Cotton fiber length related ghtt gene and molecular marker and application thereof
By developing the GhTTL gene and KASP molecular markers related to cotton fiber length, and utilizing Agrobacterium-mediated genetic transformation and KASP technology, the problems of low cotton fiber length identification and breeding efficiency were solved, and efficient breeding of long-fiber, high-yield cotton was achieved.
Patent Information
- Application Number
- CN202510222251.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-02-27
AI Technical Summary
Existing technologies make it difficult to efficiently identify and select genes related to cotton fiber length, resulting in low breeding efficiency.
We developed a GhTTL gene related to cotton fiber length and used KASP molecular markers in its promoter region. We then overexpressed the GhTTL gene using Agrobacterium-mediated genetic transformation and combined it with KASP technology to perform genotyping at SNP sites, thus developing a molecular marker that can identify cotton varieties with dominant fibers.
It improves the efficiency and precision of cotton breeding and selection, enabling accurate identification and selection of long-fiber, high-yield cotton, and promoting fiber elongation.
Smart Images

Figure CN119874864B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a cotton fiber length related GhTTL gene and a molecular marker and application thereof. BACKGROUND
[0002] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide on a genome, including substitution, transversion, deletion and insertion. In the field of agriculture, fine mapping of trait genes, molecular assisted breeding, seed resource identification, etc. can be carried out; in the field of medicine, molecular genetic mechanism of disease, disease gene mapping, drug sensitivity or disease susceptibility site screening, etc. can be carried out.
[0003] For SNP genotyping, KASP technology has rapidly occupied the market since its inception with its ultra-high flexibility, accuracy and cost performance. KASP refers to competitive allele-specific PCR, which can accurately genotype InDels at target SNPs and specific sites for a wide range of genomic DNA samples, including complex genomic DNA samples.
[0004] KASP technology does not need to synthesize specific fluorescent primers for each SNP site. It is based on its unique ARM PCR principle, which uses universal fluorescent primers for amplification of all site detection, which greatly reduces the reagent cost of LGC KASP, has high accuracy, reduces the use cost, has better site adaptability than Taqman, and the obtained result is also simpler and faster to analyze, so LGC KASP has very good application in medical and agricultural detection.
[0005] Therefore, the present application is proposed. SUMMARY
[0006] One of the purposes of the present application is to provide a protein, to first propose a cotton fiber development related GhTTL gene, and to develop a KASP molecular marker in the promoter region of the GhTTL gene, to provide a cotton fiber development related gene suitable for KASP molecular marker development, and to provide a new idea for identifying or assisting in identifying fine mapping of cotton fiber traits.
[0007] The second purpose of the present application is to provide a nucleic acid molecule encoding the above-mentioned protein.
[0008] The third purpose of the present application is to provide the use of the above-mentioned protein or the above-mentioned nucleic acid molecule in improving the length and / or yield of cotton fiber or cultivating long fiber and / or high-yield cotton.
[0009] The fourth object of the present application provides an application of a substance for detecting the SNP site in the nucleic acid molecule in identifying or assisting in identifying the fiber length of cotton or in cotton breeding.
[0010] The fifth object of the present application provides any of the following substances: the primer set for amplifying the SNP site; the PCR reagent containing the primer pair; or the kit containing the primer pair or the PCR reagent.
[0011] The sixth object of the present application provides a method for identifying or assisting in identifying the fiber length of cotton.
[0012] The seventh object of the present application provides a method for breeding long-fiber cotton.
[0013] In order to achieve the above objects of the present application, the following technical solutions are adopted:
[0014] In a first aspect, the present application provides a protein, wherein the amino acid sequence of the protein is shown as SEQ ID NO. 1.
[0015] In a second aspect, the present application provides a nucleic acid molecule encoding the above protein.
[0016] Preferably, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2.
[0017] In a third aspect, the present application provides an application of the above protein or the above nucleic acid molecule in improving the fiber length and / or yield of cotton or in breeding long-fiber and / or high-yield cotton.
[0018] In a fourth aspect, the present application provides an application of a substance for detecting the SNP site in the nucleic acid molecule in identifying or assisting in identifying the fiber length of cotton or in cotton breeding, wherein the SNP site includes one or more of the SNP site Chr10-14335026, the SNP site Chr10-14334971, the SNP site Chr10-14334710 or the SNP site Chr10-14333695.
[0019] Further, the SNP site Chr10-14335026 is an A / G mutation.
[0020] The SNP site Chr10-14334971 is a C / T mutation.
[0021] The SNP site Chr10-14334710 is a C / T mutation.
[0022] The SNP site Chr10-14333695 is a C / A mutation.
[0023] Further, the substance for detecting the SNP site in the nucleic acid molecule comprises a primer set for amplifying the SNP site, a PCR reagent containing the primer pair, or a kit containing the primer pair or the PCR reagent.
[0024] Further, the primer set comprises one or more of primer set 1, primer set 2, primer set 3, or primer set 4.
[0025] The nucleotide sequences of the primer set 1 are shown in SEQ ID NO. 3-5, respectively.
[0026] The nucleotide sequences of the primer set 2 are shown in SEQ ID NO. 6-8, respectively.
[0027] The nucleotide sequences of the primer set 3 are shown in SEQ ID NO. 9-11, respectively.
[0028] The nucleotide sequences of the primer set 4 are shown in SEQ ID NO. 12-14, respectively.
[0029] In a fifth aspect, the present application provides any of the following substances:
[0030] The primer set for amplifying the SNP site described above;
[0031] Or, the PCR reagent containing the primer pair described above;
[0032] Or, the kit containing the primer pair or the PCR reagent described above.
[0033] In a sixth aspect, the present application provides a method for identifying or assisting in identifying the fiber length of cotton, comprising detecting the genotype of the SNP site in the nucleic acid molecule described above in the cotton to be tested.
[0034] The fiber length of the cotton to be tested with the genotype of SNP site Chr10-14335026 as TT is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14335026 as CC;
[0035] Or, the fiber length of the cotton to be tested with the genotype of SNP site Chr10-14334971 as GG is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14334971 as AA;
[0036] Or, the fiber length of the cotton to be tested with the genotype of SNP site Chr10-14334710 as GG is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14334710 as AA;
[0037] Or, the fiber length of the to-be-tested cotton with the genotype of GG of SNP site Chr10-14333695 is greater than or candidate greater than the to-be-tested cotton with the genotype of CC of SNP site Chr10-14333695.
[0038] In a seventh aspect, the present application provides a method for breeding long-fiber cotton, comprising detecting the genotype of the SNP site in the nucleic acid molecule in the cotton;
[0039] The cotton with the genotype of TT of SNP site Chr10-14335026 is selected for breeding to obtain the target cotton;
[0040] Or, the cotton with the genotype of GG of SNP site Chr10-14334971 is selected for breeding to obtain the target cotton;
[0041] Or, the cotton with the genotype of GG of SNP site Chr10-14334710 is selected for breeding to obtain the target cotton;
[0042] Or, the cotton with the genotype of GG of SNP site Chr10-14333695 is selected for breeding to obtain the target cotton.
[0043] The present application provides a protein, by genetic transformation of the gene, constructs GhTTL-WMV067 and GhTTL-016 vector, using Agrobacterium-mediated cotton genetic transformation method, overexpression of GhTTL gene, and the fiber data of wild type control group Zhongmushu 49 (ZM49) are statistically compared, it is found that the GhTTL protein can promote the elongation of cotton fiber, its amino acid sequence is shown as SEQ ID NO. 1. Another aspect of the present application also provides the application of the substance for detecting the SNP site in the above nucleic acid molecule in identifying or assisting in identifying the fiber length of cotton or cotton breeding, KASP genotyping is carried out on the SNP site in the promoter region of the fiber development related gene GhTTL in cotton, and a molecular marker capable of identifying cotton seeds with superior fiber is developed. It can assist directional breeding of a large number of cotton varieties, obtain cotton seeds with the present advantage site, as a reliable screening standard, improve the efficiency and accuracy of breeding selection. BRIEF DESCRIPTION OF DRAWINGS
[0044] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.
[0045] Figure 1 This is a comparison diagram of fiber length phenotypes of ZM49 and GhTTL-OE provided in Embodiment 1 of the present invention;
[0046] Figure 2 A comparison diagram of the fiber phenotypes of the CRISPR / Cas9-mediated GhTTL gene editing line and ZM49 provided in Example 1 of this invention;
[0047] Figure 3 This is a diagram illustrating the effect of SNP variations in the promoter region on the expression level of the GhTTL gene, provided in Embodiment 2 of the present invention.
[0048] Figure 4 This is a schematic diagram of KASP analysis marker typing for different samples provided in Embodiment 4 of the present invention. Detailed Implementation
[0049] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.
[0050] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.
[0051] In one aspect, the present invention provides a protein, the amino acid sequence of which is shown in SEQ ID NO.1.
[0052] This study discovered the GhTTL gene. Through genetic transformation of this gene, vectors GhTTL-WMV067 and GhTTL-016 were constructed. Using Agrobacterium-mediated cotton genetic transformation, the GhTTL gene was overexpressed. Statistical comparison with the fiber data of the wild-type control group ZM49 showed that the GhTTL protein can promote the elongation of cotton fibers. Its amino acid sequence is shown in SEQ ID NO.1.
[0053] According to another aspect of the invention, a nucleic acid molecule encoding the aforementioned protein is also provided.
[0054] Nucleic acid molecules refer to polymeric forms of nucleotides of any length, including ribonucleotides and / or deoxyribonucleic acid. Examples of nucleic acid molecules include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases.
[0055] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.2.
[0056] According to another aspect of the invention, the use of the aforementioned protein or nucleic acid molecule in increasing cotton fiber length and / or yield or in cultivating long-fiber and / or high-yielding cotton is also provided.
[0057] According to another aspect of the present invention, the application of a substance for detecting SNP sites in the above-mentioned nucleic acid molecules in the identification or auxiliary identification of cotton fiber length or cotton breeding is also provided, wherein the SNP sites include one or more of SNP sites Chr10-14335026, Chr10-14334971, Chr10-14334710 or Chr10-14333695.
[0058] KASP genotyping was performed on the SNP site in the promoter region of GhTTL, a gene related to fiber development in cotton, to develop a molecular marker that can identify cotton varieties with dominant fibers. This marker can assist in the targeted breeding of large quantities of cotton varieties to obtain cotton varieties with this dominant locus, serving as a reliable screening standard and improving the efficiency and accuracy of breeding and selection.
[0059] In some specific embodiments, the SNP site Chr10-14335026 is an A / G mutation;
[0060] The SNP site Chr10-14334971 is a C / T mutation;
[0061] The SNP site Chr10-14334710 is a C / T mutation;
[0062] The SNP site Chr10-14333695 is a C / A mutation.
[0063] In some specific embodiments, the substance for detecting SNP sites in the nucleic acid molecule includes primer sets for amplifying SNP sites, PCR reagents containing the primer pairs, or kits containing the primer pairs or the PCR reagents.
[0064] The primer set comprises a FAM primer, a HEX primer and a Common primer, and the molar ratio of the FAM primer, the HEX primer and the Common primer is 2:2:5.
[0065] In some specific embodiments, the primer set comprises one or more of primer set 1, primer set 2, primer set 3 or primer set 4.
[0066] The nucleotide sequences of the primer set 1 are shown in SEQ ID NO. 3-5, respectively.
[0067] The nucleotide sequences of the primer set 2 are shown in SEQ ID NO. 6-8, respectively.
[0068] The nucleotide sequences of the primer set 3 are shown in SEQ ID NO. 9-11, respectively.
[0069] The nucleotide sequences of the primer set 4 are shown in SEQ ID NO. 12-14, respectively.
[0070] According to another aspect of the present application, there is also provided any one of the following:
[0071] The primer set for amplifying the SNP site described above;
[0072] Or, the PCR reagent containing the primer pair described above;
[0073] Or, the kit containing the primer pair or the PCR reagent described above.
[0074] According to another aspect of the present application, there is also provided a method for identifying or assisting in identifying the fiber length of cotton, comprising detecting the genotype of the SNP site in the nucleic acid molecule described above in the cotton to be tested.
[0075] The fiber length of the cotton to be tested with the genotype of SNP site Chr10-14335026 being TT is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14335026 being CC;
[0076] Or, the fiber length of the cotton to be tested with the genotype of SNP site Chr10-14334971 being GG is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14334971 being AA;
[0077] Or, the fiber length of the cotton to be tested with the genotype of SNP site Chr10-14334710 being GG is greater than or candidate greater than the cotton to be tested with the genotype of SNP site Chr10-14334710 being AA;
[0078] Or, the fiber length of the to-be-tested cotton whose genotype of SNP site Chr10-14333695 is GG is greater than or candidate greater than that of the to-be-tested cotton whose genotype of SNP site Chr10-14333695 is CC.
[0079] According to another aspect of the present application, a method for selecting long fiber cotton is also provided, comprising detecting the genotype of the SNP site in the nucleic acid molecule in the cotton;
[0080] Selecting the cotton whose genotype of SNP site Chr10-14335026 is TT for breeding to obtain the target cotton;
[0081] Or, selecting the cotton whose genotype of SNP site Chr10-14334971 is GG for breeding to obtain the target cotton;
[0082] Or, selecting the cotton whose genotype of SNP site Chr10-14334710 is GG for breeding to obtain the target cotton;
[0083] Or, selecting the cotton whose genotype of SNP site Chr10-14333695 is GG for breeding to obtain the target cotton.
[0084] The technical solutions of the present application will be described clearly and completely below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0085] Cotton material: 419 different varieties of cotton were selected, including Meidu Mao, CC28, Anti-Imperial Cotton, Yumian No. 1, Wan 3396, Tangmian 7401, Jicun No. 8, Dazemian, Lucun No. 1, Yun'an No. 4, Shen 547, Daehongdae, Xiangxuan No. 2, Dongting No. 3, Nangua cotton, Zaoyang not falling bud, Chingling cotton (Nantong), Xuzhou 1818, Hucun 204, 70-1437, Cimian No. 9, Pengze No. 4, 70-24, Shaoyang big peach, Yan 64-1, Zhizhong 521, Xianmian 858, Esha 28, Xuzhou 514, Xuzhou 142, Simian No. 2, Xiaoxian 133 long wool, Shaanxi Daedae, Baoshan big peach, Ba 6716, Zhongmiansuo No. 12 (Zhong 381), Wuji Yizhuhua, Jicun No. 12, Ecotton No. 12, Daedae 15 x Yapeng cotton, Zhongmiansuo No. 19 (Zhong 7886), Zhong 85271, Keyuan 1, Keyuan 4, Linqing 201, Wan Zao 686, Wan 231, Zhongmiansuo No. 23, Nandang Badi Dahua, 208H-1, Sucun No. 1, Jinyuan 1081, Banong 212, Tu 71-113, Bu 3363, Zhongzhi BD13, Linqing 2350, Huazhong 106, Zhongmiansuo No. 10 (Zhong 509), Heishanmian No. 1, Jinmian No. 2, Liao 113, Chirpan 996, Liaomian No. 9, Zhongmiansuo No. 16 (Zhong 375), Yuzhish 84-1, Liaos 7334-7728, Ji 91-28, Shaan 2754, Shaan 2812, Dacotton No. 20, Jihuan Kangyan, E Q872, Yuzao 275, Yunzao 219, Yun 93 Kang 354, Yun 94H-32, Liaojinmian No. 3, Kuche 96515, Kashen 736, Kuche T94-4, Han 241, Yumian 19, Kuitun system 353, Han 284, Shuangjia 321, Xinluzao 10, Laoyangmian, Lingbaomian, Zhengzhou-385, Luodian Tiesi, Shalai No. 1, Qinli 514, Yun K1505, Ningmian No. 18 (Huadong 6555), Gui Du'an County Wuren Township Bazi, Gui Luocheng Dacotton (1), Yunnan Lijiang County Judian Township Miao Flower, Xinluzhong 5, Suyan 310, Yumian 18, Guoxinmian 3, Jincotton 38, Zhongzhi 86-6, Hongshi 5, Jianyang 303, Ningmian 9, Xinluzao 36, Bole 34, Shaan 4080, Gancotton 12, Zhongyi Hong 2, Suyuan 04-3, Suyuan 04-129, J02508, Zhong R1052, Zhong R2058, Liaos 853, Lu 890, Liaos 2277, Taiyuan 4, Zhongmiansuo 49, Henan 79, Jiucun 2, Jincotton 36, Zhong 2201, Xinluzao 21, Xinluzao 28, Jin 7, Xinluzhong 34, Yibanghong, 73-782, Jingzhou degenerative cotton, Shaan 689, Hedai 65-125, Shaan 954, Rendong 67-86, Jiangsu cotton No. 1, Shaanxian 78-782, Pingtang old Yanghua, 73-184, Beijing 432, Beichugongshe cotton, Kang 5, Xingtai W-2, Ganzao 032, Zhong 5765, Zhong 6331, Jifang 355, Chuan 169-6, E 82-6078, Junmian No. 1,Shanghai 368, Da 4554, Mayangyang, Bama Naliang, 206, Nandannuli, Su Yuan 7252, Huazhong Yuan 91-230, E 901, Sanhu 84-1, 3593, E 19, E 4396, Liao 7003, Jin 417, Nantong 87-598, Tu 83-161, Zhonghu PI 3910a, E 21, Xia 2168, CCRI 30, JCG 82, Shihezi 913, Zhong 203016, Xinjian 96-48, Keyi 7, Xinluzhong 8, Hongjijia, Shi Yuan 345, Bama 1, Dongting 1 VI 3221, Liaoyang, Siyang 630, 70xuansheng 733, Jing 55173, Luyuan 343, Su Yuan 04-162, CCRI 50, Xinluzao 31, Zhongyuan 0114, Zhonghu PI 9321, Henan Daliang Das, Huixuan Yiwoshou, Datao, Yun 1812, Xuzhou 6, Daizi cotton short fruit branch, Xinluzao 7, Yiba Bian, Lucun 2, CCRI 17 (Zhong 117), Lu 1138, E kangmian 8, Shan 416, Lucun 6, CCRI 35, Xinmian 33B, Simian 3, Sucun 9108, CCRI 41, Si 168, Linqing 2352, Chad 3, Zhong 206, Nongguang 1, Turkmenistan upland cotton, Jiucun 8, Jinmian 46, BJA 592, Soviet cotton 78 line (89-57-4), MAR-7A-3, Express, King, American B-35, S 1835, Bao 2367, Wufen 1 ("low phenol"), Nongda 8, Jinmian 49, African cotton E-40, GP 203, Soviet cotton 156 line (91-671), Texas 973, Australian V2 / 757, F 281, Lvxu 1, CCRI 60, Miscot 7803-52, Jifeng 908, Lucunyan 28, GP 135, E 0908, Arkansas 971 (introduced from China 971), Brownxu 1, Jinmian 34, Daizi cotton 16, Australian SiV2, Delcot 277-5, Brown 2-63, Si-6524, GZNn (Mozambique), Xiang 83-238 (Xiangmian 13), Aicimian 1517-70, AC 321, V 1, BP 52, Cha jijiaodezi, Xiangmian 18, PD 2165, Shi kang 39, Shixu H10, Yincun 1, Su you 6036, Huaban leaf, Nongda 7, Bole 07-11, CCRI 81, DES 926, PD 3246, N 74-250, M-8124-1159, Zhong RI 015, PD 6186, American 28114-313, 93 foreign 14, HF 5 RUP, S 3210, Colombia, Dedizi 2404, Pilose-3, Qik, Liaowu 1201 (low phenol), CF-43 / 2, Bukhara 6, Cha jijiaodezi, M-8114-0224, Z 37 less, Babshaw 1, Su BR 6202Bt,PD97072, 149X, Delfos 9169A, Desmotada, Jin Nong Da Yuan 3-1, Soviet Cotton 35 line (91-329-2), 93 Foreign Introduction-17, American 87-2, St213 RNR, Group Cotton ("0" type), L-5F45, MSCO-8, Anjiyan-60, DP90, Misscot 8711ne (glandless), Empire Str N2-4, V83-013, Cestam 86-1 (Mexico), PD0113, Soviet Cotton 118 line (89-73-2), Zhongzhi Cotton No. 2 Rowden, Fergan 175, 93 Foreign Introduction-4, Brazil 006, Zhongwu 372 (low gossypol), Cook 1627 (shan), Greenlint, Xinluzhong 35, Nonglin No. 1, Ning 523, Local Cotton (Russia), Soviet Cotton 12 line (91-359), Liaoyang Multifiber Cotton, Caike 510, Jisugongye Cotton, Li 771-436 (Li non-toxin), 41B006, Dune HS120, Soviet 8909, Baicun No. 1, TYJ-98-35, GP81, Daizi Cotton No. 15, Lambright GL-N, 108F, Pocum No. 3 ("1" type), Si Cotton 453, gL2gl3, Purple Brown Land Cotton, FH682, N73 Deltapine NGF, Local cotton, Zhong 21371, Jil 169, Ari 1327, Ari 971, A41772BBt, SGK 9708 (original), Dalizong 69, Liaoyang Multifiber, Zhong Arc 73, R01 Sandu 85, SA1064B1, K8J508, Zhong R773-310, Zhong R773-314, Zhong 1138E24, R8166S91, Zhongmiansuo 43, Su You 6108, Wangjiang Changrong Cotton, Original 247-31, Ari 3696, Su You 6003, Qin Yuan 93089, A971Bt, RT Baixu, Su Yuan 7235, Wusan Changrong, RTN78, Ari 3697, Zhong 1421, 4133Bt, Zhong 1441, Brown 1-61, Brown 128, Zhongmiansuo 82, Brown S9B11, Brown S9B12, Jicun 668, Kuitun 80-2056W (Xinluzao-3), Langhuang F10 (Baixu), Su Cotton 12, Uganda No. 3, Chang Kang Cotton, 86-1 (72-100), Zhongwu 378, Xuzhou 553, Eguang Cotton, Jicun No. 11, TM-1, Shuangtao Cotton ("0" type), Yahuang Li, Yucun No. 1, Langhuang F10 (Brown XU), Jicun 20, J02-247, CZA (70) 33, Handan 333, Jincun 33, Zhongmiansuo 36, Yucun 8, Yucun 21, Jincun 20, Gancun 11, Su Cotton 22, Su Cotton 9, Yinsan 6, Lucunyan 16, Jincun 25, Ekuang Cotton 10, Zhong 078, Jicun 17, and Eucun 20.
[0086] Example 1 Functional verification of GhTTL gene
[0087] I. Identification of GhTTL gene
[0088] In this embodiment, resequencing of 419 populations combined with whole genome association analysis determines that there is a significant correlation interval with fiber length on chromosome D10, which contains a total of 10 genes. Step-by-step functional verification of these genes shows that GhTTL gene is a functional gene. Analysis determines that the candidate gene related to fiber development is GhTTL. The amino acid sequence of GhTTL protein is shown in SEQ ID NO. 1, and the nucleotide sequence encoding GhTTL gene is shown in SEQ ID NO. 2.
[0089] II. Functional verification of GhTTL gene
[0090] By genetic transformation of the gene, the overexpression vector GhTTL-WMV067 and the gene editing vector GhTTL-016 of GhTTL are constructed. Using a method of Agrobacterium-mediated cotton genetic transformation, overexpression material GhTTL-OE and gene editing material GhTTL-CRISPR of GhTTL are created.
[0091] As shown in Figure 1 , wherein A is the phenotype comparison of mature fiber of GhTTL-OE and ZM49 (wild type WT) plants, scale = 1 cm; B is the expression analysis of GhTTL in overexpression (GhTTL-OE) plants. L1-L5 represent biological repeats of the same variety. The expression level in ZM49 sample is set to 1, and his3 is used as an internal control. Error bars represent the standard deviation (SD) of three independent experiments. C is the statistical analysis of mature fiber length of GhTTL-OE plants. Error bars represent the standard deviation based on 10 independent fiber length measurements. The statistical significance is determined by t test (**P<0.01, ***P<0.001). By statistically comparing the fiber data of GhTTL-OE and the control group ZM49, it is clear that the gene can promote the elongation of fiber.
[0092] As shown in Figure 2Figure 6. The effect of GhTTL gene on fiber development. A, the CRISPR / Cas9 target sequence of GhTTL gene and sequencing verification results of different editing lines. B, fiber phenotype of GhTTL editing lines (GhTTL-CRISPR) and wild type (ZM49) at fiber development stages (10DPA, 15DPA, 20DPA). C, morphological characteristics of mature fibers of GhTTL-CRISPR and ZM49. D, statistical analysis of fiber length of ZM49 and GhTTL-CRISPR lines at 10DPA and 15DPA. E, statistical analysis of fiber length of ZM49 and GhTTL-CRISPR lines at 20DPA and mature fibers. Data are expressed as mean ± standard deviation (n = 10). Statistical significance was determined by Student-t test (*P < 0.05, **P < 0.01). L1, L2 and L3 represent biological replicates of the same variety. Statistical comparison of fiber data between GhTTL-CRISPR and ZM49 showed that knocking out GhTTL gene could inhibit fiber elongation.
[0093] Example 2 identified SNP sites in the GhTTL promoter region
[0094] 1. SNP site confirmation
[0095] Through sequencing and sequence alignment, as shown in A of Figure 3 Figure 5, the distribution map of SNP sites in the promoter region of GhTTL gene was shown. SNP site mutations were identified in the GhTTL promoter region, forming two haplotypes (Hap1 and Hap2). As shown in B of Figure 3 Figure 5, a box plot showed the association analysis between the two haplotypes of the GhTTL promoter region and the fiber length phenotype. In the box plot, the center line represents the median, the box represents the interquartile range, and the whiskers represent the data range. Statistical significance between groups was evaluated using a two-tailed t-test. The fiber length data of the two haplotypes were statistically analyzed, and it was found that the fiber length of the Hap1 variety was significantly longer than that of the Hap2 variety. Figure 3In Figure C, the qRT-PCR analysis shows the relative expression levels of GhTTL in different haplotype materials. The GhTTL expression level in D054 was used as a reference (set to 1), and his3 was used as an internal control. Error bars represent the standard deviation (SD) of three biological replicates. Figure D shows the luciferase reporter assay for detecting LUC expression driven by the GhTTL-P-Hap1 promoter, and Figure E shows the luciferase reporter gene assay for detecting LUC expression driven by the GhTTL-P-Hap2 promoter. The ability of the two promoter genotypes to drive gene expression was validated, showing that the Hap1 promoter drives GhTTL expression more strongly than the Hap1 promoter, thereby promoting fiber elongation. These results demonstrate that SNP mutations in the GhTTL promoter region cause significant changes in fiber length.
[0096] 2. Feasibility analysis of developing KASP molecular markers from SNP sites
[0097] By analyzing the sequence, such as Figure 3 In the A section, it was found that SNP site 14335101 was not suitable for developing KASP markers due to its multiple copy sequence. SNP sites Chr10-14335026, Chr10-14334971, Chr10-14334710, and Chr10-14333695 could all be explored for KASP marker development.
[0098] Example 3: Development of KASP molecular markers for SNP sites
[0099] Extract at least 150bp flanking sequences upstream and downstream of the development site, and analyze the sequence copy number and GC content of the site to be developed. Generally, the probability of successful development of high copy sequences, high GC and high repetition sequences is very low, and they are not developed.
[0100] 1. Primer design and synthesis
[0101] KASP primers were designed for SNP sites and flanking sequences using Bactprimer 3 software. Each KASP marker set consisted of two specific primers and one universal primer. A FAM fluorescent adapter sequence (GAAGGTGACCAAGTTCATGCT) was ligated to the 5' end of specific primer 1F (FAM is indicated in red on the Y-axis). A HEX fluorescent adapter sequence (GAAGGTCGGAGTCAAC GGATT) was ligated to the 5' end of specific primer 2F (HEX is indicated in blue on the X-axis). The primers were synthesized by Huazhi Biotechnology Co., Ltd.
[0102] The KASP genotyping molecular marker primer sequence information for the four SNP sites is as follows:
[0103] Chr10-14335026:
[0104] Specific primer 1F (SEQ ID NO. 3): GAAGGTGACCAAGTTCATGCTGTTCACACACAAATGGCGATCCT;
[0105] Specific primer 2F (SEQ ID NO. 4): GAAGGTCGGAGTCAACGGATTGTTCACACACAAATGGCGATCCC;
[0106] Universal primer R (SEQ ID NO. 5): CTACTAGCACGGACAAAGGAAAAG.
[0107] Chr10-14334971:
[0108] Specific primer 1F (SEQ ID NO. 6): GAAGGTGACCAAGTTCATGCTCAAGTTTTGCTTTTCCTTTGTCCG;
[0109] Specific primer 2F (SEQ ID NO. 7): GAAGGTCGGAGTCAACGGATTACAAGTTTTGCTTTTCCTTTGTCCA;
[0110] Universal primer R (SEQ ID NO. 8): TGTTGTGAACCAGCCAAACCATCTAC.
[0111] Chr10-14334710:
[0112] Specific primer 1F (SEQ ID NO. 9): GAAGGTGACCAAGTTCATGCTCATGCACGTAACCTTTTTCCTAAGC;
[0113] Specific primer 2F (SEQ ID NO. 10): GAAGGTCGGAGTCAACGGATTCCATGCACGTAACCTTTTTCCTAAGT;
[0114] Universal primer R (SEQ ID NO. 11): GAATAATCGATGAGAGAACTTTCCAC.
[0115] Chr10-14333695:
[0116] Specific primer 1F (SEQ ID NO. 12): GAAGGTGACCAAGTTCATGCTAAAAGACAAAAGATAGGCAAAATCAAG;
[0117] Specific primer 2F (SEQ ID NO. 13): GAAGGTCGGAGTCAACGGATTAAAAGACAAAAGATAGGCAAAATCAAT;
[0118] Universal primer R (SEQ ID NO. 14): ACATGGGTGATTTCCAACATGAATG.
[0119] 2. Establishment of KASP method
[0120] 1) Sample DNA extraction
[0121] The DNA extraction of the sample was performed by standard magnetic bead method, mainly including the following steps:
[0122] A1, add 4mm steel balls to the sample well plate, cover with silica gel cover, grind at 1400rpm for 2min;
[0123] A2, after grinding, add 400ul lysis solution to the well plate, incubate for 1h;
[0124] A3, after incubation, centrifuge at 3600rpm for 10min, put into LGC automatic magnetic bead extractor, run plant DNA extraction program;
[0125] A4, confirm that there is no error in the program running, complete the DNA extraction process, and store the DNA for later use.
[0126] 2) KASP amplification:
[0127] The genomic DNA of the above-mentioned sample to be tested was used as a template for KASP amplification with KASP typing molecular marker primers. Primer working solution: dissolve FAM primer, HEX primer and Common primer primer dry powder to 100μM, take 12μl FAM primer, 12μl HEX primer and 30μl Common primer, then supplement 46μl water to obtain primer working solution, wherein the concentration of FAM primer is 12μmol / L, the concentration of HEX primer is 12μmol / L, and the concentration of Common primer is 30μmol / L.
[0128] The KASP amplification system is shown in Table 1, the microplate type is microreaction hole film, unit μL. Douglas platform for PCR amplification, the PCR amplification conditions are shown in Table 2.
[0129] Table 1 KASP amplification system
[0130] Component Amount DNA template (10-20 ng / ul) 0.8 ng (oven dried) 2x PCR MIX 0.40 μL Primer working solution 0.01 μL Double distilled water 0.39 μL Total reaction volume 0.8 μL
[0131] Table 2 KASP amplification conditions
[0132]
[0133] Wherein, PCR according to the appropriate number of cycles of the case of typing.
[0134] 3) Fluorescence scanning: ARAYA was used to scan the fluorescence signal of the reaction system; then INTELLICS was used for data analysis and genotyping.
[0135] Example 4 Assay validation KASP molecular markers associated with fiber length
[0136] 94 samples were selected from the initial 419 samples, which contained Hap1 and Hap2 homozygous genotypes and heterozygous genotypes. The 94 samples were detected using four molecular markers respectively.
[0137] KASP marker verification was performed on 94 samples using the Array Tape system of Douglas Scientific. NEXAR was used for PCR system assembly, and the amplification system and conditions shown in Tables 1 and 2 were used for operation. After the completion of the PCR reaction, ARAYA was used to scan the fluorescence signal of the reaction system; then INTELLICS was used for data analysis and genotyping.
[0138] The marker genotyping diagram is shown in Figure 4 , wherein type A indicates that the sample contains a reference genotype homozygous site at this KASP marker site (marked in red in the genotyping diagram, located in the upper left corner of the graph), type B indicates that the sample contains a mutant genotype homozygous site at this KASP marker site (marked in blue in the genotyping diagram, located in the lower right corner of the graph), and the heterozygous genotype indicates that the sample contains A and B heterozygous alleles at this KASP marker site (marked in purple in the genotyping diagram, located near the 45-degree axis center of the coordinate axis). The genotypes of each sample are shown in Table 3.
[0139] Through collating and analyzing the detection results of the four KASP molecular markers developed, it is shown that the four molecular markers can be clearly defined as having polymorphism, but from the aspects of typing and specificity, the marker typing of SNP site No. 14335026 (Chr10-14335026) is generally biased to FAM homozygous, VIC homozygous clusters are not concentrated enough, and the typing effect is general. The marker typing of the other three sites (Chr10-14334971, Chr10-14334710 and Chr10-14333695) all have good typing effect and the genes have strong correlation, the typing effect is highly unified, which proves that the molecular marker has high accuracy.
[0140] Table 3 KASP molecular marker detection results of different samples
[0141]
[0142]
[0143]
[0144]
[0145] Wherein, N represents not detected.
[0146] As shown in Table 3, the samples numbered 3, 10, 12, 24, 28, 31, 39, 48, 54, 55, 59, 61, 62, 66, 72, 80, 85 and 90 do not meet the conditions of long fiber trait cotton from the aspect of genotypes, and the other samples are consistent with the detection results of the four SNP sites, and are all cotton with long fiber traits; at the same time, comparing the above results with the field fiber length phenotype of each sample, it is found that the fiber length of the other samples is elongated to different degrees compared with the fiber length of the samples numbered 3, 10, 12, 24, 28, 31, 39, 48, 54, 55, 59, 61, 62, 66, 72, 80, 85 and 90, which is consistent with the genotyping judgment result.
[0147] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.
Claims
1. Use of a protein or a nucleic acid molecule encoding the protein in increasing the length of cotton fiber or breeding long fiber cotton; the amino acid sequence of the protein is shown as SEQ ID NO. 1; the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.
2.
2. Use of a substance for detecting a SNP site in the promoter of the nucleic acid molecule of claim 1 in identifying or assisting in identifying the length of cotton fiber, wherein the SNP site comprises one or more of SNP site Chr10-14334971, SNP site Chr10-14334710 or Chr10-14333695; the substance for detecting a SNP site in the promoter of the nucleic acid molecule of claim 1 comprises a primer set for amplifying the SNP site, a PCR reagent containing the primer set or a kit containing the primer set or the PCR reagent; the primer set comprises one or more of primer set 2 for amplifying SNP site Chr10-14334971, primer set 3 for amplifying SNP site Chr10-14334710 or primer set 4 for amplifying SNP site Chr10-14333695; the nucleotide sequence of the primer set 2 is shown as SEQ ID NO. 6-SEQ ID NO. 8, respectively; the nucleotide sequence of the primer set 3 is shown as SEQ ID NO. 9-SEQ ID NO. 11, respectively; the nucleotide sequence of the primer set 4 is shown as SEQ ID NO. 12-SEQ ID NO. 14, respectively.
3. Use according to claim 2, characterized in that, the SNP site Chr10-14334971 is a G / A mutation; the SNP site Chr10-14334710 is a G / A mutation; the SNP site Chr10-14333695 is a G / T mutation.
4. Any one of the following: A, one or more of primer set 2-primer set 4 for amplifying the SNP site of claim 2; or, B, a PCR reagent containing the primer set of A; or, C, a kit containing the primer set of A or the PCR reagent of B.
5. A method of identifying or assisting in the identification of cotton fiber length, characterized in that, comprises detecting the genotype of the following SNP site in the promoter of the nucleic acid molecule of claim 1 in the cotton to be tested; the fiber length of the cotton to be tested with the genotype GG of SNP site Chr10-14334971 is greater than or is a candidate for being greater than the cotton to be tested with the genotype AA of SNP site Chr10-14334971; or, the fiber length of the cotton to be tested with the genotype GG of SNP site Chr10-14334710 is greater than or is a candidate for being greater than the cotton to be tested with the genotype AA of SNP site Chr10-14334710; or, the fiber length of the cotton to be tested with the genotype GG of SNP site Chr10-14333695 is greater than or is a candidate for being greater than the cotton to be tested with the genotype CC of SNP site Chr10-14333695; The primer set used comprises one or more of primer set 2 for amplifying SNP site Chr10-14334971, primer set 3 for amplifying SNP site Chr10-14334710 or primer set 4 for amplifying SNP site Chr10-14333695; the nucleotide sequences of the primer set 2 are shown in SEQ ID NO. 6~SEQ ID NO. 8, respectively; the nucleotide sequences of the primer set 3 are shown in SEQ ID NO. 9~SEQ ID NO. 11, respectively; the nucleotide sequences of the primer set 4 are shown in SEQ ID NO. 12~SEQ ID NO. 14, respectively.
6. A method of breeding long-staple cotton, characterized by, genotype of the SNP site in the promoter of the nucleic acid molecule of claim 1 in cotton is detected; cottons with genotype GG of SNP site Chr10-14334971 are selected for breeding to obtain the target cotton; or, cottons with genotype GG of SNP site Chr10-14334710 are selected for breeding to obtain the target cotton; or, cottons with genotype GG of SNP site Chr10-14333695 are selected for breeding to obtain the target cotton; The primer set used comprises one or more of primer set 2 for amplifying SNP site Chr10-14334971, primer set 3 for amplifying SNP site Chr10-14334710 or primer set 4 for amplifying SNP site Chr10-14333695; the nucleotide sequences of the primer set 2 are shown in SEQ ID NO. 6~SEQ ID NO. 8, respectively; the nucleotide sequences of the primer set 3 are shown in SEQ ID NO. 9~SEQ ID NO. 11, respectively; the nucleotide sequences of the primer set 4 are shown in SEQ ID NO. 12~SEQ ID NO. 14, respectively.
Citation Information
Patent Citations
heat exchanger for gases, vapors and liquids
DE913292C
The catalytic hydrogenation method in the liquid phase is used to convert aldehydes into corresponding alcohols.
SA1064B1