Phytobacterium plantarum HUCF14 and application thereof in preparation of medicine for relieving ferroptosis

Abstract

The invention discloses a plant lactobacillus HUCF14 strain and application thereof in preparation of a medicine for relieving ferroptosis, and belongs to the technical field of functional microorganisms. In order to excavate a microecological preparation for treating ferroptosis related diseases, the invention separates a plant lactobacillus HUCF14 strain, and the strain HUCF14 strain is proved to have better tolerance and no toxicity to artificial gastrointestinal fluid through a simulated gastrointestinal fluid experiment and a toxicity evaluation experiment; the establishment of a drosophila ferroptosis model proves that the following symptoms caused by ferroptosis can be improved by taking the strain HUCF14: degeneration of action ability, shortening of sleep duration, anxiety and unease, reduction of DPPH free radical scavenging ability and antioxidant ability and reduction of glutathione level; the expression of an intestinal tissue ferroptosis related gene gpx4 is abnormal; and the intestinal flora structure is disordered. The strain HUCF14 provided by the invention can be used for preparing medicines for relieving ferroptosis, and a new way is opened up for relieving ferroptosis.

Description

Technical Field

[0001] The invention belongs to the technical field of functional microorganisms, and particularly relates to a strain of Lactobacillus plantarum HUCF14 and application thereof in preparing a medicine for alleviating ferroptosis. Background Art

[0002] Ferroptosis is a new form of programmed cell death, which is mainly manifested by iron ion accumulation, lipid reactive oxygen species (ROS) deposition, glutathione (GSH) depletion, inhibition of cystine / glutamate antiporter (System Xc-), and lipid peroxide accumulation (Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease [J]. Nature Reviews Molecular Cell Biology, 2021, 22 (4): 266-82.). Currently, there are four proven pathways to resist ferroptosis: System Xc- / GSH / GPX4 pathway, FSP1 / CoQ / NAD(P)H pathway, GCH1 / BH4 / BH2 pathway and DHODH / CoQ pathway (Huang L, Bian M, Zhang J, Jiang L. Iron Metabolism and Ferroptosis in Peripheral Nerve Injury. Oxidative Medicine and Cellular Longevity, 2022, 2022: 1-14.). As research deepens, it has been found that ferroptosis caused by abnormal GPX4 function plays an important role in the occurrence and development of various diseases, such as cancer, inflammatory bowel disease, neurodegenerative diseases, brain damage, liver disease, cardiovascular disease, etc. (Li J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, Sun B, Wang G. Ferroptosis: past, present and future. Cell death & disease, 2020, 11 (2): 88.). Among them, ferroptosis is one of the most important forms of cell death in intestinal and brain diseases.

[0003] Current research on GPX4 has found that mice with specific knockout of GPX4 in the brain show symptoms of cognitive decline and hippocampal neuron degeneration. Alpha-lipoic acid antioxidant dietary supplements can downregulate the expression of Tfr1, upregulate Sla7a11, Gpx4, etc., and reverse neuron degeneration in the brain (Ran Q, Liang H. The use of GPx4 knockout mice and transgenic mice to study the roles of lipid peroxidation in diseases and aging. Studies on Experimental Models, 2011: 265-78.). In addition, after Alzheimer's disease model mice were supplemented with polyunsaturated fatty acids in their diet, the degree of lipid peroxidation in brain tissue was alleviated and the deposition of β-amyloid protein was reduced (Chen C, Liao J, Xia Y, Liu X, Jones R, Haran J, McCormick B, Sampson TR, Alam A, Ye K. Gut microbiota regulate Alzheimer's disease pathologies and cognitive disorders via PUFA-associated neuroinflammation. Gut, 2022, 71(11): 2233-52.).After selective knockout of GPX4, mice rapidly developed paralysis, characterized by increased lipid peroxidation, decreased hippocampal neurons, increased astrocyte proliferation, severe degeneration of spinal motor neurons, and death within 8 weeks, confirming the important role of GPX4 in motor neurons; and after supplementation with vitamin E (antioxidant), paralysis and death were delayed, confirming that under the premise of GPX4 deficiency, inhibiting lipid peroxidation is also of great significance (Hambright WS, Fonseca RS, Chen L, Na R, Ran Q. Ablation offerroptosis regulator glutathione peroxidase 4 in forebrain neurons promotes cognitive impairment and neurodegeneration. Redox biology, 2017, 12: 8-17.) (Yoo SE, Chen L, Na R, Liu Y, Rios C, Van Remmen H, Richardson A, Ran Q. Gpx4 ablation in adult mice results in a lethal phenotype accompanied by neuronal loss in brain. Free Radical Biology andMedicine, 2012, 52(9): 1820-7.). Traumatic brain injury mice showed neuronal death and ferroptosis caused by abnormal GPX4 function. It was also found that the intestinal flora represented by Aeromonas sp. also showed structural abnormalities, suggesting that Aeromonas may cause ferroptosis and brain damage. The study further confirmed that infection with intestinal Aeromonas salmonicida can cause intestinal ferroptosis. Based on the above results, the research team used romonas hydrophila for intestinal infection, and the infected mice also showed symptoms of ferroptosis and brain damage phenotypes, further suggesting that ferroptosis induced by intestinal flora represented by Aeromonas may play a role in the two-way communication between the gut and the brain indirectly or systematically.In addition, studies have confirmed that inhibiting ferroptosis can reduce acute lung injury caused by intestinal ischemia reperfusion injury, and the intestinal flora metabolite capsaicin ester can increase the expression of gpx4 by activating TRPV1 in intestinal ischemia reperfusion injury and ileal organoid hypoxia / reoxygenation injury, regulate lipid peroxidation, and inhibit ferroptosis (Deng F, Zhao BC, Yang X, Lin ZB, Sun QS, Wang YF, Yan ZZ, Liu WF, Li C, Hu JJ. The gutmicrobiota tametabolite capsiate promotes Gpx4 expression by activating TRPV1 to inhibit intestinal ischemia reperfusion-induced ferroptosis. Gut microbes, 2021, 13(1): 1-21.).

[0004] Based on the above studies, the lipid peroxidation process caused by GPX4 dysfunction is closely related to the intestinal flora and its metabolites, and can play a role in a variety of diseases indirectly or systematically. Therefore, it is of great significance to develop functional dietary supplements that can effectively alleviate ferroptosis-related diseases by targeting and regulating the GPX4-mediated lipid peroxidation process, exploring effective intestinal microecological preparations, and developing effective ferroptosis-related diseases. Summary of the invention

[0005] In order to explore the microecological preparations for treating ferroptosis-related diseases by targeting and regulating the lipid peroxidation process mediated by GPX4, the present invention isolated a Gram-positive bacterium HUCF14, identified the strain as Lactobacillus plantarum through morphological and molecular biological identification, and confirmed that the strain HUCF14 has good tolerance to artificial gastrointestinal fluid and is non-toxic through simulated gastrointestinal fluid experiments and toxicity evaluation experiments; and confirmed that the strain HUCF14 can improve various adverse symptoms caused by ferroptosis by establishing a Drosophila ferroptosis model.

[0006] In order to solve the above technical problems and achieve corresponding technical effects, the present invention provides the following technical solutions:

[0007] The first object of the present invention is to provide a plant lactobacillus (Lactiplantibacillus plantarum) HUCF14, wherein the plant lactobacillus HUCF14 is deposited in Guangdong Microbiological Culture Collection Center, with a deposit number of GDMCC No: 64612, a deposit date of May 11, 2024, and a deposit address of Guangdong Institute of Microbiology, Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou.

[0008] The second object of the present invention is to provide the use of the above-mentioned Lactobacillus plantarum HUCF14 in the preparation of a medicine for alleviating ferroptosis.

[0009] In one embodiment of the present invention, the drug has at least one of the following effects:

[0010] (1) Improve the body's mobility degradation caused by ferroptosis;

[0011] (2) Improve the decrease in total sleep duration caused by ferroptosis and the anxiety caused by decreased sleep duration;

[0012] (3) Improve the body's decreased ability to scavenge DPPH free radicals caused by ferroptosis;

[0013] (4) Improve the body's decreased antioxidant capacity caused by ferroptosis;

[0014] (5) Improve the decrease in glutathione levels caused by ferroptosis;

[0015] (6) Improve the decreased expression level of intestinal ferroptosis-related gene gpx4 caused by ferroptosis;

[0016] (7) Improve the intestinal flora structure disorder caused by ferroptosis.

[0017] In one embodiment of the present invention, the content of Lactobacillus plantarum HUCF14 in the drug is 3.0×10 8 CFU / mL or 3.0×10 8 CFU / g.

[0018] It is further defined that the drug also includes pharmaceutically acceptable excipients.

[0019] It is further defined that the dosage form of the drug is tablet, capsule, granule, powder or liquid preparation.

[0020] The third object of the present invention is to provide a medicine for treating ferroptosis, which uses the above-mentioned Lactobacillus plantarum HUCF14 as an active ingredient.

[0021] In one embodiment of the present invention, the functions of the drug include at least one of (a1)-(a7):

[0022] (a1) Improve the body's mobility degradation caused by ferroptosis;

[0023] (a2) Improve the decrease in total sleep duration caused by ferroptosis and the restlessness caused by decreased sleep duration;

[0024] (a3) Improve the body's decreased ability to scavenge DPPH free radicals caused by ferroptosis;

[0025] (a4) Improve the body's decreased antioxidant capacity caused by ferroptosis;

[0026] (a5) Improve the decrease in glutathione levels caused by ferroptosis;

[0027] (a6) Improved the decreased expression level of intestinal ferroptosis-related gene gpx4 caused by ferroptosis;

[0028] (a7) Improve the intestinal flora structure disorder caused by ferroptosis.

[0029] In one embodiment of the present invention, the content of Lactobacillus plantarum HUCF14 in the drug is 3.0×10 8 CFU / mL or 3.0×10 8 CFU / g.

[0030] It is further defined that the dosage form of the drug is tablet, capsule, granule, powder or liquid preparation.

[0031] Beneficial effects of the present invention:

[0032] The present invention isolates a Gram-positive bacterium HUCF14, identifies the strain as Lactobacillus plantarum through morphological and molecular biological identification, and confirms that the strain HUCF14 has good tolerance to artificial gastrointestinal fluid and is non-toxic through simulated gastrointestinal fluid experiments and toxicity evaluation experiments; establishes a fruit fly ferroptosis model, confirms that the strain HUCF14 can improve multiple adverse symptoms caused by ferroptosis, including improving the degradation of the body's mobility caused by ferroptosis, improving the decrease in the body's total sleep time caused by ferroptosis and the restlessness caused by the decrease in sleep time, improving the body's DPPH free radical scavenging ability and antioxidant ability caused by ferroptosis, improving the decrease in the body's glutathione level caused by ferroptosis, improving the decrease in the expression level of the intestinal tissue ferroptosis-related gene gpx4 caused by ferroptosis, and improving the disorder of the intestinal flora structure caused by ferroptosis, and compared with the ferroptosis inhibitor Fer-1, the plant lactobacillus plantarum HUCF14 provided by the present invention shows a better effect of treating ferroptosis. Therefore, the present invention provides Lactobacillus plantarum HUCF14 which can be used to prepare medicines for alleviating ferroptosis, thus opening up a new approach for alleviating ferroptosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the colony morphology of Lactobacillus plantarum HUCF14;

[0034] Figure 2This is the statistical result of the time of fruit flies climbing tubes in each group in the tube climbing experiment; ****p<0.0001;

[0035] Figure 3 The statistical results of the total sleep time of each group of fruit flies are shown in the figure; *p<0.05, ****p<0.0001;

[0036] Figure 4 The statistical results of the total number of activities of each group of fruit flies during sleep; *p<0.05, **p<0.01, ***p<0.001;

[0037] Figure 5 The statistical results of DPPH free radical scavenging rate of each group of fruit flies are shown in the figure; **p<0.01, ***p<0.001;

[0038] Figure 6 The statistical results of the total antioxidant capacity of each group of fruit flies are shown in the figure; **p<0.01, ***p<0.001;

[0039] Figure 7 The results of the detection of glutathione levels in each group of fruit flies; *p<0.05;

[0040] Figure 8 The expression level of gpx4, a gene related to iron death in the intestine of Drosophila in each group, is detected in the figure; *p<0.05, ****p<0.0001;

[0041] Fig. 9 The following are the analysis results of the intestinal flora structure of each group of fruit flies. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific implementation methods and the accompanying drawings of the specification. It should be noted that the embodiments mentioned below are only applicable to explaining the present invention, but are not intended to limit the scope of the present invention. The embodiments mentioned below are only part of the embodiments of the present invention rather than all the embodiments. In this field, if other technicians do not make creative work, the embodiments they obtain are protected by the present invention.

[0043] The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials, reagents, culture media and instruments used are all conventional materials, reagents, culture media and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0044] Deposit of biological materials:

[0045] A strain of Lactobacillus plantarum HUCF14, taxonomically named Lactiplantibacillus plantarum, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 11, 2024, with the deposit number GDMCC No: 64612. The deposit unit address is Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0046] The culture medium used in the present invention is as follows:

[0047] LBS medium is composed of the following ingredients: 10 g / L tryptone, 17 g / L anhydrous sodium acetate, 5 g / L yeast extract, 0.575 g / L magnesium sulfate, 20 g / L glucose, 0.12 g / L manganese sulfate, 1 mL / L Tween 80, 0.034 g / L ferrous sulfate, 6 g / L potassium dihydrogen phosphate, 2 g / L ammonium citrate, and the balance is water, pH 5.4 ± 0.2. When preparing solid medium, add 15 g / L agar.

[0048] Example 1: Isolation and identification of Lactobacillus plantarum HUCF14

[0049] 1. Isolation of strain HUCF14

[0050] (1) Sample collection: Naturally fermented vegetable samples were collected in Zhaodong City, Heilongjiang Province on December 30, 2023. Fermented vegetables and juice were taken out and placed in 50 mL sterile sampling tubes using sterile tweezers and pipettes;

[0051] (2) Gradient dilution: Take 25 g of fermented vegetable sample and add it to 250 mL of sterile saline to obtain 10 -1 dilution, and then dilute to obtain 10 -3 , 10 -4 , 10 -5 diluent;

[0052] (3) Plate coating: Take 100 μL of different gradient dilutions and spread them on LBS plates, with 2 plates for each gradient;

[0053] (4) Culture: Place the plate in a conventional incubator and culture at 37°C for 48 h;

[0054] (5) Streaking: Take single colonies of different morphologies and perform streak once. After culturing at 37°C for 48 h, pick a single colony from the streak purification plate and continue streak purification for the second time.

[0055] (6) Activation: Pick a single colony from the last streaking purification plate and inoculate it into the corresponding 10 mL liquid culture medium and culture it for 24 h;

[0056] (7) Strain preservation: Take 1.5 mL of the activated bacterial solution and transfer it to a 2 mL strain preservation tube. Prepare five replicates. Centrifuge four of the replicates (6000 rpm for 3 min), remove the supernatant, add 1 mL of 40% sterile glycerol, mix thoroughly with a vortex oscillator, and store in a -80°C refrigerator.

[0057] 2. Identification of strain HUCF14

[0058] (1) Morphological identification of strain HUCF14

[0059] Colony characteristics: Strain HUCF14 forms obvious colonies on LBS solid medium after anaerobic culture for 48 hours. The colony diameter is between 0.5-2 mm. The front shape is round, the side shape is protruding, the edge is neat, milky white, opaque, the surface is moist and smooth, and no pigment is produced (see Figure 1 ).

[0060] Bacterial characteristics: Strain HUCF14 is Gram-positive, does not form spores, and is a non-motile bacterium.

[0061] Growth characteristics: strain HUCF14 reached the late logarithmic phase in LBS medium under constant temperature and anaerobic conditions at 37°C for about 24 hours.

[0062] (2) Molecular biological identification of strain HUCF14

[0063] Molecular biological identification of strain HUCF14: Using the genome of strain HUCF14 as a template, Lactobacillus GroEL primers Lac-GroEL-F (nucleotide sequence as shown in SEQ ID NO.2) and Lac-GroEL-R (nucleotide sequence as shown in SEQ ID NO.3) were used to obtain the GroELrRNA sequence of strain HUCF14 (as shown in SEQ ID NO.1) by PCR, and gene sequence comparison was performed through the EZ website (https: / / www.ezbiocloud.net / ).

[0064] The comparison results showed that the GroEL rRNA sequence of strain HUCF14 was closest to that of Lactiplantibacillus plantarum strain SK156, with a sequence similarity of 99.76%. Therefore, strain HUCF14 was determined to be a member of Lactobacillus plantarum.

[0065] The strain HUCF14 isolated in the present invention was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 11, 2024, with a deposit number of GDMCC No: 64612. The address of the depository unit is Guangdong Provincial Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0066] SEQ ID NO.1:

[0067] AGCAATGATCAACAATGGCTTGCCTTGTTCAACGATGGATTGTAATAGTGGTAAGATATCTTGAATGTTTGAAATCTTCTTATCAGTAATTAAGATATATGGATTGTCAAGATCCGCTTCCATCTTATCATTATCAGTAACCATGTATTGTGATAAGTAGCCGCGGTCGAATTGCATCCCTTCAACAACGTCTAAGCTAGTATCAACA CCACGTGATTCTTCAATCGTGATAACACCGTCATGACCAACTTTTTCCATGGCTTCGGCAATCAATTTACCAGTTTCTTCACTTGCTGAAGATACAGAAGCGATTTGCGCAATATCTTCTTGCGTCTTAACTTCGTGTGCCATAGCGTGTAATGAGTCAACCGCCGTCTTAGTAGCTTCTTCAATCCCACGACGAATGCCAACGGGG;

[0068] SEQ ID NO.2: GCYGGTGCWAACCCNGTTGG;

[0069] SEQ ID NO. 3: AANGTNCCVCGVATCTTGTT.

[0070] Example 2: Evaluation of the tolerance of Lactobacillus plantarum HUCF14 to simulated gastrointestinal fluid

[0071] The plant lactobacillus HUCF14 stored in cryopreservation was inoculated into LBS culture medium, cultured anaerobically at 37°C for 48h, and then subcultured with LBS culture medium for 2-3 times, 1mL of the culture medium of plant lactobacillus HUCF14 was taken, mixed with 9.0mL of artificial simulated gastric juice of pH 2.5 (LBS culture medium containing 1% pepsin and pH=2.5), and cultured anaerobically at 37°C, and samples were taken at 0h, 0.5h, 1h and 2h, and plate colony counts were performed by pouring culture with LBS agar culture medium, and the number of viable bacteria was determined and the survival rate was calculated. The survival rate is the ratio of the logarithm of the number of viable bacteria at the time of sampling to the logarithm of the number of viable bacteria at 0h, expressed as %.

[0072] The frozen Lactobacillus plantarum HUCF14 was inoculated into LBS culture medium, cultured anaerobically at 37°C for 48h, and then subcultured with LBS culture medium for 2-3 times, and then 1mL of the culture medium of Lactobacillus plantarum HUCF14 was added into 9mL of artificial simulated intestinal fluid (LBS culture medium containing 0.3% ox bile salt, 1% trypsin, pH=8.0), and cultured anaerobically at 37°C, and samples were taken at 0h, 0.5h, 1h, 2h, 3h and 4h, and plate colony counts were performed by pouring culture with LBS agar culture medium, and the number of viable bacteria was determined and the survival rate was calculated. The survival rate is the ratio of the logarithm of the number of viable bacteria at the time of sampling to the logarithm of the number of viable bacteria at 0h, expressed as %.

[0073] The experimental results are shown in Tables 1 and 2, which show that Lactobacillus plantarum HUCF14 has good tolerance to artificial gastrointestinal fluid.

[0074] Table 1 Evaluation results of tolerance of Lactobacillus plantarum HUCF14 to artificial simulated gastric fluid

[0075]

[0076] Table 2 Evaluation results of tolerance of Lactobacillus plantarum HUCF14 to artificial simulated intestinal fluid

[0077]

[0078] Example 3: Toxicity evaluation of Lactobacillus plantarum HUCF14

[0079] The Lactobacillus plantarum HUCF14 cells were resuspended in 10% skim milk to a concentration of 3.0 × 10 8 300 healthy male fruit flies were fed with the bacterial suspension of 500 μL of this concentration once a day after acclimating to the environment for one week. The mortality and body weight were recorded for one week (see Table 3).

[0080] As shown in Table 3, the feeding concentration is 3.0×10 8 CFU / mL of Lactobacillus plantarum HUCF14 had no obvious effect on fruit flies. There was no significant change in the weight of the fruit flies after feeding, no mortality occurred, and no pathological symptoms were found when the appearance of the fruit flies was observed under a microscope.

[0081] Table 3 Statistical results of fruit fly weight changes and mortality

[0082]

[0083] Note: -, no death of fruit flies

[0084] Example 4: Lactobacillus plantarum HUCF14 can significantly improve the tube-climbing ability of ferroptotic Drosophila

[0085] (1) Fruit fly breeding

[0086] Fruit flies were raised in an artificial climate incubator at 25°C, with relative humidity adjusted to 60%, a 12h / 12h light cycle, and the culture medium was changed every 3 days. The incubator was sprayed and wiped with 75% alcohol for disinfection. After 10 days of culture, fruit flies began to emerge, and 2-3 day old males were selected.

[0087] (2) Fruit fly grouping and treatment methods

[0088] The experiment was divided into blank control group, model group, HUCF14 intervention group and positive drug group. The treatment of each group was as follows:

[0089] Blank control group: fruit flies were not treated and ate normally;

[0090] Model group: Drosophila were placed in a fruit fly tube. Each time the model was established, 500 μL of 10 μmol / L Erastin was dripped onto the filter paper. The filter paper was then placed in the fruit fly tube for the fruit flies to eat. The model was established every 48 hours. Each time the filter paper was placed for 6 hours, and the treatment lasted for 15 days in total.

[0091] HUCF14 intervention group: Drosophila were placed in a fruit fly tube and modeled in the same way as the model group. 500 μL of 3.0×10 8 CFU / mL of Lactobacillus plantarum HUCF14 suspension was dripped onto the filter paper, and the filter paper was placed in the fruit fly tube for fruit flies to eat during the rest of the modeling period for intervention treatment, which lasted for 15 days in total.

[0092] Positive drug group: Drosophila were placed in a Drosophila tube and modeled in the same way as the model group. 500 μL of 10 μmol / L Fer-1 (Fer-1 is a ferroptosis inhibitor) was dripped onto the filter paper. During the rest of the modeling period, the filter paper was placed in the Drosophila tube for Drosophila to feed on, and the treatment lasted for 15 days.

[0093] (3) Drosophila tube climbing experiment

[0094] The tube climbing experiment is a behavioral experimental method to test the general motor ability of fruit flies. It is used to evaluate the motor function of fruit flies and study the factors that affect the behavior of fruit flies. In the tube climbing experiment, fruit flies are divided into groups of 30, each group contains 5 replicates. The experimental fruit flies are transferred to a clean glass tube (height: 20cm, inner diameter: 3.2cm). The tube is tapped to make all fruit flies fall to the bottom and allowed to crawl. The time it takes for all fruit flies to crawl over the 10cm line in the tube is counted, recorded and the relevant data is calculated.

[0095] The experimental results are as follows Figure 2As shown, compared with the fruit flies in the blank control group, the fruit flies in the model group spent significantly more time climbing the tubes in the climbing tube device, which can be considered as a decrease in motor ability from a behavioral perspective. The fruit flies in the intervention group that took Lactobacillus plantarum HUCF14 spent significantly less time climbing the tubes in the climbing tube device, which was close to the climbing time of the fruit flies in the positive drug group. It can be seen that Lactobacillus plantarum HUCF14 can significantly improve the decrease in motor ability caused by ferroptosis.

[0096] Example 5: Lactobacillus plantarum HUCF14 can improve the sleep and mental state of sleep-disordered fruit flies

[0097] The fruit fly breeding, grouping and treatment methods in this embodiment are the same as those in Example 4.

[0098] The fruit fly sleep monitoring system independently developed by KIM Laboratory, School of Life Engineering, Harbin Institute of Technology was used to monitor the sleep activity of fruit flies in the blank control group, model group, HUCF14 intervention group and positive drug group for 24 hours.

[0099] The experimental results of total sleep duration are as follows Figure 3 As shown in the figure, the total sleep time of the model group was significantly lower than that of the control group. The intervention group taking Lactobacillus plantarum HUCF14 and the positive drug group taking Fer-1 could significantly increase the total sleep time of the fruit flies compared with the model group, and the effect of the HUCF14 intervention group was equivalent to that of the positive drug group. Figure 4 As shown, the total number of activities in the model group was significantly higher than that in the control group, indicating that the significant reduction in total sleep duration caused the model group fruit flies to have restlessness; and the intervention group taking Lactobacillus plantarum HUCF14 and the positive drug group taking Fer-1 could significantly reduce the total number of activities during sleep of fruit flies and reduce restlessness compared with the model group. This shows that the dietary intervention of Lactobacillus plantarum HUCF14 provided by the present invention can significantly improve the decrease in total sleep duration of fruit flies caused by ferroptosis and the restlessness caused by reduced sleep duration.

[0100] Example 6: Lactobacillus plantarum HUCF14 can enhance the DPPH free radical scavenging ability of ferroptotic Drosophila. The breeding, grouping and treatment methods of Drosophila in this example are the same as those in Example 4.

[0101] DPPH free radical scavenging rate can be used to evaluate the body's ability to scavenge DPPH free radicals. The higher the scavenging rate, the stronger the antioxidant capacity. The DPPH free radical scavenging ability detection kit was used to detect the DPPH free radical scavenging ability of Drosophila in the blank control group, model group, HUCF14 intervention group and positive drug group.

[0102] The experimental results are as follows Figure 5As shown, the DPPH free radical scavenging rate of the model group fruit flies was significantly lower than that of the control group fruit flies, and the intervention group taking Lactobacillus plantarum HUCF14 and the positive drug group taking Fer-1 could significantly improve the DPPH free radical scavenging ability of fruit flies compared with the model group, and the fruit flies in the HUCF14 intervention group had better DPPH free radical scavenging ability than the fruit flies in the positive drug group. It shows that the dietary intervention of Lactobacillus plantarum HUCF14 provided by the present invention can significantly improve the DPPH free radical scavenging ability of the body of ferroptotic fruit flies.

[0103] Example 7: Lactobacillus plantarum HUCF14 can improve the antioxidant status of ferroptotic Drosophila

[0104] The fruit fly breeding, grouping and treatment methods in this embodiment are the same as those in Example 4.

[0105] Total antioxidant capacity is an indicator that measures the number and activity of antioxidants in the body, reflecting the body's antioxidant status. The total antioxidant capacity (T-AOC) detection kit was used to detect the total antioxidant capacity of Drosophila in the blank control group, model group, HUCF14 intervention group and positive drug group. The experimental results are as follows Figure 6 As shown, the total antioxidant capacity of the fruit flies in the model group was significantly lower than that in the blank control group. The intervention group taking Lactobacillus plantarum HUCF14 and the positive drug group taking Fer-1 were able to significantly improve the total antioxidant capacity of the fruit flies compared with the model group, and the fruit flies in the HUCF14 intervention group had better total antioxidant capacity than the fruit flies in the positive drug group. This shows that the dietary intervention of Lactobacillus plantarum HUCF14 screened by the present invention can improve the antioxidant status of the body of ferroptotic fruit flies.

[0106] Example 8: Lactobacillus plantarum HUCF14 can increase glutathione levels in ferroptotic Drosophila

[0107] The fruit fly breeding, grouping and treatment methods in this embodiment are the same as those in Example 4.

[0108] Glutathione plays an important role in the biochemical defense system of the human body and has many physiological functions. Its main physiological function is to remove free radicals in the human body. As an important antioxidant in the body, it protects the sulfhydryl groups in many proteins and enzymes. The alloxan method was used to detect the glutathione level in Drosophila. The experimental results are as follows Figure 7As shown, compared with the blank control group fruit flies, the glutathione level in the ferroptosis fruit flies was significantly reduced, and the intervention group taking Lactobacillus plantarum HUCF14 and the positive drug group taking Fer-1 could significantly reverse the decrease in glutathione level caused by ferroptosis compared with the model group, and the effect of the HUCF14 intervention group was equivalent to that of the positive drug group. This shows that the dietary intervention of Lactobacillus plantarum HUCF14 provided by the present invention can increase the glutathione level in the body of ferroptosis fruit flies.

[0109] Example 9: Lactobacillus plantarum HUCF14 can increase the expression level of gpx4, a gene related to ferroptosis in the intestine of Drosophila melanogaster

[0110] The fruit fly breeding, grouping and treatment methods in this embodiment are the same as those in Example 4.

[0111] The intestinal tissue of Drosophila was lysed with Trizol, and chloroform was added to extract RNA. Then, RNA was precipitated with isopropanol, eluted with 75% ethanol, and finally re-dissolved with DEPC water. Template DNA was obtained by reverse transcription kit. The template DNA was amplified by fluorescent quantitative PCR to quantify gpx4. Gapdh was used as the internal reference gene, and the sample was repeated 3 times. The expression level of gpx4 gene was calculated by 2-△Cq. The experimental results are shown in Figure 8 As shown, the gene expression level of gpx4, a gene related to ferroptosis in the intestine of fruit flies in the model group, was significantly lower than that in the blank group, while taking Lactobacillus plantarum HUCF14 could significantly reverse the decrease in the expression level of gpx4 gene in the intestine of fruit flies with ferroptosis, indicating that the dietary intervention of Lactobacillus plantarum HUCF14 of the present invention can significantly increase the expression of gpx4, a gene related to ferroptosis in intestinal tissue.

[0112] Example 10: Lactobacillus plantarum HUCF14 can improve the intestinal flora structure of ferroptotic Drosophila

[0113] The fruit fly breeding, grouping and treatment methods in this embodiment are the same as those in Example 4.

[0114] FastDNAspin kit for feces was used to extract DNA from fruit fly feces samples, and 341F / 806R primers (upstream primer 341F (SEQ ID NO.2): 5'-CCTAYGGGRBGCASCAG-3' and downstream primer 806R (SEQ ID NO.3): 5'-GGACTACNNGGGTATCTAAT-3') were used to amplify the V3-V4 region of the extracted DNA, and the amplified fragment was about 465bp. The PCR amplification product was purified by QIAquick Gel Extraction Kit gel recovery kit. According to the concentration of the PCR purified product, samples of different volumes were mixed into a mixed system of equal mass concentration, and double-end sequencing was performed on the MiSeq high-throughput sequencing platform. The obtained data were compared and annotated with the Silva reference database. Based on the genus-level data of the fruit fly intestinal flora, PCoA analysis based on Bray-Curtis distance was performed, and the experimental results are shown in the figure. Fig. 9 As shown, there are differences in the intestinal flora structure of fruit flies between the model group and the blank group. The model group, the blank group and the Lactobacillus plantarum HUCF14 dietary intervention group show different clustering. Taking Lactobacillus plantarum HUCF14 can improve the clustering of the intestinal flora of ferroptosis fruit flies, so that it is neither biased towards the blank group nor the model group, suggesting that Lactobacillus plantarum HUCF14 is more inclined to assist in establishing a new intestinal homeostasis in terms of intestinal flora regulation, indicating that the dietary intervention of Lactobacillus plantarum HUCF14 of the present invention can improve the intestinal flora structure of ferroptosis fruit flies.

[0115] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Lactobacillus plantarum HUCF14, characterized in that: The deposit number of the Lactobacillus plantarum HUCF14 is GDMCC No:64612.

2. Use of the Lactobacillus plantarum HUCF14 according to claim 1 in the preparation of a medicine for alleviating ferroptosis.

3. The use according to claim 2, characterized in that: The drug has at least one of the following effects: (1) Improve the body's mobility degradation caused by ferroptosis; (2) Improve the decrease in total sleep duration caused by ferroptosis and the anxiety caused by decreased sleep duration; (3) Improve the body's decreased ability to scavenge DPPH free radicals caused by ferroptosis; (4) Improve the body's decreased antioxidant capacity caused by ferroptosis; (5) Improve the decrease in glutathione levels caused by ferroptosis; (6) Improve the decreased expression level of intestinal ferroptosis-related gene gpx4 caused by ferroptosis; (7) Improve the intestinal flora structure disorder caused by ferroptosis.

4. The use according to claim 2, characterized in that: The content of Lactobacillus plantarum HUCF14 in the medicine is 3.0×10 8 CFU / mL or 3.0×10 8 CFU / g.

5. The use according to claim 2, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

6. The use according to claim 2, characterized in that: The dosage form of the medicine is tablet, capsule, granule, powder or liquid preparation.

7. A medicine for treating ferroptosis, comprising the Lactobacillus plantarum HUCF14 of claim 1 as an active ingredient.

8. The medicine according to claim 7, characterized in that The functions of the drug include at least one of (a1)-(a7): (a1) Improve the body's mobility degradation caused by ferroptosis; (a2) Improve the decrease in total sleep duration caused by ferroptosis and the restlessness caused by decreased sleep duration; (a3) Improve the body's decreased ability to scavenge DPPH free radicals caused by ferroptosis; (a4) Improve the body's decreased antioxidant capacity caused by ferroptosis; (a5) Improve the decrease in glutathione levels caused by ferroptosis; (a6) Improved the decreased expression level of intestinal ferroptosis-related gene gpx4 caused by ferroptosis; (a7) Improve the intestinal flora structure disorder caused by ferroptosis.

9. The use according to claim 7, characterized in that: The content of Lactobacillus plantarum HUCF14 in the medicine is 3.0×10 8 CFU / mL or 3.0×10 8 CFU / g.

10. The use according to claim 7, characterized in that: The dosage form of the medicine is tablet, capsule, granule, powder or liquid preparation.

Images