A strain of Stenotrophomonas maltophilia with oxybenzone-degrading ability and its application

Abstract

The present invention discloses a strain of Stenotrophomonas maltophilia capable of degrading oxybenzone and its applications. The strain, Stenotrophomonas maltophilia CJY, is extracted from sewage plant sludge and has a highly efficient oxybenzone degradation effect, relatively completely converting the pollutant into harmless substances such as CO2 and H2O. Therefore, it has broad application prospects in the biological purification of industrial waste gas and wastewater. In an environment with a pH of 7, the strain can achieve a 50% removal rate for 50 mg / L of oxybenzone and a 30% removal rate for 125 mg / L or less of oxybenzone.

Description

(1) Technical field

[0001] The invention relates to a strain of Stenotrophomonas maltophilia with the ability to degrade oxybenzone and application thereof. (2) Background technology

[0002] Oxybenzone is an organic compound and a derivative of benzophenone. Also known as p-hydroxybenzoate or paraben, oxybenzone is a slightly yellow crystalline powder with a melting point of 66°C. It is a chemical preservative widely used in cosmetics, food, and pharmaceuticals. It is insoluble in water but soluble in various organic solvents, including ethanol, ethyl acetate, and methanol.

[0003] Oxybenzone has multiple negative biological effects, including inhibition of androgen activity, endocrine disruption, and genotoxicity. Although it is classified as low-toxic, its widespread use has led to its presence in environmental water bodies, including Swiss lakes, Spanish rivers, and Chinese river sediments. This pollutant is difficult to remove through conventional water treatment processes, so the monitoring and control of oxybenzone has become an urgent issue.

[0004] Therefore, it is necessary to study the efficient degradation of oxybenzone in the environment for human health. (3) Summary of the invention

[0005] The present invention aims to provide a strain of Stenotrophomonas maltophilia capable of degrading oxybenzone and its use. The strain, Stenotrophomonas maltophilia CJY, can efficiently degrade oxybenzone using it as its sole carbon source, grows in a mild environment, and is easily scalable. The discovery of this degrading bacterium is of great significance for the efficient purification of oxybenzone, a new pollutant, from wastewater.

[0006] The technical solution adopted in the present invention is:

[0007] The present invention provides a new oxybenzone-degrading bacterium, Stenotrophomonas maltophilia CJY, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M20242471 and a deposit date of November 7, 2024. The address is Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of the Stenotrophomonas maltophilia CJY of the present invention are: the colonies are light yellow, disc-shaped, spore-free and have flagella; the edges are neat, opaque and easy to pick up, and the bacterial lawn grows along the streaks; the colonies are aerobic and Gram-negative.

[0009] The present invention also provides an application of Stenotrophomonas maltophilia in degrading oxybenzone. Specifically, the application comprises adding a bacterial solution obtained by expanded culture of Stenotrophomonas maltophilia CJY or resting cells obtained by centrifugation of the bacterial solution to an inorganic salt culture medium containing oxybenzone at a pH of 6 to 8, and culturing the culture medium at 10 to 30° C. and 100 to 200 rpm to achieve degradation of oxybenzone.

[0010] Furthermore, in the inorganic salt culture solution, the amount of bacterial solution added is expressed as OD 600 The amount of resting cells added is 50-150 mg / L (preferably 92 mg / L) based on dry weight.

[0011] Furthermore, the initial addition concentration of oxybenzone in the inorganic salt culture solution is 50 to 150 mg / L.

[0012] Furthermore, the inorganic salt culture medium is composed of: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl3 0.0162g / L, trace element mother solution 5mL / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution is composed of: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014 g / L, ZnSO4·7H2O 0.10 g / L, and the solvent was deionized water.

[0013] Furthermore, the resting cells of Stenotrophomonas maltophilia CJY are prepared according to the following steps:

[0014] (1) Slant culture:

[0015] Stenotrophomonas maltophilia CJY was inoculated into a slant LB solid medium and cultured at 30°C for 24-36 hours to obtain slant bacteria. The final concentration of the LB solid medium was as follows: NaCl 10 g / L, tryptone 10 g / L, yeast powder 5 g / L, agar 18-20 g / L, the solvent was deionized water, and the pH value was natural.

[0016] (2) Expanded training

[0017] Use an inoculation loop to pick the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Incubate at 30°C and 160 rpm for 24-36 h to obtain the OD 600 =0.1-0.2 bacterial liquid, centrifuged, collected wet cells, washed with inorganic salt culture medium, and obtained resting cells of Stenotrophomonas maltophilia CJY; the final concentration of the LB liquid culture medium was: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent was deionized water, and the pH value was natural.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The Stenotrophomonas maltophilia CJY provided by the present invention is obtained from sewage plant sludge and has a highly efficient degradation effect on oxybenzone. It can relatively completely convert the pollutant into harmless substances such as inorganic substances (CO2, H2O) and cellular biomass, and therefore has broad application prospects in the biological purification of industrial waste gas and wastewater.

[0020] The Stenotrophomonas maltophilia CJY of the present invention can achieve a removal rate of 50% for 50 mg / L of oxybenzone in an environment of pH=7, and a removal rate of 30% for oxybenzone within 125 mg / L. (IV) Description of the accompanying drawings

[0021] Figure 1 This is a photo of the colony morphology of strain CJY on LB medium.

[0022] Figure 2 Transmission electron micrograph of strain CJY.

[0023] Figure 3 This is the phylogenetic tree of strain CJY.

[0024] Figure 4 This is a liquid chromatography analysis chart of oxybenzone.

[0025] Figure 5 This is the degradation curve of Stenotrophomonas maltophilia CJY for different concentrations of oxybenzone.

[0026] Figure 6 This is the degradation curve of Stenotrophomonas maltophilia CJY for 100 mg / L oxybenzone at different pH values.

[0027] Figure 7 The degradation rate of 100 mg / L oxybenzone by Stenotrophomonas maltophilia CJY at different pH values ​​on day 12.

[0028] Figure 8 OD of the culture medium 600 and dry weight curve of bacteria. (V) Specific implementation methods

[0029] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] The composition of the inorganic salt culture medium is as follows: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl3 0.0162g / L, trace element mother solution 5mL / L, solvent is deionized water, pH 7.0; the trace element mother solution composition is: CuSO4·5H2O0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014 g / L, ZnSO4·7H2O 0.10 g / L, and the solvent was deionized water.

[0032] The final concentration composition of LB solid medium is: NaCl 10 g / L, tryptone 10 g / L, yeast powder 5 g / L, agar 18-20 g / L, the solvent is deionized water, and the pH value is natural.

[0033] The final concentration composition of LB liquid culture medium is: NaCl 10 g / L, peptone 10 g / L, yeast powder 5 g / L, the solvent is deionized water, and the pH value is natural.

[0034] Example 1: Isolation, purification and identification of strain CJY.

[0035] 1. Isolation and purification of strain CJY.

[0036] Strain CJY is a Gram-negative bacterium domesticated and isolated from activated sludge taken from a sewage treatment plant.

[0037] The specific steps are as follows:

[0038] Add 100 mL of inorganic salt culture medium to a 300 mL shake flask, add 10 mL of activated sludge and 100 mg / L of oxybenzone for enrichment culture. When the oxybenzone concentration is lower than the initial concentration, take out 5 mL of the enrichment solution and add it to 100 mL of fresh inorganic salt culture medium. Add the same concentration of oxybenzone. Repeat the above enrichment process 5 times. Then, dilute the last enrichment solution in a gradient manner and apply it to LB solid medium. Select a single colony to isolate the plate and draw a line for purification ( Figure 1 ), the candidate bacteria were added to the inorganic salt medium, and oxybenzone was added as the only carbon source and energy source for verification, and the target strain CJY was obtained. Its morphology was determined by transmission electron microscopy ( Figure 2 ).

[0039] 2. Identification of strain CJY

[0040] (1) Characteristics of strain CJY: The colonies are light yellow, disc-shaped, with neat edges, opaque, and easy to pick. Transmission electron microscopy revealed that the bacteria were oval bacilli with flagella, measuring 3000 × 7000 nm, and Gram-negative.

[0041] (2) Identification through 16S rRNA sequence analysis and physiological and biochemical experiments

[0042] DNA from strain CJY was extracted and purified using an Ezup column-based bacterial genomic DNA extraction kit and stored at 4°C. PCR amplification was performed on the purified DNA using universal bacterial primers: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as 94°C pre-denaturation for 4 minutes, followed by 30 cycles of denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 1 minute, followed by a final repair and extension at 72°C for 10 minutes. The PCR product was purified and sequenced (Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The 16S rRNA sequencing results were uploaded to NCBI, obtaining accession number PQ579954. The sequence was then compared with the gene sequence in the NCBI database by blast. It was found to belong to the genus Stenotrophomonas and had 92% homology with Stenotrophomonas maltophilia strain HIB-100, Stenotrophomonas maltophilia strain F4-2-40, and Stenotrophomonas sp. DT40. Ten representative strains of Stenotrophomonas were selected from the results and a phylogenetic tree was constructed using MEGA-X version 10.2.6 software based on 16S rRNA gene sequence homology. Figure 3 The strain was identified as Stenotrophomonas maltophilia by comparison of genetic distance and 16S rRNA sequence.

[0043] (3) The ability of strain CJY to utilize 47 carbon sources on the BioMérieux GN card.

[0044] use The metabolic status of the strains to 47 different carbon sources was investigated using the 2compact fully automatic microbial analysis system (GN card) (entrusted to Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. 2compact fully automatic microbial analysis system (GN card) detection showed that strain CJY could strongly utilize 10 carbon sources, but could not utilize the other 37 carbon sources.

[0045] Table 1 Strain CJY 2Compact fully automatic microbial analysis system biochemical reaction results

[0046]

[0047]

[0048] Note: +, positive reaction; -: negative reaction

[0049] Through strain morphology, 16S rRNA sequence analysis and physiological and biochemical experiments, strain CJY was identified as Stenotrophomonas maltophilia, named Stenotrophomonas maltophilia CJY, and deposited in the China Center for Type Culture Collection with the deposit number: CCTCCNO: M 20242471, deposit date: November 7, 2024, address: Wuhan University, Wuhan, 430072, China.

[0050] Example 2: Obtaining Stenotrophomonas maltophilia CJY resting cells

[0051] 1. Slant culture:

[0052] Stenotrophomonas maltophilia CJY was inoculated into LB liquid culture medium and cultured at 30°C and 160 rpm for 24 to 36 hours. The activated bacteria were then streaked onto solid LB plates and cultured in a 30°C incubator. A single colony was taken and streaked onto the plate to detect the purity of the bacteria. The LB test tube slant was then stored as usual (4°C).

[0053] 2. Expand training

[0054] Inoculate the slant bacteria in step 1 into LB liquid medium and culture at 30°C, 160 rpm for 24-36 h to obtain the OD 600 = 0.1-0.2 bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt medium, and obtain resting cells of Stenotrophomonas maltophilia CJY.

[0055] Example 3: Degradation performance of Stenotrophomonas maltophilia CJY on oxybenzone at different concentrations.

[0056] The inorganic salt culture medium was divided into 300 mL shaking flasks, 100 mL per bottle, and sterilized at 110°C for 40 min. After sterilization, it was placed at room temperature for 2 days to confirm that no bacteria grew. The resting cells obtained by the method of Example 2 were added to a final concentration of 92 mg / L (based on cell dry weight), and then oxybenzone was added as the sole carbon source to a final concentration of 50, 75, 100, 125, and 150 mg / L, respectively. After the shaking flask was sealed, it was cultured on a shaking table at 30°C and 160 rpm, and a blank control without bacteria was performed. The residual oxybenzone concentration in the shaking flask was determined regularly by liquid chromatography ( Figure 4 (The liquid chromatogram of the reaction solution after 0h reaction with 100mg / L substrate) was drawn to draw the removal rate curve of oxybenzone with different initial concentrations of the strain over time. The results are shown in Figure 5 The results showed that when the concentration of oxybenzone was 50-125 mg / L, strain CJY could effectively degrade the added substrate.

[0057] Liquid chromatography parameters for determining oxybenzone concentration: the chromatograph was a Waters Alliance e2695 high performance liquid chromatograph (Waters, USA), the chromatographic column was a CORBAX SB-C18 column (5 μm, 4.5×250 mm), the mobile phase was a volume ratio of water to methanol containing 3% acetic acid of 25:75, the injection time was 6 min, the detection wavelength was 290 nm, the injection volume was 10 μL, and the volume flow rate was 1.0 mL×min -1 , column temperature was 30°C, and peak elution time was approximately 4.5 min.

[0058] Example 4: Degradation performance of Stenotrophomonas maltophilia CJY on 100 mg / L oxybenzone under different initial pH environments.

[0059] The inorganic salt culture medium was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0) using 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution, and the bacterial solution prepared by the method of Example 2 was inoculated under the condition of an initial oxybenzone concentration of 100 mg / L. The initial bacterial solution concentration in each replicate was expressed as OD 600 The sample was shaken and cultured in a constant temperature shaker at 30°C and 160 rpm, and a blank control without bacteria was made. The residual oxybenzone concentration in the shake flask was measured regularly using the method in Example 3. The removal rate of oxybenzone in different pH environments was plotted over time, and the degradation rate of oxybenzone at 100 mg / L at different pH values ​​after 12 days was plotted. The results are shown in Figure 3. Figure 6 and Figure 7 The results showed that Stenotrophomonas maltophilia CJY had a good degradation effect on paraoxybenzone at pH 6-8, and the degradation effect of paraoxybenzone was the best at pH 7.

[0060] Different amounts (1, 1.5, 2, 2.5, 3, 3.5 mL) of the maltogenic bacteria CJY culture prepared by the method of Example 2 were added to 100 mL of inorganic salt culture medium, and the corresponding OD values ​​were measured using a UV absorption analyzer. 600 The inorganic salt culture medium containing the bacterial solution was centrifuged and dried, and the corresponding bacterial dry weight was obtained by weighing. The OD values ​​corresponding to different bacterial dry weights were plotted. 600 Value curve, the results are shown in Figure 8 .

[0061] Although the present invention has been disclosed above with reference to the embodiments, it is not intended to limit the scope of protection of the present invention. Any changes and modifications made by any technician familiar with the technology without departing from the concept and scope of the present invention should fall within the scope of protection of the present invention.

Claims

1. A strain of Stenotrophomonas maltophilia CJY with the ability to degrade oxybenzone, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO: M 20242471, deposit date: November 7, 2024, address: Wuhan University, Wuhan, China, 430072.

2. Use of the Stenotrophomonas maltophilia CJY according to claim 1 in degrading oxybenzone.

3. The use according to claim 2, characterized in that The application is to obtain a bacterial liquid or resting cells obtained by centrifugation of the bacterial liquid after expanding the culture of Stenotrophomonas maltophilia CJY, add it to an inorganic salt culture medium with a pH of 6 to 8 and containing oxybenzone, and culture it at 10 to 30° C. and 100 to 200 rpm to achieve the degradation of oxybenzone.

4. The use according to claim 3, characterized in that The initial addition concentration of oxybenzone in the inorganic salt culture medium is 50-150 mg / L.

5. The use according to claim 3, characterized in that In the inorganic salt culture medium, the amount of bacterial solution added is expressed as OD 600 The amount of resting cells added is 50-150 mg / L based on dry weight.

6. The use according to claim 3, characterized in that The inorganic salt culture medium is composed of: K2HPO4·3H2O0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl3 0.0162g / L, trace element mother solution 5ml / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution Composition: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, solvent is deionized water.

7. The use according to claim 3, characterized in that Stenotrophomonas maltophilia CJY resting cells were prepared as follows: (1) Slant culture: Stenotrophomonas maltophilia CJY was inoculated into a slant LB solid medium and cultured at 30°C for 24-36 h to obtain slant cells; (2) Expansion culture: Use an inoculation loop to pick the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 30°C and 160 rpm for 24-36 hours to obtain the OD 600 = 0.1-0.2 bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt culture solution, and obtain resting cells of Stenotrophomonas maltophilia CJY.

Images