCAAGGATGG-3' (SEQ ID NO: 16)

[0096] To construct the double-target knockout vector of SlABCG45 and SlABCG44, the template pCBC_DT1T2_SlU6p was used to perform PCR with Slabcg45 / 44-cri-F1 / R1, Slabcg45 / 44-cri-F2 / R2, and Slabcg45 / 44-cri-F3 / R3, respectively, to amplify the target fragments (PCR product 1, PCR product 2, and PCR product 3). The purified target fragments were digested with restriction endonuclease BsaI, and the target fragments were ligated to the pTX041 vector also digested with BsaI using T4 ligase to construct the recombinant plasmid SlABCG45 / 44-Cas9.

[0097] To ensure that the Slabcg44 single mutant can be obtained, the template pCBC_DT1T2_SlU6p was used to perform PCR with Slabcg44-cri-F1 / R1, Slabcg44-cri-F2 / R2, and Slabcg44-cri-F3 / R3, respectively, to amplify the target fragments (PCR product 4, PCR product 5, and PCR product 6). The purified target fragments were digested with restriction endonuclease BsaI, and the target fragments were ligated to the pTX041 vector also digested with BsaI using T4 ligase to construct the recombinant plasmid SlABCG44-Cas9.

[0098] To construct the knockout vector of SlCCD8, the template pCBC_DT1T2_SlU6p was used to perform PCR with Slccd8-cri-F1 / R1, Slccd8-cri-F2 / R2, and Slccd8-cri-F3 / R3, respectively, to amplify the target fragments (PCR product 7, PCR product 8, and PCR product 9). The purified target fragments were digested with restriction endonuclease BsaI, and the target fragments were ligated to the pTX041 vector also digested with BsaI using T4 ligase to construct the recombinant plasmid SlCCD8-Cas9.

[0099] The plasmids pTX041 and pCBC_DT1T2_SlU6p described above are recorded in the literature “Wang, X., Liu, Z., Sun, S., et al. (2021). SISTER OF TM3 activates FRUITFULL1 to regulate inflorescence branching in tomato. Hortic. Res. 8: 1-15.”

[0100] The nucleotide sequences of the primers described above are as follows:

[0101] Slabcg45 / 44-cri-F1:

[0102] 5'- ATATATGGTCTCGTTTGATTCGAGGCAGACGTTGGGGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 25);

[0103] Slabcg45 / 44-cri-R1 : 5'-ATTATTGGTCTCGTTCACAAACTACACTGTTAGATTC-3' (SEQ ID NO: 26);

[0104] Slabcg45 / 44-cri-F2:

[0105] 5'- ATATATGGTCTCGTGAAGAGATTGTGGTCGAGGTTTTAGAGCTAGAAATAGC-3'

[0106] (SEQ ID NO: 27);

[0107] Slabcg45 / 44-cri-R2: 5'-ATTATTGGTCTCGGAGCCAAACTACACTGTTAGATTC-3' (SEQ ID NO: 28);

[0108] Slabcg45 / 44-cri-F3:

[0109] 5'- ATATATGGTCTCGGCTCGATTTGGTGGAAAGGGTTTTAGAGCTAGAAATAGC-3'

[0110] (SEQ ID NO: 29);

[0111] Slabcg45 / 44-cri-R3:

[0112] 5'-ATTATTGGTCTCGAAACGCCCGTCATTCCACGCTGACAAACTACACTGTTAGATTC-3' (SEQ ID NO: 30);

[0113] Slabcg44-cri-F1:

[0114] 5'- ATATATGGTCTCGTTTGTGCTGCTCTAACCACCAAGGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 31);

[0115] Slabcg44-cri-F1 : 5'-ATATATGGTCTCGTTGGATTCGAGGCAGACGTGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 35);

[0116] Slabcg44-cri-F2:

[0117] 5'-ATATATGGTCTCGTTGGATTCGAGGCAGACGTGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 35);

[0118] Slabcg44-cri-R2: 5'-ATTATTGGTCTCGCCAACAAACTACACTGTTAGATTC-3' (SEQ ID NO: 34);

[0119] Slabcg44-cri-F3:

[0120] 5'-ATATATGGTCTCGTTGGATTCGAGGCAGACGTGTTTTAGAGCTAGAAATAGC-3'

[0121] (SEQ ID NO: 35);

[0122] Slabcg44-cri-R3:

[0123] 5'-ATTATTGGTCTCGAAACCGCGATTTCAAGAATGATACAAACTACACTGTTAGATTC-3' (SEQ ID NO: 36);

[0124] Slccd8-cri-F1 :

[0125] 5'-ATATATGGTCTCGTTTGCCCCTATGGGCTACATGGTTGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 37);

[0126] Slccd8-cri-R1 : 5'-ATTATTGGTCTCGCCGGCAAACTACACTGTTAGATTC-3' (SEQ ID NO: 38);

[0127] Slccd8-cri-F2:

[0128] 5'-ATATATGGTCTCGCCGGGTCGAGCCACAAAGAAGTTTTAGAGCTAGAAATAGC-3'

[0129] (SEQ ID NO: 39);

[0130] Slccd8-cri-R2: 5'-ATTATTGGTCTCGAATACAAACTACACTGTTAGATTC-3' (SEQ ID NO: 40);

[0131] Slccd8-cri-F3:

[0132] 5'-ATATATGGTCTCGTATTTCTTGCCTAAATAAGCGTTTTAGAGCTAGAAATAGC-3'

[0133] (SEQ ID NO: 41);

[0134] Slccd8-cri-R3:

[0135] 5'-ATTATTGGTCTCGAAACCCATCCTTGACAAGCTCCGCCAAACTACACTGTTAGATTC-3' (SEQ ID NO: 42).

[0136] Enzyme digestion and ligation system 1: 10X T4 DNA ligase buffer, 1 μL; 0.1% BSA (Takara), 1 μL; pTX041, 100 ng; PCR product 1, 30 ng; PCR product 2, 30 ng; PCR product 3, 30 ng; Bsa I (NEB), 0.5 μL; T4 DNA ligase (Promega), 0.5 μL; supplemented with ddH2O to 10 μL.

[0137] Enzyme digestion and ligation system 2: 10X T4 DNA ligase buffer, 1 μL; 0.1% BSA (Takara), 1 μL; pTX041, 100 ng; PCR product 4, 30 ng; PCR product 5, 30 ng; PCR product 6, 30 ng; Bsa I (NEB), 0.5 μL; T4 DNA ligase (Promega), 0.5 μL; supplemented with ddH2O to 10 μL.

[0138] Enzymatic ligation system 3: 10X T4 DNA ligase buffer, 1 μL; 0.1% BSA (Takara), 1 μL; pTX041, 100 ng; PCR product 7, 30 ng; PCR product 8, 30 ng; PCR product 9, 30 ng; Bsa I (NEB), 0.5 μL; T4 DNA ligase (Promega), 0.5 μL; supplemented with ddH2O to 10 μL.

[0139] The reaction procedure was: (37°C, 5 min→16°C, 10 min) 16 cycles; 50°C, 5 min; 80°C, 5 min.

[0140] 2. Transformation of plant expression vector into Agrobacterium

[0141] Take 1 μL of each of the recombinant plasmids SlABCG45 / 44-Cas9, SlABCG44-Cas9 and SlCCD8-Cas9, and transform them into 100 μL of Agrobacterium competent cells AGL1 by high-voltage electroporation, and spread them on LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and incubate them at 28°C under inversion for 2-3 days. Pick single colonies in 3 mL of LB liquid medium containing the same antibiotics, and incubate them at 28°C, 220 rpm overnight. The next day, transfer 200 μL of the bacterial solution into 50 mL of LB liquid medium with the same antibiotic resistance, and incubate them at 28°C, 220 rpm for 16 hours. When the OD value of the bacterial solution is 0.7-0.8, collect the bacterial cells to obtain Agrobacterium AGL1-SlABCG45 / 44-Cas9, AGL1-SlABCG44-Cas9 and AGL1-SlCCD8-Cas9. 600

[0142] 3. Stable transformation of tomato

[0143] ​(1) Using cultivated tomato S. lycopersicum cv. MoneyMaker and wild cherry tomato S. pimpinellifolium PI365967 as receptors, choose full and large seeds, soak the seeds in 75% alcohol for 2 min, and pour off the alcohol. Soak the seeds in 30% Oxydol for 20 min, and pour off the Oxydol. Wash the seeds with single-steam sterilized water for 4 times. Finally, spread the seeds on ½ MS solid medium, and cultivate at 25°C with 16 / 8 hours light. (2) After growing on ½ MS solid medium for one week, the tomato seedling cotyledons are flat. Under sterile conditions, cut the leaves with scissors and soak them in MSO for 1 h. Absorb the excess MSO liquid on the leaves with sterilized filter paper, and then place the leaves on A1 solid medium at room temperature in the dark for 1 day of pre-culture. (3) Centrifuge the activated Agrobacterium AGL1-SlABCG45 / 44-Cas9, AGL1-SlABCG44-Cas9 and AGL1-SlCCD8-Cas9 at 200 rpm for 10 min, collect the bacterial bodies, and discard the supernatant. (4) Resuspend the Agrobacterium AGL1-SlABCG45 / 44-Cas9, AGL1-SlABCG44-Cas9 and AGL1-SlCCD8-Cas9 bacterial bodies in LB liquid medium without antibiotics. Then centrifuge the bacterial bodies at 3800 rpm for 10 min, and pour off the supernatant. (5) Preparation of the infection liquid: resuspend the Agrobacterium AGL1-SlABCG45 / 44-Cas9, AGL1-SlABCG44-Cas9 and AGL1-SlCCD8-Cas9 in liquid MSO medium, dilute to OD 600 = 0.3-0.4, and then add 50 μL of 0.074 M acetosyringone to obtain the infection liquid. (6) After soaking the tomato cotyledons pre-cultured on A1 solid medium for 1 day in the infection liquid for 15 min, pour off the infection liquid, absorb the liquid on the cotyledons with sterilized filter paper, and place the cotyledons back on the original A1 solid medium to infect the leaves for 2-3 days. (7) Transfer the cotyledons to A2 solid medium. Cultivate at 25°C under long-day photoperiod for two weeks. (8) Observe callus formation, and transfer the callus to A3 solid medium to induce sprouting. (9) After inducing sprouting into robust seedlings, cut the seedling stems, and insert them into A4 solid medium to induce rooting, until the complete tomato transgenic material is grown.

[0144] Medium and antibiotic configuration:

[0145] MSO (Agrobacterium suspension) (1 L): MS Powder (M524) 4.33 g, Sucrose 30 g, adjust the volume to 1 L with 1 M NaOH / KOH to adjust the pH to 5.9, and sterilize with high-pressure steam for 15 min.

[0146] MS medium (1 L): MS Powder (M519) 4.43 g, Sucrose 30 g, adjust pH to 5.9 with 1 M NaOH / KOH after making up to 1 L, add 8 g agar. Autoclave for 15 min.

[0147] A1 solid medium (100 mL): MS medium 100 mL, IAA (1 g / L) 100 μL, ZT (1 g / L) 175 μL. Autoclave for 15 min.

[0148] A2 solid medium (100 mL): MS medium 100 mL, IAA (1 g / L) 100 μL, ZT (1 g / L) 175 μL, Kan (50 mg / mL) 225 μL, Tim (1 g / L) 100 μL. Autoclave for 15 min.

[0149] A3 solid medium (100 mL): MS medium 100 mL, IAA (1 g / L) 100 μL, ZT (1 g / L) 175 μL, Kan (50 mg / mL) 100 μL, Tim (1 g / L) 100 μL. Autoclave for 15 min.

[0150] A4 solid medium (100 mL): MS medium 100 mL, Kan (50 mg / mL) 100 μL, Tim (1 g / L) 100 μL. Autoclave for 15 min.

[0151] 1000x Rifampicin: prepare a stock solution of 50 mg / mL in DMSO, filter sterilize.

[0152] 1000x Kanamycin sulfate: prepare a stock solution of 50 mg / mL in water, filter sterilize.

[0153] In the above formulations, IAA means indole acetic acid, ZT means zeatin, Kan means kanamycin, and Tim means Timentin.

[0154] 4. Identification of homozygous mutant material

[0155] Leaf DNA of tomato transformation materials was extracted. Single plant was sampled, and the taken leaves were put into 2 mL Eppendof centrifuge tube, 600 μL CTAB extraction buffer was added, and the leaves were ground into powder after adding steel beads using a sample puncher, and were incubated at 65 °C water bath for 30 min. 200 μL chloroform solution was added, and after shaking, centrifuged at 9800 rpm at 4 °C for 10 min. 400 μL supernatant was taken, and an equal volume of isopropanol was added, and mixed by inverting, and centrifuged at 12000 rpm at 4 °C for 10 min to precipitate the DNA. The DNA precipitate was washed with 70% ethanol, and then dried after opening the cover, and the DNA precipitate was dissolved with 100 μL ddH2O. The obtained DNA was used as a template, and first, Cas9-F / R primers were used to detect whether there was a band.

[0156] Cas9-F: 5'-CACTATCCTTCGCAAGACCC-3' (SEQ ID NO: 43);

[0157] Cas9-R: 5'-GAGATTCCCGAACAAGCCG-3' (SEQ ID NO: 44).

[0158] For the materials positive for Cas9 primer detection, the primer SlABCG45-seq-F / R, SlABCG44-seq-F / R, SlCCD8-seq-F / R was used to identify the editing type of the material. The nucleotide sequences of the primers are as follows:

[0159] SlABCG45-seq-F: 5'-TGGAGGGTGGTGGAGATATATTG-3' (SEQ ID NO: 45);

[0160] SlABCG45-seq-R: 5'-TTAGCCTCTTTCTCTGCCCC-3' (SEQ ID NO: 46);

[0161] SlABCG44-seq-F: 5'-CACGTCGTGATGAACCTTATAGG-3' (SEQ ID NO: 47);

[0162] SlABCG44-seq-R: 5'-TAGTAGGCGGATTCTTACGG-3' (SEQ ID NO: 48);

[0163] SlCCD8-seq-F: 5'-GAGACTATCTATTCAAAAGGTGGCA-3' (SEQ ID NO: 49);

[0164] SlCCD8-seq-R: 5'-ACACATTCTATTACTGAGAGCAA-3' (SEQ ID NO: 50).

[0165] PCR reaction system (25μL): 1μL DNA template, 1.5μL 10μM forward primer, 1.5μL 10μM reverse primer and 21μL Gold Mix (Qingke Biotechnology).

[0166] PCR reaction program: 98℃ pre-denaturation for 3 min; (98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 30 s) 35 cycles; 72℃ extension for 5 min.

[0167] The PCR products were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for Sanger sequencing. After obtaining the sequencing results, the sequences were compared. Figure 4 As shown, under the PI365967 background, 10 homozygous mutant materials with a 1bp insertion at target sequence 1 of SlABCG45 were identified and named Slabcg45-1; 5 homozygous mutant materials with an 86bp deletion between target sequences 1 and 2 of SlABCG44 were identified and named Slabcg44-1. Under the Moneymaker background, 6 homozygous mutant materials with a 1bp deletion at target sequence 2 of SlABCG45 were identified and named Slabcg45-3; 5 homozygous mutant materials with a 1bp insertion at target sequence 2 of SlABCG45 were identified and named Slabcg45-4; 4 homozygous mutant materials with a 7bp deletion at target sequence 2 of SlABCG44 were identified and named Slabcg44-3; and 10 homozygous mutant materials with a 459bp deletion between target sequences 1 and 3 of SlCCD8 were identified and named Slccd8-1. The transgenic material was propagated in a greenhouse using bagging. The received seeds were planted, and DNA was extracted from the leaves. Materials that tested negative for Cas9 primers were transplanted for further propagation. Subsequent field trials were conducted using the received seeds.

[0168] 5. Determination of strigolactone content in Slabcg45-1 and Slabcg44-1 mutant materials

[0169] The material culture procedure for the strigolactone content determination test is as follows: (1) Sterilize the wild type (WT), Slabcg45-1 and Slabcg44-1 tomato seeds: immerse the seeds in 70% alcohol for 1 minute in a clean bench, then wash with sterilized water for 3 times after pouring off the alcohol. Then immerse the seeds in 30% bleach for 20 minutes, then wash with sterilized water for 5 times after pouring off. Transfer the seeds to a culture dish, retain a little water to keep moist, and place in a 4°C refrigerator for two days. (2) Configure 1 / 2MS solid medium in a sterile environment, sow the tomato seeds on the medium, and cultivate at 28°C under a 16 / 8 hour light cycle for 10 days. (3) Transplant the tomato seedlings from the 1 / 2MS solid medium to a glass tube containing 1 / 2 phosphorus-deficient Hoagland liquid medium, and hydroponically cultivate at 28°C under a 16 / 8 hour light cycle for 12 days.

[0170] Collect 5 hours of hydroponic liquid, add GR24 4DO as an internal standard. Transfer the hydroponic liquid to an Oasis HLB column (Waters) that has been equilibrated. Elute the components containing strigolactone orobanchol (mollinol) and solanacol with acetone, and blow dry the eluate with nitrogen. After re-dissolving with 50% acetonitrile, perform LC-MS / MS analysis. At the same time, weigh the fresh root weight of each material, for conversion of the strigolactone content secreted by the root system per unit mass.

[0171] As shown in Figure 5 Compared with the wild type (WT), the strigolactone content in the root exudates of mutants Slabcg45-1 and Slabcg44-1 is significantly reduced, indicating that the SlABCG45 and SlABCG44 proteins are crucial for the export of strigolactone, which is consistent with their function as strigolactone transporters.

[0172] Example 3. Parasitism and yield determination of wild type, Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 mutants in fields contaminated with orobanche seeds

[0173] 1. Parasitism statistics in fields contaminated with orobanche seeds

[0174] All transgenic materials planted in the field are homozygous mutants isolated from Cas9, that is, Cas9-free materials. Since the fruits of wild Solanum pimpinellifolium are small and have no edible value, only wild type in the background of cultivated tomato Moneymaker, Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 mutants are parasitized in the field contaminated by seeds of Orobanche cumana in Xinjiang, and the parasitic degree is counted, and the specific method is as follows: tomato seeds are transplanted to the field after seedling in the plug tray for one month, and the soil is prepared in advance, and the ridge is made and covered with mulch. Drip irrigation is started immediately after the tomato materials are transplanted, and the soil is kept moist. Every 6 tomato materials are planted in two rows in a plot, the ridge width is 80 cm, the plant spacing is 40 cm, and the distance between plots is 100 cm. Wild type, Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 are planted in 4 plots, and are distributed at intervals. When the tomato grows to about 0.5 m, a frame is set up, the main stem of the tomato is tied to the bamboo pole, and regular pricking management is carried out. In the later period, water and fertilizer are applied, and herbicides are sprayed, and other conventional management is carried out.

[0175] The total number of Orobanche parasitized in each plot is counted at the fruit maturation stage of tomato. At the same time, the fresh weight of Orobanche in each plot is counted. As shown in Table 2, compared with the wild type, Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 knockout mutants all show enhanced resistance to Orobanche. Figure 6

[0176] 2. Fruit and yield determination in the field contaminated by Orobanche seeds

[0177] The fruit traits and yield of wild type (WT), Slabcg45-3, Slabcg45-4, Slabcg44-3 and Slccd8-1 are determined. As shown in Table 3, compared with the wild type (WT), the average size of single fruit of Slabcg45-3 and Slabcg45-4 has no significant difference, but the average size of single fruit of Slabcg44-3 and Slccd8-1 is significantly smaller Figure 7 Figure 7 ​​B) indicates that the mutant SlABCG45 gene did not have a significant negative impact on fruit size, while the mutant SlABCG44 and SlCCD8 genes affected fruit development. Simultaneously, individual tomato plants were harvested from the aforementioned field-grown plants, and the number and weight of red fruits (red fruit), green fruits (green fruit), and all fruits (total fruit) on each plant were statistically analyzed. The results showed that the number of red fruits per plant, the total number of fruits, and the total fruit weight of Slabcg45-3 and Slabcg45-4 were significantly higher than those of the wild type; the total number and weight of fruits in Slabcg44-3 did not change significantly compared to the wild type; while Slccd8-1 exhibited a significant phenotype of fewer fruits and reduced fruit weight. Figure 7 (C, 7E, and 7H). Therefore, only knocking out the SlABCG45 gene can achieve a balance between broomrape resistance and tomato growth, that is, improving tomato resistance without causing a significant negative phenotype in tomato growth, demonstrating potential for increased yield in the field. Finally, the total tomato yield of each plot was statistically analyzed. Compared with the wild type, the tomato material with the SlABCG45 gene knocked out increased the yield by approximately 33% to 36% (Table 1). The above results indicate that the SlABCG45 gene has important application value in the breeding of parasitic tomatoes, and knocking out the SlABCG45 gene through gene editing technology can significantly increase the yield of tomatoes in parasitic environments.

[0178] Table 1

[0179]

[0180] Note: The values ​​in the table are the average of the total tomato yield (g) of the four plots.

[0181] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including modifications made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method of increasing tomato yield in a tomato plant in an environment infested with groundsel, comprising: The method comprises reducing the content of SlABCG45 protein in the tomato plant or inhibiting the expression of the coding gene of the SlABCG45 protein in the tomato plant; the amino acid sequence of the SlABCG45 protein is shown as SEQ ID NO: 3; and the method is achieved by editing the coding gene of the SlABCG45 protein through a CRISPR gene editing system.

2. The method of claim 1, wherein, The nucleotide sequence of the coding gene of the SlABCG45 protein is shown as SEQ ID NO:

2.

3. The method of claim 1, wherein, The CRISPR gene editing system is a CRISPR-Cas9 system; the target sequence of the coding gene of the SlABCG45 protein used in the CRISPR-Cas9 system is target sequence 1 or target sequence 2; the nucleotide sequence of the target sequence 1 is shown as SEQ ID NO: 10; and the nucleotide sequence of the target sequence 2 is shown as SEQ ID NO:

11.

4. The method of claim 3, wherein, The method comprises introducing the coding gene of sgRNA targeting the target sequence 1 or the target sequence 2 and the coding gene of Cas9 into the tomato plant to obtain a transgenic plant with improved orobanche resistance and tomato yield in an orobanche parasitic environment.

5. A product for improving the tomato yield of a tomato plant in an orobanche parasitic environment, the product being used for reducing the content of SlABCG45 protein in the tomato plant or inhibiting the expression of the coding gene of the SlABCG45 protein in the tomato plant; the amino acid sequence of the SlABCG45 protein is shown as SEQ ID NO: 3; and the product is a reagent required for editing the coding gene of the SlABCG45 protein by using a CRISPR-Cas9 gene editing system; the reagent is reagent 1 or reagent 2. The reagent 1 is a composition composed of R1) or R2) and Cas9: R1) sgRNA targeting the target sequence 1 in claim 3; R2) sgRNA targeting the target sequence 2 in claim 3; The reagent 2 is a recombinant vector containing the coding gene of R1) or R2) and the coding gene of Cas9.

6. The product of claim 5, wherein, The nucleotide sequence of the coding gene of the SlABCG45 protein is shown as SEQ ID NO:

2.

7. The SlABCG45 protein in claim 1 or the coding gene of the SlABCG45 protein in claim 2 is used for improving the tomato yield of a tomato plant in an orobanche parasitic environment; wherein the content of SlABCG45 protein in the tomato plant is reduced or the expression of the coding gene of the SlABCG45 protein in the tomato plant is inhibited by editing the coding gene of the SlABCG45 protein through a CRISPR gene editing system, so as to improve the tomato yield of the tomato plant in the orobanche parasitic environment.

Images