A disease-resistant and growth-promoting Pseudomonas asiatica LC40 and its application

Abstract

The present application discloses a disease-resistant and growth-promoting Pseudomonas asiatica LC40 and its application, which relates to the field of microbial technology. The specific Pseudomonas is Pseudomonas asiatica ( Pseudomonas asiatica ) LC40, which was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on December 2, 2024, with the deposit number CGMCC No. 32869. This strain can be applied to inhibit tobacco mosaic virus (TMV), tomato brown rugose fruit virus (ToBRFV), Magnaporthe oryzae of rice ( Magnaporthe oryzae ) and Alternaria tenuissima of scallion leaf spot pathogen ( Alternaria tenuissima ). The Pseudomonas asiatica LC40 involved in the present application has the ability to dissolve phosphorus and can secrete the auxin-like compound IAA. The field test results show that the LC40 strain has the effects of promoting the growth and increasing the yield of tomatoes. The Pseudomonas asiatica LC40 strain can effectively prevent and control plant diseases, promote crop growth, and thus improve the yield and quality of crops, showing a good application prospect for disease prevention and growth promotion.

Description

Technical Field

[0001] This application belongs to the technical field of biological control of plant diseases, and specifically relates to a strain of Pseudomonas asiatica LC40, as well as its application in biological control of plant diseases and promotion of crop growth. Background Art

[0002] Plant viral diseases are known as "plant cancers" and are one of the main threats to the healthy growth of many crops, fruits, vegetables, and ornamental plants. Among them, tobacco mosaic virus (TMV) is one of the most destructive plant viruses. After infecting crops, it will seriously affect the yield and quality of crops, posing a huge threat to agricultural production. Tomato brown rugose fruit virus (ToBRFV) is a new species of the genus Tobacco mosaic virus ( Tobamovirus ), and its spread is extremely fast. It can survive in host plants and seeds for a long time and achieve long-distance transmission through cross-regional transportation, causing serious harm to major tomato production areas. Studies have found that the virus infection rate of tomato seeds collected from ToBRFV-infected tomatoes can reach 100%, and this virus has broken through the resistance genes of tomato varieties Tm - 2 2 ， Currently, there have been no research reports on germplasm materials resistant to ToBRFV.

[0003] Fungal diseases are the number one disease in agricultural production. Once they occur, they will seriously threaten the yield and quality of crops. Among them, Magnaporthe oryzae ( Magnaporthe oryzae ), as one of the most serious diseases in rice production, can cause a 10% - 35% reduction in the world's rice production every year, posing a huge threat to food security. Scallions are one of the most widely planted vegetables and seasonings in China. In the case of continuous cropping and a relatively high multiple cropping index, the leaf spot disease of scallions caused by Alternaria tenuissima ( Alternaria tenuissima ), has become the main problem affecting scallion production.

[0004] The main control methods for common plant diseases include breeding disease-resistant varieties, agricultural control, biological control, physical control, and chemical control, etc. Cultivating disease-resistant plant varieties by introducing disease-resistant genes is considered to be a relatively effective measure for controlling plant diseases. However, the cycle for screening and cultivating excellent disease-resistant varieties is long and the cost is high. Although chemical control methods are efficient and convenient, the extensive use of chemical pesticides has made problems such as excessive agricultural residues and environmental pollution increasingly prominent. Finding safer and more effective control methods has become a current research hotspot.

[0005] Biological control is an environmentally friendly control method that mainly uses microorganisms and their metabolites in the natural environment to control diseases. At present, about 1,000 species of biological control microorganisms have been discovered, mainly including fungi, bacteria and actinomycetes. Among them, Pseudomonas spp. ( Pseudomonas sp.), Bacillus ( Bacillus sp.), Streptomyces ( Streptomyces sp.), Penicillium ( Penicillium sp.) and Trichoderma ( Trichoderma sp.) etc. Pseudomonas bacteria ( Pseudomonas sp.) is widely used because of its strong ecological adaptability and rhizosphere colonization ability, as well as its ability to directly promote plant growth and inhibit plant pathogens. At present, studies have reported the control of plant viral diseases and fungal diseases by biocontrol bacteria. However, most of these studies on the use of biocontrol bacteria to control plant viral diseases focus on TMV, and there are no reports on the use of biocontrol bacteria for the control of ToBRFV. Therefore, it is particularly important to screen biocontrol bacteria that have both broad-spectrum disease resistance and the ability to promote crop growth, especially when facing a virus such as ToBRFV that is highly invasive, spreads quickly, and is difficult to control. This need is even more urgent. Summary of the invention

[0006] To solve the above problems, the present application provides a disease-resistant, growth-promoting and yield-increasing Pseudomonas asiaticus ( Pseudomonas asiatica ) LC40, not only has obvious inhibitory and passivation effects on tobacco mosaic virus (TMV) and tomato brown rugose fruit virus (ToBRFV), but also has a significant inhibitory and passivation effect on rice blast fungus ( Magnaporthe oryzae )、Alternaria tenuifolia( Alternaria tenuissima ) has a significant inhibitory effect and can significantly promote the growth and yield of tomato plants. The strain and its application are achieved through the following technical solutions:

[0007] On the one hand, the present application provides a strain of Pseudomonas asiatica ( Pseudomonas asiatica ) LC40, Pseudomonas asiaticus LC40 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32869, and was classified as Pseudomonas asiaticus Pseudomonas asiatica The storage address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0008] On the other hand, the present application also provides a Pseudomonas asiaticus fermentation broth, which contains the above-mentioned Pseudomonas asiaticus LC40.

[0009] On the other hand, the present application also provides an application of a Pseudomonas asiatica fermentation broth in inhibiting tobacco mosaic virus, and the Pseudomonas asiatica fermentation broth is the above-mentioned Pseudomonas asiatica fermentation broth.

[0010] On the other hand, the present application also provides an application of a Pseudomonas asiatica fermentation broth in inhibiting Magnaporthe oryzae ( Magnaporthe oryzae ), as well as Alternaria tenuissima ( Alternaria tenuissima ), and the Pseudomonas asiatica fermentation broth is the above-mentioned Pseudomonas asiatica fermentation broth.

[0011] On the other hand, the present application also provides a crude extract protein of Pseudomonas asiatica, and the crude extract protein of Pseudomonas asiatica contains the above-mentioned Pseudomonas asiatica LC40.

[0012] On the other hand, the present application also provides an application of a crude extract protein of Pseudomonas asiatica in inhibiting tobacco mosaic virus and tomato brown rugose fruit virus, and the crude extract protein of Pseudomonas asiatica is the above-mentioned crude extract protein of Pseudomonas asiatica.

[0013] On the other hand, the present application also provides an application of Pseudomonas asiatica in promoting tomato growth and increasing yield, and the Pseudomonas asiatica is the above-mentioned Pseudomonas asiatica LC40.

[0014] Beneficial effects

[0015] The Pseudomonas asiatica LC40 strain of the present application was identified as Pseudomonas asiatica ( Pseudomonas asiatica ), through techniques and methods such as morphology, physiological and biochemical characteristics, and 16S rRNA sequencing, and it is a biocontrol bacterium with high efficiency in disease resistance and growth promotion. This strain has a significant passivation effect on TMV and ToBRFV, and has a high-efficiency prevention effect on TMV; it has a significant inhibitory effect on the mycelial growth of Magnaporthe oryzae and Alternaria tenuissima. The Pseudomonas asiatica LC40 strain has the ability to dissolve phosphorus and secrete IAA. The results of field experiments show that the strain LC40 also has a significant effect on promoting tomato growth and increasing yield. The Pseudomonas asiatica LC40 is easy to culture, easy to preserve, environmentally friendly, safe for humans and animals, has both growth promotion and disease prevention effects, and has the potential to be developed into a biological bacterial fertilizer and a biological pesticide.

[0016] The present application provides an application of a disease-preventing and growth-promoting Pseudomonas asiatica LC40 strain. The LC40 fermentation broth and crude extract protein have a good passivation effect on TMV and ToBRFV. Among them, the inhibition rate of the fermentation broth on TMV is 68.40%, and the inhibition rates of the crude extract protein on TMV and ToBRFV are 76.68% and 70.11% respectively.

[0017] The Pseudomonas asiatica LC40 strain of the present application on Magnaporthe oryzae ( Magnaporthe oryzae ), and Alternaria tenuissima ( Alternaria tenuissimaThe mycelial growth of ( ) has a significant inhibitory effect, and the inhibition rates on the mycelial growth of Magnaporthe oryzae and Alternaria tenuissima are 76.07% and 50.98% respectively.

[0018] The present application also provides the application of the disease-preventing and growth-promoting Pseudomonas asiatica LC40 strain. The results of field trials show that spraying the fermentation broth of the Pseudomonas asiatica LC40 strain at 150-fold dilution can effectively promote the growth of tomato plants and increase the yield. The plant height of tomatoes in the field test area of the Pseudomonas asiatica LC40 strain is 14.7 cm higher than that in the farmer's self-prevention control area, with an average yield increase of 8.79%. Moreover, there are more large fruits in the LC40 test area, and the heaviest single fruit reaches 530 g.

[0019] It should be understood that the above general description and the following detailed description are only exemplary and explanatory, and cannot limit the present application. Brief Description of the Drawings

[0020] By describing the exemplary embodiments of the present application in more detail in conjunction with the drawings, the above and other objects, features, and advantages of the present application will become more obvious. Among them, in the exemplary embodiments of the present application, the same reference numerals generally represent the same components.

[0021] Figure 1 This is the colony morphology of the Pseudomonas asiatica LC40 strain on LB medium in the present application.

[0022] Figure 2 This is the cell morphology of the Pseudomonas asiatica LC40 strain under the electron microscope in the present application.

[0023] Figure 3 This is the phosphorus-solubilizing result of the Pseudomonas asiatica LC40 strain in the present application.

[0024] Figure 4 This is the determination result of the IAA secretion ability of the Pseudomonas asiatica LC40 strain in the present application;

[0025] A: The fermentation broth of the LC40 strain without adding Salkowski colorimetric solution;

[0026] B: The fermentation broth of the LC40 strain with added Salkowski colorimetric solution.

[0027] Figure 5 This is the 16S rRNA phylogenetic tree of the Pseudomonas asiatica LC40 strain in the present application.

[0028] Figure 6 This is the inactivation effect of the fermentation broth of the Pseudomonas asiatica LC40 strain on TMV in the present application.

[0029] Figure 7This is the effect diagram of the crude protein of Pseudomonas asiatica LC40 in this application on inactivating TMV.

[0030] Figure 8 This is the preventive effect of the fermentation broth of Pseudomonas asiatica LC40 strain in this application on TMV;

[0031] A: Comparison diagram of spraying 1000-fold solution of 30% dufulin wettable powder with the control

[0032] B: Comparison diagram of the treatment group sprayed with the fermentation broth of Pseudomonas asiatica LC40 strain and the control group;

[0033] C: Top-down view of the treatment and the control;

[0034] D: Enlarged view of the LB control;

[0035] E: Enlarged view of the treatment group of LC40 strain.

[0036] Figure 9 This is the inactivating effect of the crude protein of Pseudomonas asiatica LC40 strain in this application on ToBRFV.

[0037] Figure 10 This is the inhibitory result of Pseudomonas asiatica LC40 strain on the mycelial growth of pathogenic fungi;

[0038] Figure 11 This is the statistical result of the tomato plant height at different treatments and different investigation times in the field experiment of Pseudomonas asiatica LC40 strain in this application.

[0039] Figure 12 This is the statistical result of the number of tomato flower buds at different treatments and different investigation times in the field experiment of Pseudomonas asiatica LC40 strain in this application.

[0040] Biological deposit description

[0041] Pseudomonas asiatica ([[]] Pseudomonas asiatica ) LC40 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 2, 2024, with the deposit number CGMCC No. 32869, and the taxonomic name is Pseudomonas asiatica Pseudomonas asiatica . The deposit address is located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the status is viable. Detailed implementation manners

[0042] The embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described below. On the contrary, the embodiments provided in the text are intended to make the present application more thorough and complete, and to convey the scope of the present application fully to those skilled in the art.

[0043] Previous studies have found that Pseudomonas asiatica Pseudomonas asiatica has the nitrification ability to efficiently remove ammonia nitrogen and can be used for the treatment of water environment, but there are few studies on promoting plant growth and controlling plant virus diseases. In this application, a strain of Pseudomonas asiatica Pseudomonas asiatica LC40 was screened from crop rhizosphere microorganisms. It has the functions of disease resistance and growth promotion, which can provide resources for the development and utilization of microbial agents and provide a new option for the green prevention and control of crop diseases.

[0044] This application provides a strain of Pseudomonas asiatica Pseudomonas asiatica LC40 with the functions of disease resistance, growth promotion and yield increase. This strain has an obvious inactivation effect on tobacco mosaic virus and tomato brown rugose fruit virus, has a good inhibitory effect on Magnaporthe oryzae and Alternaria tenuissima, and can promote the growth of tomato plants and increase the yield, thereby reducing the application of chemical pesticides and fertilizers and realizing the sustainable development of agriculture. It has a good application prospect in agricultural production.

[0045] The preparation methods of the media used in the examples are as follows:

[0046] LB medium (1 L): Weigh 10 g of tryptone, 5 g of yeast extract powder, and 10 g of NaCl. Add 1 L of ddH2O (add 10 g of agar powder for solid medium and do not add for liquid medium), then autoclave at 121 °C for 20 min. After cooling to about 56 °C, pour the solid medium into plates for standby.

[0047] VL55 medium (1 L): VL55 medium is mainly used for the isolation of soil microorganisms. The (1×) formula is as follows: Weigh 1.95 g of 2-(N-morpholino)ethanesulfonic acid, 0.024 g of MgSO4, 0.033294 g of CaCl2, 0.026421 g of [(NH4)2HPO4], 1 mL of selenite / tungstate solution, and 1 mL of trace solution SL10 in advance, then dissolve them in 800 mL of ddH2O. Adjust the pH to 7.2 with a mixed solution of 0.2 moL / L NaOH and 0.1 moL / L KOH (this is consistent with the pH of the soil), add 15 g of agar and make up the volume to 1 L. Autoclave at 121 °C for 20 min. After cooling to about 56 °C, add 10 mL of 5% (w / v) xylan solution, 2 mL of vitamin solution 1, and 6 mL of vitamin solution 2, mix well and pour into plates for standby.

[0048] PDA medium (1 L): Weigh 200 g of potatoes and cook until pasty. After filtering through gauze, add 20 g of glucose and 15 g of agar. Add ddH2O to make up to 1 L, sterilize at 121 °C under high pressure for 20 min, and pour into plates for standby after cooling to about 56 °C.

[0049] NBPIP medium (1 L): Weigh 10.0 g of glucose, 2.5 g of Ca3(PO4), 5.0 g of MgCl2, 0.25 g of MgSO4·7H2O, 0.2 g of KCl, 0.1 g of [(NH4)2SO4], and 15.0 g of agar. Add ddH2O to make up to 1 L, sterilize at 121 °C under high pressure for 20 min, and pour into plates for standby after cooling to about 56 °C.

[0050] Glucose peptone water medium (1 L): 7 g of peptone, 5 g of glucose, 5 g of KH2PO4. Add ddH2O to make up to 1 L, sterilize at 121 °C under high pressure for 20 min.

[0051] Nitrate reduction reaction medium (1 L): 3 g of beef extract, 5 g of peptone, 1 g of KNO3. Add ddH2O to make up to 1 L, sterilize at 121 °C under high pressure for 20 min.

[0052] Tryptic soy broth (TSB) (1 L): Weigh 30 g of TSB powder, add ddH2O to make up to 1 L, stir and boil until completely dissolved, and sterilize at 121 °C for 20 min.

[0053] Unless otherwise specified, the samples or materials used in the following examples are all purchased from the market.

[0054] Example 1 Isolation of Pseudomonas asiatica strain LC40

[0055] Source of soil sample: The soil was taken from the cigar tobacco planting base in Mengding Town, Gengma Dai and Va Autonomous County, Lincang City, Yunnan Province. The rhizosphere soil of diseased plants and healthy plants around them was selected. The roots of the plants were pulled out, and after removing the large soil blocks, they were put into a sterile sampling bag and taken back to the laboratory for storage in a 4 °C refrigerator for standby.

[0056] Put 1 g of rhizosphere soil and some fibrous root samples into 10 mL of sterile distilled water, shake and culture at 220 rpm for 30 min, and let stand at room temperature for 5 min to obtain the original solution. Pipette 100 μL of the original solution into 900 μL of sterile water and mix well to obtain a 10 -1 dilution. Perform gradient dilution using the same dilution method to obtain 10 -3 、10 -4 、10 -5 concentration dilution solutions. Pipette 100 μL of 10 -3, 10 -4 and 10 -5 The diluent was evenly spread on VL55 medium, and 3 plates were spread for each gradient. After being placed in an inverted position in an incubator at 28 °C for 7 - 8 days, single colonies with different morphologies were picked and cultured on a new VL55 medium for 5 - 7 days. After repeating the purification 2 - 3 times, single colonies were picked for fermentation culture. The screening method of antagonistic strains is as follows:

[0057] (1) Screening of antagonistic bacteria: Using Bacillus cereus ( Bacillus cereus ) as the indicator bacterium to screen for antagonistic bacteria with antibacterial effects. According to a volume ratio of 1:100, the fermentation broth of Bacillus cereus with OD 600 = 0.33 (1×10 8 cfu / mL) and sterilized LB medium were mixed evenly and poured into plates. 8 spaces were marked on the plate in proportion, and one Oxford cup was placed in each space. 100 μL of the above-mentioned fermentation broth of the strain to be tested was added to the Oxford cup. After sealing with a sealing film, it was placed in an incubator at 28 °C for 1 - 2 days, and antagonistic bacteria were screened according to the formation of antibacterial zones on the plate.

[0058] (2) Purification of antagonistic bacteria: According to the size of the antibacterial zone, the target bacteria with antibacterial effects were selected and purified by "Z" - shaped streaking on LB solid medium.

[0059] Result: 95 strains of bacteria were isolated from 25 cigar rhizosphere soil samples. After screening with Bacillus cereus as the indicator bacterium, the strain with the largest antibacterial zone diameter (1.3 cm) was obtained and named LC40.

[0060] Strain preservation: After the LC40 strain was inoculated in LB liquid medium and fermented for 12 - 24 h, it was mixed with 50% glycerol at a volume ratio of 1:1 and stored in a - 80 °C ultra - low temperature refrigerator for standby.

[0061] Example 2 Identification of LC40 strain

[0062] Identification method: The strain was identified by morphological characteristics, physiological and biochemical characteristics, and molecular biology.

[0063] (I) Morphological identification of LC40 strain

[0064] The LC40 strain was streaked on an LB plate and cultured at 28 °C for 24 h, then the morphology of single colonies was observed. The morphological characteristics of the strain were observed under a transmission electron microscope, and the staining results of the bacterial cells were observed under an optical microscope after Gram staining.

[0065] Morphological characteristics of LC40: The colonies on LB solid medium were yellowish - white, round, with a smooth surface, neat edges, moist and shiny, with a special pungent smell, and did not produce pigments (see Figure 1). The cells are rod-shaped, with extremely abundant flagella, 1-3 in number ( Figure 2 ). Gram-negative.

[0066] (II) Physiological and biochemical identification of LC strain

[0067] Referring to the relevant content of the determination of physiological and biochemical characteristics in "Bergey's Manual of Determinative Bacteriology" (9th Edition), the physical and chemical properties of LC40 strain were determined.

[0068] Determination of the ability of LC40 strain to produce IAA: After inoculating the activated LC40 fermentation broth into R2A liquid medium containing 200 mg / L L-tryptophan and culturing overnight, 5 mL of the bacterial liquid was taken and 0.5 mL of Salkowski colorimetric solution (150 mL of H2SO4 was slowly poured into 250 mL of distilled water, stirred and cooled, and then 7.5 mL of 0.5 mol / L FeCl3·6H2O was added and mixed evenly) was added, and cultured with shaking for 30 min. If the color of the bacterial liquid turns red or pink, it has the ability to secrete IAA (positive), and no color change is negative.

[0069] Test for the phosphate-solubilizing ability of LC40 strain: 50 μL of the LC40 strain fermentation broth was inoculated in the center of NBPIP solid medium, cultured in an incubator at 28 °C for 6 days, stained with 5% bromophenol blue for 3 min, then the staining solution was poured out, rinsed with clean water, and the phosphate-solubilizing ability of the strain was judged by observing whether a degradation zone was formed around the colony.

[0070] Gelatin liquefaction test: 10 μL of the LC40 strain fermentation broth cultured overnight was pipetted into a gelatin medium test tube, cultured statically at 27 °C for 5 days, then placed at 4 °C for 30 min. If the gel is in a liquefied state when taken out, it is positive, and if the gel re-solidifies or does not liquefy, it is negative.

[0071] Methyl red test: The LC40 strain was inoculated into 5 mL of glucose peptone water medium and cultured overnight, then 2-3 drops of methyl red were added along the wall of the test tube. If the color of the bacterial liquid turns red, it is positive, and no color change is negative.

[0072] Nitrate reduction reaction: The LC40 strain was inoculated into the nitrate reduction reaction medium, cultured at 37 °C and 200 rpm for 3 days, 2-3 drops of reagent A (8.0 g of sulfanilic acid dissolved in 1000 mL of 5 mol / L acetic acid) and reagent B (2.5 g of α-naphthol dissolved in 1000 mL of 5 mol / L acetic acid) were added and mixed evenly. If it turns red, it is positive, and no color change is negative.

[0073] V-P test: Take 2 mL of the fermentation broth of LC40 strain cultured overnight, 1 mL of 6% α-naphthol and 0.4 mL of 40% KOH, mix well and shake for 5 min. If it immediately turns red or turns red within 2 h at room temperature, it is positive; if no red color appears, it is negative.

[0074] Determination of NaCl tolerance: In LB liquid media with NaCl concentrations of 2%, 4%, and 8% respectively, add 100 μL of the fermentation broth of strain LC40 in equal amounts and in the same logarithmic growth phase. After culturing at 28 °C and 220 rpm for 24 h, measure the OD 600 value to compare and analyze the status of the strain.

[0075] Determination of acid tolerance: In LB liquid media with pH = 4, pH = 6, and pH = 7 respectively, add 100 μL of the fermentation broth of strain LC40 in equal amounts and in the same logarithmic growth phase. After culturing at 28 °C and 220 rpm for 24 h, measure the OD 600 value to compare and analyze the status of the strain.

[0076] As can be seen from Table 1, strain LC40 can dissolve phosphorus ( Figure 3 ), and has the ability to secrete IAA ( Figure 4 ). In addition, gelatin liquefaction, methyl red reaction, nitrate reduction reaction and V-P test are negative, the salt tolerance concentration is 1% - 4% (NaCl), and it can ferment in an acidic environment with pH 5 - 7.

[0077] Table 1 Morphological characteristics and physiological and biochemical properties of strain LC40

[0078]

[0079] Note: +: Positive; -: Negative

[0080] (III) Molecular biological identification of strain LC40

[0081] The screened LC40 strain was reactivated on LB solid medium. The genomic DNA of the bacteria was extracted using a column-type bacterial genomic DNA extraction kit. Using the genomic DNA of the strain as a template, the 16S rRNA gene of the bacteria was amplified with the universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT). After the obtained PCR product was detected by 1% agarose gel electrophoresis, the positive PCR product was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequenced 16S rRNA was aligned with the 16S rRNA gene sequences of other strains in the NCBI database, and the corresponding strain sequences were downloaded from the NCBI database. A phylogenetic tree was constructed using the FastTree / iqtree / raxml software.

[0082] The 16S rRNA gene sequence of the LC40 strain obtained by sequencing was 1501 bp, and the sequence was as shown in SEQ ID NO. 1:

[0083]

[0084] The Blast alignment results of the 16S rRNA gene sequence of strain LC40 with those in the NCBI database showed that strain LC40 had the highest sequence identity with P. asiatica strain RYYT (CP127872.1) and P. asiatica strain RA-6B (CP128558.1) in terms of the 16S rRNA gene sequence, both reaching 99.80%. Meanwhile, the phylogenetic tree constructed based on the 16S rRNA gene sequences of different Pseudomonas species showed that strain LC40 clustered with P. asiatica JP233 (025853855.1), P. asiatica NMI3658 (021283465.2), P. asiatica PIGCA (028752155.1), etc. on the same branch ( Figure 5 ).

[0085] In summary, through the morphological characteristics, physiological and biochemical properties, and molecular biological identification of strain LC40, it was determined that strain LC40 was Pseudomonas asiatica ( Pseudomonas ). Pseudomonas asiatica It was deposited in the China General Microbiological Culture Collection Center on December 2, 2024. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 32869.

[0086] Example 3 Inhibitory effects of strain LC40 on TMV and ToBRFV

[0087] (I) Passivation effect of the fermentation broth of strain LC40 on TMV

[0088] Preparation of TMV virus source: Weigh 0.5 g of Nicotiana benthamiana diseased leaves infected with TMV, add 10 mL of sterilized phosphate buffer (0.01 mol / L PBS), grind into a homogenate, and centrifuge at 4 °C and 6000 rpm for 5 min. Then, aspirate the supernatant as the inoculum.

[0089] Extraction of crude protein by ammonium sulfate precipitation: Inoculate strain LC40 into 3 mL of LB liquid medium, and incubate at 28 °C and 220 rpm for 24 h to prepare a seed solution. Inoculate the seed solution into a triangular flask containing 300 mL of LB liquid medium at an inoculation ratio of 1:100, and incubate at 28 °C and 220 rpm for 48 h; centrifuge at 4 °C and 10000 rpm for 15 min. The supernatant is filtered through a bacterial filter ( dAfter filtration through a 0.22 μm filter, a sterile fermentation filtrate was obtained. Solid ammonium sulfate was added to the sterile fermentation broth to a saturation of 80%, and after precipitation overnight at 4°C, it was centrifuged at 10,000 rpm for 20 min to collect the precipitate. 20 mL of 0.02 mol / L PBS buffer was measured and used to suspend the precipitate, which was then placed in a dialysis bag and dialyzed against the same concentration of PBS buffer to remove salts, obtaining a crude protein extract. Sucrose powder was used to remove excess water in the dialysis bag. The concentrated crude protein extract was aliquoted into 1.5 mL centrifuge tubes and stored at -80°C for later use.

[0090] Testing the inhibitory effect of the fermentation broth of strain LC40 on TMV: The strain was inoculated into TSB liquid medium at a volume ratio of 1:100 and cultured overnight, and then diluted with sterile water to obtain a fermentation broth with an OD 600 of 1.0 for standby. Using the method of rubbing inoculation, the fermentation broth of strain LC40 was mixed with the TMV inoculation buffer in equal volumes, incubated at room temperature for 2 h, and then inoculated onto the right half leaf of Nicotiana glutinosa; a mixture of TSB liquid medium and TMV inoculation buffer incubated at room temperature for 2 h and inoculated onto the left half leaf was used as a control. At the same time, a 1000-fold dilution of 30% difenoconazole wettable powder was mixed with the TMV inoculation solution in equal volumes, incubated at room temperature for 2 h, and rubbed inoculated onto the right half leaf of Nicotiana glutinosa as a chemical control; a mixture of TSB and TMV inoculation solution rubbed inoculated onto the left half leaf of Nicotiana glutinosa was used as a negative control. 100 μL of the mixed solution was inoculated onto each half leaf, and each treatment was repeated 3 times. 10 min after inoculation, an appropriate amount of clear water was sprayed onto the leaf surface to keep the leaf moist. 3 days after inoculation, the number of necrotic spots on Nicotiana glutinosa was investigated and the inhibition rate was calculated.

[0091] Testing the inactivation effect of the crude protein extract of strain LC40 on TMV: The crude protein extract of strain LC40 diluted to 1 mg / mL was mixed with the TMV inoculation solution in equal volumes, incubated at room temperature for 2 h, and then inoculated onto the right half leaf of Nicotiana glutinosa using the method of rubbing inoculation; the left half leaf was inoculated with PBS and TMV (1:1 volume ratio) incubated at room temperature for 2 h as a control. At the same time, a 1000-fold dilution of 30% difenoconazole wettable powder was mixed with the TMV inoculation solution in equal volumes, incubated at room temperature for 2 h, and rubbed inoculated onto the right half leaf of Nicotiana glutinosa as a chemical control; a mixture of PBS and TMV inoculation solution rubbed inoculated onto the left half leaf of Nicotiana glutinosa was used as a negative control. 100 μL of the mixed solution was inoculated onto each half leaf, with 3 replicates. 10 min after inoculation, an appropriate amount of clear water was sprayed onto the leaf surface to keep the leaf moist. 3 days after inoculation, the number of necrotic spots was investigated and the inhibition rate was calculated.

[0092] Inhibition rate (%) = (average number of necrotic spots in the control - average number of necrotic spots in the treatment) / average number of necrotic spots in the control × 100%.

[0093] As shown in Table 2, Table 3 and Figure 6 、 Figure 7As shown in the figure, the average inhibition rates of the LC40 fermentation broth and the crude protein extract against TMV were 68.63% and 76.68% respectively, indicating that both the LC40 fermentation broth and the crude protein extract had a passivation effect on TMV, and the effect was better than that of 30% difenoconazole wettable powder.

[0094] Table 2 Inhibitory effect of the fermentation broth of Pseudomonas asiatica strain LC40 against TMV

[0095]

[0096] Table 3 Inhibitory effect of the crude protein extract of Pseudomonas asiatica strain LC40 against TMV

[0097]

[0098] (2) Preventive effect of the fermentation broth of strain LC40 against TMV

[0099] The preventive effect of the fermentation broth of strain LC40 against TMV was determined through the preventive mode: The activated LC40 fermentation broth was inoculated into 20 mL of LB liquid medium and cultured overnight. The next day, the fermentation broth was diluted with sterile water to an OD 600 value of 1.0, and then sprayed onto the leaves of common tobacco K365 at the 3-4 leaf stage. Spraying LB liquid medium was used as the negative control, and spraying 1000-fold solution of 30% difenoconazole wettable powder was used as the positive control. 48 hours after spraying, the TMV infectious clone (pCB-TMV) transformed into Agrobacterium was inoculated. Each common tobacco K326 was inoculated with 100 μL of Agrobacterium containing the TMV infectious clone with an OD 600 value of 0.8. The symptoms were observed 21 days after inoculating TMV.

[0100] The grading of the severity of TMV disease refers to the "grading standard for tobacco common mosaic virus disease (TMV)" in the national standard GB / T 23222-2008 "Grading and investigation methods for tobacco diseases and pests" (Table 4).

[0101] Table 4 Grading standard for the severity of TMV disease

[0102]

[0103] Note: Grading and investigation are carried out on a per-plant basis

[0104] Calculation method of disease index: Disease index = ∑(number of diseased plants or leaves at each level × value of that disease level) / (total number of plants or leaves investigated × highest disease level value) × 100

[0105] Inhibition rate (%) = [(disease index of the control group - disease index of the treatment group) / disease index of the control group] × 100%

[0106] As shown in Table 5 and Figure 8As shown, the plants in the treatment group with the fermentation broth of strain LC40 grew normally, with no obvious mosaic symptoms, and the disease index was 22.22. While the plants in the LB control group were dwarfed, with severe mosaic and deformity symptoms, and the disease index was 80. After calculation, the inhibition rate of the fermentation broth of strain LC40 against TMV was 72.22%, and its inhibitory effect on TMV was better than that of 30% difenoconazole wettable powder. The above results indicate that the fermentation broth of strain LC40 has a significant preventive effect on TMV.

[0107] Table 5 Investigation results of the severity of TMV disease after spraying the fermentation broth of strain LC40

[0108]

[0109] (III) Activity test of the crude protein of strain LC40 against ToBRFV

[0110] The above invention uses TMV as the control object and verifies that the fermentation broth and crude protein of Pseudomonas asiatica LC40 have a significant inactivation effect on TMV. Further verify the effect of LC40 crude protein against ToBRFV.

[0111] Verify the inactivation effect of the crude protein of strain LC40 against ToBRFV by the half-leaf lesion method: The preparation of the virus source is the same as in (I). After mixing the crude protein of strain LC40 diluted to 1 mg / mL with the ToBRFV inoculum in equal volume and incubating at room temperature for 2 h, inoculate it onto the right half leaf of Nicotiana glutinosa by the method of rubbing inoculation; inoculate the left half leaf with PBS and ToBRFV (1:1 volume ratio) incubated at room temperature for 2 h as a control. At the same time, mix 1000-fold solution of 30% difenoconazole wettable powder with the ToBRFV inoculum in equal volume and incubate at room temperature for 2 h, and rub inoculate it onto the right half leaf of Nicotiana glutinosa as a chemical control; the mixture of PBS and the ToBRFV inoculum is rubbed inoculated onto the left half leaf of Nicotiana glutinosa as a negative control. Inoculate 100 μL of the mixture on each half leaf, with 3 replicates. Spray an appropriate amount of clear water on the leaf surface 10 min after inoculation to keep the leaf moist. Investigate the number of lesions 3 days after inoculation and calculate the inhibition rate. The calculation method of the inhibition rate is the same as in Example 3 (I).

[0112] As shown in Table 6 and Figure 9 As shown, the inhibition rate of the crude protein of strain LC40 against ToBRFV was 70.11%, indicating that it has a good inhibitory effect on ToBRFV.

[0113] Table 6 Inhibitory effect of the crude protein of Pseudomonas asiatica LC40 against ToBRFV

[0114]

[0115] Example 4 Inhibitory effect of strain LC40 against pathogenic fungi

[0116] Tested pathogenic fungi: Fusarium oxysporum f. sp. cubense tropical race 4 (Foc 4), Magnaporthe oryzae, Alternaria tenuissima, and Rhizoctonia solani Fusarium oxysporium f. sp. cubense tropical race 4:Foc 4), Magnaporthe oryzae ( Magnaportheoryzae ), Alternaria tenuissima ( Alternariatenuissima ), and Rhizoctonia solani ( Rhizoctoniasolani ).

[0117] The antagonistic experiment was carried out by the plate confrontation culture method. The confrontation experiment method is as follows: The pathogenic fungi and the LC40 strain were inoculated on PDA and LB plates respectively. A single colony of LC40 was picked and inoculated into LB liquid medium, and cultured overnight at 28 °C and 220 rpm. When the PDA medium cooled to about 45 °C, the fermentation broth of the LC40 strain with an OD 600 of 0.4 was added at a volume ratio of 1:100, and after mixing well, the plates were poured. The plate without adding LC40 was used as a control. A pathogenic fungal disc with a diameter of 1 cm was inoculated in the center of the plate, and 3 replicates were set for each treatment. The plates were incubated upside down at 28 °C until the control plate was fully covered with the pathogen, and then the diameter of the pathogenic fungal colony was measured, and the growth inhibition rate of the LC40 strain on the mycelium of the pathogenic fungi was calculated.

[0118] Inhibition rate (%) = (colony diameter of the control group - colony diameter of the treatment group) / colony diameter of the control group × 100%.

[0119] As can be seen from Table 7 and Figure 10 , among the 4 pathogenic fungi, the LC40 strain had an inhibitory effect on Magnaporthe oryzae ( Magnaportheoryzae ), Alternaria tenuissima ( Alternariatenuissima ), and Fusarium oxysporum f. sp. cubense tropical race 4 ( Fusarium oxysporium f. sp. cubense tropical race 4:Foc 4). Among them, the inhibitory effect on Magnaporthe oryzae was the best, with an inhibition rate of 76.08%; followed by Alternaria tenuissima, with an inhibition rate of 50.98%; the worst inhibitory effect was on Fusarium oxysporum f. sp. cubense tropical race 4 ( Fusarium oxysporium f. sp. cubense tropical race 4:Foc 4), with an inhibition rate of only 34.51%; while it had no inhibitory effect on Rhizoctonia solani ( Rhizoctoniasolani ). It shows that the LC40 strain has an inhibitory effect on some pathogenic fungi.

[0120] Table 7 Inhibition rate of Pseudomonas asiatica LC40 strain on 4 pathogenic fungi

[0121]

[0122] Example 5 Growth Promotion and Yield Increase Effects of Strain LC40 on Tomatoes

[0123] Indoor experiments have shown that strain LC40 has resistance to TMV and ToBRFV, inhibits the mycelial growth of pathogenic fungi such as Magnaporthe oryzae and Alternaria tenuissima, and has the ability to dissolve phosphorus and secrete IAA. Based on this, a field experiment was conducted to verify the growth promotion effect of strain LC40 on the crop tomato. The field experiment was carried out at the tomato planting base in Jinma Town, Luxi County, Honghe Prefecture, Yunnan Province. The variety planted was "Ruifei", purchased from Syngenta. The test time was from June to November.

[0124] (1)Experimental plot design: The experimental field was divided into 3 greenhouses with a total area of 388.8 m 2 . Each greenhouse had an area of 129.6 m 2 , which was divided into 3 plots, each plot having an area of 43.2 m 2 . Among them, each plot was planted with 4 rows at a row spacing of 1.2 m, and 16 plants were planted in each row at a plant spacing of 45 cm, for a total of 64 tomato plants. Each treatment had 192 tomato plants. The same treatments and control groups were arranged in the 3 greenhouses, with 3 replicates.

[0125] Bacterial agents used in the field experiment: The liquid of strain LC40 with an OD 600 =1.0 in shake flask fermentation was diluted 150 times with water when used, and the concentration of Rhodovulum sulfidophilum HNI-1 was 2×10 8 cfu / mL, which was diluted 300 times when used.

[0126] There were 3 treatments in the experiment, namely the farmer's self-prevention control area, the experimental area of the fermentation broth of strain LC40, and the experimental area of Rhodovulum sulfidophilum HNI-1. Among them, the farmer's self-prevention control area was the conventional treatment; the experimental area of the fermentation broth of strain LC40 was to spray the fermentation broth of strain LC40 diluted 150 times at different growth stages of tomatoes on the basis of the conventional treatment; the experimental area of Rhodovulum sulfidophilum HNI-1 was to spray Rhodovulum sulfidophilum HNI-1 diluted 300 times during the growth period of tomatoes on the basis of the conventional treatment. The specific implementation methods are as follows:

[0127] Two weeks after sowing tomato seeds, 1 L of the fermentation broth of strain LC40 diluted 150 times and 300-fold solution of Rhodovulum sulfidophilum HNI-1 (1×10 8Spray the corresponding seedbeds evenly with the corresponding solutions at a concentration of [[ID=]], respectively. On the day of transplantation, dip the tomato seedlings in the fermentation broth of strain LC40 at a dilution of 150 times and HNI-1 at a dilution of 300 times for 5 minutes in the corresponding treatment areas. In the first month after transplantation, spray the fermentation broth of strain LC40 diluted 150 times or HNI-1 diluted 300 times once every 7 days in each plot, with 3 L sprayed in each plot, for a total of 3 sprays. After that, spray the fermentation broth of strain LC40 diluted 150 times or HNI-1 diluted 300 times once every 10 days, with 5 L sprayed in each plot, for a total of 3 sprays. Investigate the plant height of tomatoes 2 - 6 weeks after tomato transplantation, and investigate the number of flower stalks of tomatoes 3 - 8 weeks after transplantation. Investigate 30 plants for each treatment. After the tomato fruits are ripe, pick the tomatoes in 3 batches and measure the yield. Fix 10 tomato plants for yield measurement in each plot, measure 30 plants each time for each treatment, and calculate the yield per mu based on 2000 plants per mu.

[0128] Tomato yield per mu (kg) = Total weight of tomato fruits investigated 3 times (kg) × 2000 plants / 30 plants

[0129] Yield increase rate per mu (%) = (Yield per mu in the experimental area - Yield per mu in the farmers' self - control area) / Yield per mu in the farmers' self - control area × 100%.

[0130] Results (1): Strain LC40 can promote the growth of tomato plants. The plant height of tomatoes was investigated 4 times after transplantation. The data of the 4 investigations all showed that the average plant height in the experimental area of the fermentation broth of strain LC40 was higher than that in the farmers' self - control area. It is worth noting that after 32 days (August 16th) of transplantation, the tomato plant height in the experimental area of the fermentation broth of strain LC40 began to be significantly higher than that in the farmers' self - control area. By 43 days (August 27th) of transplantation, the plant height difference was the largest. The tomatoes in the experimental area of the fermentation broth of strain LC40 were 14.7 cm higher than those in the farmers' self - control area ( Figure 11 ). This indicates that the fermentation broth of strain LC40 has a significant growth - promoting effect on tomato plants.

[0131] Results (2): Treatment with the fermentation broth of strain LC40 increased the number of flower stalks and yield of tomatoes. The data of the 4 investigations on the number of flower stalks all showed that treatment with the fermentation broth of strain LC40 could increase the number of flower stalks of tomatoes. The difference in the number of flower stalks was the largest at 43 days (August 27th) after tomato transplantation. The average number of flower stalks in the experimental area of the fermentation broth of strain LC40 was 1.8 more than that in the farmers' self - control area (see Figure 12 ). The final yield measurement results showed that the tomato yield in the treatment area of the fermentation broth of strain LC40 was significantly higher than that in the control area, with a yield increase rate as high as 8.79% (Table 8). In addition, during the field yield measurement, it was found that there were more large fruits in the treatment area of the LC40 fermentation broth, and the heaviest single fruit reached 530 g. This increased the yield in the experimental area of the fermentation broth of strain LC40.

[0132] The above results indicate that the fermentation broth of strain LC40 has a significant effect on promoting the growth and increasing the yield of tomatoes.

[0133] Table 8 Statistical table of tomato yields in the test areas of the fermentation broth of strain LC40, Rhodovulum sulfidophilum, and the farmer's self-prevention control area

[0134]

[0135] The embodiments of the present application have been described above. The above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations are obvious to those of ordinary skill in the art in the technical field without departing from the scope and spirit of the described embodiments. The selection of the terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technologies in the market, or to enable other ordinary skill in the art in the technical field to understand the embodiments disclosed herein.

Claims

1. A strain of Pseudomonas asiatica ( Pseudomonas asiatica ) LC40, characterized in that The Pseudomonas asiaticus LC40 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32869, and was classified and named Pseudomonas asiaticus Pseudomonas asiatica .

2. A Pseudomonas asiatica fermentation broth, characterized in that: The Pseudomonas asiatica fermentation broth comprises the Pseudomonas asiatica LC40 according to claim 1.

3. A Pseudomonas Asiaticus fermentation liquid in inhibiting tobacco mosaic virus ( Tobamovirus tabaci ), characterized in that The Pseudomonas asiaticus fermentation broth is the Pseudomonas asiaticus fermentation broth according to claim 2.

4. A Pseudomonas asiatica fermentation liquid in inhibiting rice blast fungus ( Magnaporthe oryzae ) and Alternaria tenuissima ( Alternaria tenuissima ), characterized in that The Pseudomonas asiatica fermentation broth is the Pseudomonas asiatica fermentation broth described in claim 2.

5. A crude protein extract of Pseudomonas asiatica, characterized in that: The crude protein of Pseudomonas asiaticus is extracted from the Pseudomonas asiaticus LC40 described in claim 1 by an ammonium sulfate precipitation method.

6. A crude protein extracted from Pseudomonas asiatica inhibits tobacco mosaic virus ( Tobamovirus tabaci )、Tomato brown fruit virus( Tobamovirus fructirugosum ), characterized in that The crude protein extracted from Pseudomonas asiaticus is the crude protein extracted from Pseudomonas asiaticus according to claim 5.

7. An application of Pseudomonas asiatica in promoting tomato growth and increasing yield, characterized in that: The Pseudomonas asiaticus is the Pseudomonas asiaticus LC40 described in claim 1.

Images