Zymomonas mobilis chassis cell as well as construction method and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a zymomonas mobilis chassis cell as well as a construction method and application thereof. According to the chassis cell, a zymomonas mobilis recombinant strain of which a genome is integrated with a Cas12a gene is taken as a starting strain, and a RecET gene is integrated into the genome of the zymomonas mobilis recombinant strain, so that the chassis cell with improved large-fragment gene editing efficiency is obtained. According to the method, an efficient editing mode is provided for directional editing of the zymomonas mobilis genome large fragment, the method is suitable for construction of chassis cells needing frequent gene editing, and the time cost of chassis cell gene editing is greatly saved; moreover, the chassis cell genome is greatly simplified, the biosynthesis efficiency of biological elements and ways is improved, and the method has good industrial application value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a Zymomonas mobilis chassis cell and a construction method and application thereof. Background Art

[0002] As a frontier field of biotechnology, synthetic biology is rapidly changing traditional biomanufacturing methods. Its core lies in building efficient cell factories, treating them as efficient production units, and using the biosynthetic ability of cells to transform and optimize cells through genetic engineering, metabolic engineering and other means, and inserting functionalized biosynthetic elements, circuits and pathways so that they can achieve specific biological functions or mass-produce specific biological products according to preset routes. In this process, chassis cells act as host cells for metabolic reactions, responsible for carrying and performing specific biosynthetic tasks, and are the cornerstone of synthetic biology. For example, when designing a synthetic biological system that can produce biofuels, it is necessary to introduce genes encoding enzymes related to biofuel synthesis into chassis cells to build cell factories. These genes will be expressed into corresponding enzymes through the transcription and translation mechanisms inside the cell factories. These enzymes further catalyze a series of chemical reactions in the cells, thereby achieving green and efficient biosynthesis of biofuels.

[0003] Chassis cells refer to basic organisms with relatively simple genomes that have been artificially modified. Their genomes will be manipulated to facilitate the placement of functional genetic expression elements. In short, they are cell carriers that carry and run artificially designed biosynthetic systems. In order to enable chassis cells to better achieve the goals of synthetic biology, chassis cells need to be modified to ensure the benign interaction between synthetic elements and host cells. Microbial genome streamlining and optimization is an important strategy for building excellent chassis cells. Non-essential coding and non-coding regions in the genome are deleted on a large scale to obtain a "minimal genome". Cell energy consumption is reduced by knocking out redundant genes, so that more energy can be used for product production. Among them, large-fragment deletion technology is an important means to achieve genome streamlining. The commonly used genome editing tool CRISPR-Cas has efficient DNA targeting and cutting efficiency, but the efficiency of large-fragment knockout is still low, especially in microorganisms with low double-strand break repair efficiency. In addition, chassis cells usually involve genetic manipulation and gene editing of more genes. Building an efficient genetic operating system plays a very important role in the efficient transformation of chassis cells.

[0004] Zymomonas mobilis is a type of natural ethanol-producing strain with the characteristics of small genome, fast metabolism, and high ethanol tolerance. It can be used for the production and synthesis of various alcohol-acid products and has the potential to become an excellent industrial chassis cell. At present, two sets of gene editing tools, the endogenous I-F type CRISPR-Cas system and the exogenous CRISPR-Cas12a system, have been constructed in the Z. mobilis model strain ZM4 to achieve knockout, replacement and insertion of the strain genome. However, like most strains, the double-stranded DNA break recombination efficiency of Z. mobilis is low, and it is still difficult to achieve the deletion and replacement of large fragments of DNA. Therefore, it is necessary to develop an efficient editing system for large-fragment gene sequences suitable for the construction of Z. mobilis chassis cells. Summary of the invention

[0005] In view of the problem in the prior art that the efficiency of large-fragment gene editing is low when Zymomonas mobilis is used for chassis cell construction, the present invention provides a novel Zymomonas mobilis chassis cell and a construction method and application thereof. The present invention is specifically implemented through the following technical solutions:

[0006] The first aspect of the present invention provides a chassis cell of Zymomonas mobilis, wherein the chassis cell is a ZMNP-Cas12a ZMNP-Cas12a with a Cas12a gene integrated at the ZMO0038 site of the genome as a starting strain, and the RecET gene is integrated into the ZMO0028 site of the ZMNP-Cas12a genome of the ZMNP-Cas12a ZMNP-Cas12a, and the upstream of the RecET gene is connected to the P tet Promoter, the Cas12a gene upstream is connected to P BAD Promoter.

[0007] Furthermore, the nucleotide sequence of the Cas12a gene is shown in SEQ ID NO.1, the nucleotide sequence of the RecET gene is shown in SEQ ID NO.2, and the P tet The nucleotide sequence of the promoter is shown in SEQ ID NO.3. BAD The nucleotide sequence of the promoter is shown in SEQ ID NO.4.

[0008] A second aspect of the present invention provides a method for constructing the above-mentioned Zymomonas mobilis chassis cells, comprising the following steps:

[0009] Obtain the upstream homology arm 0038US and downstream homology arm 0038DS sequences of the genomic ZMO0038 site, and convert P BAD The promoter and Cas12a gene were connected in series between the 0038US and 0038DS sequences to construct the first homologous recombination plasmid;

[0010] Obtain the upstream homology arm 0028US and downstream homology arm 0028DS of the genomic ZMO0028 site, and convert P tet The promoter and RecET gene were connected in series between the 0028US and 0028DS sequences to construct a second homologous recombination plasmid;

[0011] The first homologous recombination plasmid and the second homologous recombination plasmid were transformed into Zymomonas mobilis ZMNP-Cas12a respectively, and P BAD The promoter and Cas12a gene were integrated into the ZMO0038 site and the P tet The promoter and RecET gene were integrated into the ZMO0028 locus, and Zymomonas mobilis chassis cells were screened.

[0012] A third aspect of the present invention provides the use of the Zymomonas mobilis chassis cells as described above in large-fragment gene editing.

[0013] Furthermore, the gene editing is gene knockout, gene replacement and / or point mutation; the sequence length of the gene ranges from 9 to 30 kb.

[0014] A fourth aspect of the present invention provides a method for editing genes in the chassis cells of Zymomonas mobilis as described above, comprising the following steps:

[0015] According to the target sequence to be edited, the guide RNA and donor DNA are designed, wherein the donor DNA includes the upstream homology arm and downstream homology arm sequences of the guide RNA targeting sequence, the guide RNA and the donor DNA are connected to the expression vector to obtain the editing plasmid, the editing plasmid is transformed into the Zymomonas mobilis chassis cells as described above, and the positive chassis cells transformed with the editing plasmid are cultured.

[0016] The advantages and positive effects of the present invention are: the present invention provides a P BAD The promoter controls the Cas12a gene and P tetThe present invention discloses a recombinant strain in which the expression of the RecET gene is controlled by a promoter, which has high efficiency in editing large-fragment genes and editing plasmid transformation efficiency. In the presence of guide RNA (gRNA) and donor DNA (DonorDNA), the CRISPR-Cas12a and RecET homologous recombination systems can be used to conveniently and accurately perform operations such as knockout, site-directed mutation and replacement on the target sequence within the size range of 9-30 kb of the recombinant strain, thereby providing an efficient editing method for the directional editing of the genome of Zymomonas mobilis, being suitable for the construction of chassis cells that require frequent gene editing, and being beneficial to greatly saving the time cost of chassis cell gene editing. Moreover, the genome of the strain of the present invention is greatly simplified, which is beneficial to improving the biosynthesis efficiency of functionalized genetic expression elements and increasing the yield of target products. The strain is suitable as a chassis cell for synthetic biology and has good industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings used in describing the embodiments.

[0018] Figure 1 This is a schematic diagram of the use of Zymomonas mobilis chassis cells for gene editing in an embodiment of the present invention;

[0019] Figure 2 The homologous recombination plasmid pUC57-P of the present invention tet -RecET and pUC57-P BAD - RecET vector map;

[0020] Figure 3 The knockout efficiency of the ZMO0252 gene by the recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET of the embodiments of the present invention is shown, wherein Figure A is a schematic diagram of the transformation of the editing plasmid by the recombinant strain, Figure B is a transformation efficiency diagram of the editing plasmid in the recombinant strain, and Figure C is a diagram of the gene editing efficiency of the recombinant strain;

[0021] Figure 4 The homologous recombination plasmid pUC57-P of the present invention BAD -Cas12a vector map;

[0022] Figure 5 Figure 1 is the knockout efficiency of the ZMO0252 gene by the recombinant strain PB-Cas12a of an embodiment of the present invention, wherein Figure A is a schematic diagram of the transformation of the editing plasmid by the recombinant strain, Figure B is a transformation efficiency diagram of the editing plasmid in the recombinant strain, and Figure C is a gene editing efficiency diagram of the recombinant strain;

[0023] Figure 6Figure 1 is the knockout efficiency of the ZMO0252 gene by different recombinant strains in the embodiments of the present invention, wherein Figure A is a colony PCR amplification result diagram of each recombinant strain, and Figure B is a gene editing efficiency diagram of each recombinant strain;

[0024] Figure 7 This is a diagram of the knockout efficiency of the recombinant strain PB-cas12a_Pt-recET of the embodiment of the present invention for different fragment lengths of the ZMO0252-0269 gene cluster, wherein Figure A is a schematic diagram of the gene knockout principle, Figure B is a diagram of the accuracy of the knockout sequence verified by Sanger sequencing, and Figure C is a diagram of the editing efficiency of different gene fragment lengths;

[0025] Figure 8 This is a colony PCR amplification result diagram of the knockout of different fragment lengths of the ZMO0252-0269 gene cluster by the recombinant strain PB-cas12a_Pt-recET of an embodiment of the present invention;

[0026] Fig. 9 This is a knockout efficiency diagram of the recombinant strain PB-cas12a_Pt-recET of the present invention for the ZMO1455-1466 and ZMO0793-0803 gene clusters, wherein Figure A is a gene cluster knockout efficiency diagram, and Figures BC are colony PCR amplification result diagrams of the ZMO1455-1466 and ZMO0793-0803 gene clusters, respectively;

[0027] Fig.10 This is a knock-in efficiency diagram of the recombinant strain PB-cas12a_Pt-recET of the embodiment of the present invention for the 2,3-butanediol metabolic pathway gene cluster, wherein Figure A is a schematic diagram of the gene knock-in site, and Figures BC are colony PCR amplification result diagrams of the recombinant strain PB-cas12a_Pt-recET and the control strain PB-cas12a, respectively. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with examples. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. According to the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. In order to better understand the present invention rather than limit the scope of the present invention, all numerals used in this application to represent the amount, percentage, and other numerical values ​​should be understood as modified by the word "approximately" in all cases. Unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as being obtained by conventional rounding methods. In addition, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of the present invention should have the meanings commonly understood by those of ordinary skill in the art.

[0029] The meaning of the terms "include", "comprising", "containing", "having" and the like is non-restrictive, i.e., other steps and other ingredients that do not affect the result may be added. The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be regarded as including the following situations: (i) A, (ii) B, and (iii) A and B. The terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or indicating or implying relative order.

[0030] The term "gene" is the complete nucleotide sequence required to produce a polypeptide chain or functional RNA. The terms "chimeric gene" or "fusion gene" have the same meaning and refer to any gene that is not a natural gene and contains regulatory sequences and coding sequences that do not exist together under natural conditions. Therefore, a fusion gene may include regulatory sequences and coding sequences derived from different organisms, or regulatory sequences and coding sequences derived from the same organism but arranged in a manner different from that found in nature.

[0031] The term "vector" refers to a self-replicating DNA molecule that transfers an exogenous target gene into a host organism, and is often in the form of a circular double-stranded DNA molecule. A vector containing an exogenous gene is a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, cosmids, and minichromosomes. Plasmids are the most common form of vectors, and therefore, in the context of the present invention, plasmids and vectors can be used interchangeably.

[0032] The term "P tet ”, “P tet Promoter", "P tetUnless otherwise specified, the term "operator" and similar terms have the same meaning, which includes tetR and tetA sequences, indicating that the promoter is controlled to express in the presence of the inducer tetracycline. BAD ”, “P BAD Promoter", "P BAD Unless otherwise specified, the words "operator" and the like have the same meaning, which include araC and araBAD sequences, indicating that the promoter is controlled to express in the presence of the inducer arabinose.

[0033] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below.

[0034] In a number of preliminary studies of the present invention, Zymomonas mobilis ZM4 was first used as the starting strain, and the nuclease Cas12a gene and spectinomycin resistance gene from Francisella novicida were integrated into the ZMO0038 site in the genome of Z. mobilis ZM4 (ATCC31821) by homologous recombination, and an inducible promoter, tetracycline inducible promoter P was used. tet To control the expression of nuclease, recombinant strain ZM4-Cas12a was constructed. Recombinant strain ZM4-Cas12a is based on the CRISPR-Cas12a system and can achieve targeted editing of the genome. The construction method of recombinant strain ZM4-Cas12a refers to the literature "Shen W, Zhang J, Geng B, et al. Establishment and application of a CRISPR-Cas12a assisted genome-editing system in Zymomonas mobilis [J]. Microbial Cell Factories, 2019, 18 (1). DOI: 10.1186 / s12934-019-1219-5." and patent "CN110358767A A method for genome editing of Zymomonas mobilis based on CRISPR-Cas12a system and its application (publication date: 2019-10-22)".

[0035] Further, ZM4-Cas12a was used as the starting strain, and the four endogenous plasmids pZM32, pZM36, pZM33, and pZM39 of ZM4-Cas12a were eliminated by genetic engineering to obtain the recombinant strain ZMNP-Cas12a of Zymomonas mobilis without endogenous plasmids. Among them, the four endogenous plasmids in the ZM4-Cas12a strain are named according to size: pZM32 (32791bp, Genbank No. CP023678), pZM33 (33006bp, Genbank No. CP023679), pZM36 (36494bp, Genbank No. CP023680) and pZM39 (39266bp, Genbank No. CP023681). The recombinant strain ZMNP-Cas12a has a streamlined genome, which is beneficial to reducing energy consumption, and has excellent properties such as high gene conversion efficiency, greater tolerance to ethanol fermentation inhibitors, and better utilization of secondary mother liquor, making it very suitable as a chassis cell for industrial microorganisms. The construction method of the recombinant strain ZMNP-Cas12a can be found in the patent "CN115806922A Genetically engineered strains of Zymomonas mobilis and their applications (publication date: 2023-03-17).

[0036] The genome sequence of Zymomonas mobilis ZM4 used in the present invention is shown in Genbank Accession No. GCA_003054575.

[0037] Although the recombinant strain ZMNP-Cas12a provides a versatile genome editing tool for the development of synthetic microbial chassis and has application advantages as chassis cells, its efficiency in editing large fragments of genes or DNA sequences is low.

[0038] Based on this, the embodiment of the present invention provides a new recombinant strain of Zymomonas mobilis, which is suitable for use as a chassis cell for large-fragment gene editing. The chassis cell is a ZMNP-Cas12a strain with a Cas12a gene integrated into the ZMO0038 site of the genome, and the RecET gene is integrated into the ZMO0028 site of the ZMNP-Cas12a genome of the ZMNP-Cas12a. The upstream of the RecET gene is connected to the P tet Promoter, the Cas12a gene upstream is connected to P BAD Promoter.

[0039] Optionally, the nucleotide sequence of the Cas12a gene is shown in SEQ ID NO.1, the nucleotide sequence of the RecET gene is shown in SEQ ID NO.2, and the P tet The nucleotide sequence of the promoter is shown in SEQ ID NO.3. BADThe nucleotide sequence of the promoter is shown in SEQ ID NO.4.

[0040] The RecET homologous recombination system derived from the Escherichia coli Rac phage can effectively induce recombination between linear DNA fragments and bacterial chromosomes. The RecE protein in the RecET homologous recombination system has 5'-3' double-stranded exonuclease activity, which can act on linear fragments to produce a 3'-end single-stranded overhang. The overhang will be further bound by the single-stranded binding protein RecT in the system to prevent degradation. The double-stranded DNA with the protruding end can promote homologous recombination of the homologous arm at the target site. The present invention combines the RecET system with the CRISPR-Cas12a system previously studied, and by the guidance of guide RNA (gRNA) in the CRISPR-Cas12a system, Cas12a nuclease recognizes the targeting sequence of guide RNA and cuts to cause double-stranded DNA (dsDNA) breakage, RecE protein binds to the dsDNA end of the break, and rapidly degrades from the 5' end to form a long 3' end single-stranded DNA (ssDNA) overhang, followed by RecT protein stably binding to ssDNA, protecting the exposed ssDNA from the attack of single-stranded nuclease, and the homologous sequence of ssDNA can be found, and the gene editing of the targeting sequence is realized based on homologous recombination. Thus, the CRISPR-Cas12a provided by the present invention is conducive to promoting efficient breakage and repair of double-stranded DNA with RecET homologous recombination, thereby improving large fragment editing efficiency.

[0041] Based on the technical principle (see Figure 1 ), the present invention uses Zymomonas mobilis ZMNP-Cas12a (Ptet-Cas12a) as the starting strain, integrates the RecET gene into the genome ZMO0028 site by homologous recombination, and uses two inducible promoters P tet and P BAD By controlling its expression, two recombinant strains, Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET, were obtained. By comparing with the control strain Ptet-Cas12a, it was found that P tet Promoter-driven RecET expression is more conducive to improving the efficiency of editing plasmid transformation and large-fragment gene knockout in recombinant strains. tet and P BAD The expression of Cas12a genes was controlled separately, and the expression level of Cas12a was optimized. It was found that the expression level of Cas12a was crucial for large-fragment gene knockout. BAD Promoter-driven Cas12a expression is more conducive to improving the efficiency of editing plasmid transformation and large-fragment gene knockout in recombinant strains.

[0042] Based on the above findings, the present invention provides a method of BAD The promoter controls the Cas12a gene and P tet The recombinant strain PB-cas12a_Pt-recET in which the expression of the RecET gene is controlled by a promoter has high efficiency in large-fragment gene editing and editing plasmid transformation. In the presence of guide RNA (gRNA) and donor DNA (DonorDNA, the target gene to be edited into the recombinant strain genome targeting sequence, at least including the upstream homologous arm (US) and the downstream homologous arm (DS) of the targeting sequence), the CRISPR-Cas12a and RecET homologous recombination system is used to mediate the recombination between the target sequence break site and the homologous arm of the donor DNA, so that the recombinant strain targeting sequence can be easily and accurately replaced with the target gene for operations such as DNA knockout, site-directed mutagenesis and replacement, solving the problem of frequent remodeling of chassis cells due to replacement of genetic expression elements with different functions. The present invention uses site-directed knockout of multiple fragments of different sizes (9kb, 13kb, 16kb, 20kb, 25kb, 30kb) in the ZMO0252_0269 gene cluster, the ZMO1455-1466 gene cluster (14kb), and the ZMO0793-0803 gene cluster (15kb), confirming that the recombinant strain of the present invention can effectively knock out large-fragment genes in the range of 9-30kb, and the knockout efficiencies of 9-16kb, 20-25kb, and 30kb DNA fragments of the genome are approximately 100%, 80%, and 5%, respectively; in addition, the application of site-directed replacement of the Ptet-als Pgap-aldC_bdh (4393bp) gene cluster in the 2,3-butanediol metabolic pathway shows that the knock-in efficiency of the gene at the target site is approximately 56.25%. It can be seen that the recombinant strain with the gene editing system of the present invention provides an efficient editing method for the directional editing of the genome of Zymomonas mobilis, and its large fragment knockout efficiency is high, and the large fragment gene knock-in efficiency can be improved at the same time, which is suitable for the construction of chassis cells that need to be frequently gene-edited, which is conducive to greatly saving the time cost of chassis cell gene editing, and can also provide scientific guidance for large-fragment genome editing of other microbial strains. Moreover, the starting strain genome of the present invention is greatly simplified, which is conducive to improving the biosynthesis efficiency of functionalized genetic expression elements, increasing the yield of target products, and is suitable for chassis cells as synthetic biology, with good industrial application value.

[0043] Another embodiment of the present invention provides a method for constructing the above-mentioned Zymomonas mobilis chassis cells, comprising the following steps:

[0044] Obtain the upstream homology arm 0038US and downstream homology arm 0038DS sequences of the genomic ZMO0038 site, and convert P BADThe promoter and Cas12a gene were connected in series between the 0038US and 0038DS sequences to construct the first homologous recombination plasmid;

[0045] Obtain the upstream homology arm 0028US and downstream homology arm 0028DS of the genomic ZMO0028 site, and convert P tet The promoter and RecET gene were connected in series between the 0028US and 0028DS sequences to construct a second homologous recombination plasmid;

[0046] The first homologous recombination plasmid and the second homologous recombination plasmid were transformed into Zymomonas mobilis ZMNP-Cas12a respectively, and P BAD The promoter and Cas12a gene were integrated into the ZMO0038 site and the P tet The promoter and the RecET gene are integrated into the ZMO0028 site, and the Zymomonas mobilis chassis cells of the present invention are screened and obtained.

[0047] It should be noted that the transformation order of the first homologous recombination plasmid and the second homologous recombination plasmid described above is not particularly limited. The first homologous recombination plasmid can be transformed first, and the P BAD The promoter and Cas12a gene were tandemly integrated into the ZMO0038 site of ZMNP-Cas12a to obtain the PB-cas12a recombinant strain, and then the second homologous recombination plasmid was transformed to P tet The promoter and RecET gene are connected in series and integrated into the ZMO0028 site of the PB-cas12a recombinant strain to screen for the target recombinant strain. The second homologous recombination plasmid can also be transformed first to obtain the Pt-cas12a_Pt-recET recombinant strain, and then the first homologous recombination plasmid is transformed to screen for the target recombinant strain.

[0048] Optionally, for the convenience of screening, the first homologous recombination plasmid and the second homologous recombination plasmid carry different resistance marker genes, thereby screening positive clones through the resistance performance of the recombinant strain to different antibiotics. The present invention is not particularly limited to the selection of resistance markers, and conventional resistance genes in the art can be used, including but not limited to: kanamycin gene, chloramphenicol gene, spectinomycin gene, tetracycline gene, ampicillin gene, puromycin gene, and neomycin gene.

[0049] In a typical embodiment, the resistance marker gene of the first homologous recombination plasmid is selected from the spectinomycin gene, and the resistance marker gene of the second homologous recombination plasmid is selected from the chloramphenicol gene.

[0050] Optionally, the first homologous recombination plasmid and the second homologous recombination plasmid further include a replication origin (Ori) sequence, and the Ori sequence can be derived from a pUC57 vector. The Ori sequence initiates replication in the plasmid by recruiting replication-related proteins to obtain a large number of homologous recombination plasmids.

[0051] In a specific embodiment, the construction of the first homologous recombination plasmid comprises the following steps: obtaining the upstream homology arm 0038US and the downstream homology arm 0038DS sequence of the ZMO0038 site by PCR amplification, and obtaining the P BAD The promoter, Cas12a gene, spectinomycin gene and Ori sequence of pUC57 vector were amplified to obtain 0038US sequence, RecET gene, P BAD The promoter, spectinomycin gene and 0038DS sequence are sequentially connected to the Ori sequence by Gibson assembly to obtain a second homologous recombination plasmid; wherein the nucleotide sequence of the 0038US sequence amplification primer pair is shown in SEQ ID NO.20-21, the nucleotide sequence of the 0038DS sequence amplification primer pair is shown in SEQ ID NO.22-23, the nucleotide sequence of the Cas12a gene amplification primer pair is shown in SEQ ID NO.18-19, and P BAD The nucleotide sequences of the promoter amplification primer pair are shown in SEQ ID NOs. 7 and 9, the nucleotide sequence of the spectinomycin gene amplification primer pair is shown in SEQ ID NOs. 24-25, and the nucleotide sequence of the Ori sequence amplification primer pair is shown in SEQ ID NOs. 16-17.

[0052] In a specific embodiment, the construction of the second homologous recombination plasmid comprises the following steps: obtaining the upstream homology arm 0028US and the downstream homology arm 0028DS sequence of the ZMO0028 site by PCR amplification, and obtaining the P tet promoter, RecET gene, chloramphenicol gene and Ori sequence of pUC57 vector, and the amplified 0028US sequence, RecET gene, P tet The promoter, chloramphenicol gene and 0028DS sequence are sequentially connected with the Ori sequence by Gibson assembly to obtain a second homologous recombination plasmid; wherein the nucleotide sequence of the 0028US sequence amplification primer pair is shown in SEQ ID NO.10-11, the nucleotide sequence of the 0028DS sequence amplification primer pair is shown in SEQ ID NO.12-13, the nucleotide sequence of the RecET gene amplification primer pair is shown in SEQ ID NO.5-6, and P tetThe nucleotide sequences of the promoter amplification primer pair are shown in SEQ ID NOs.7-8, the nucleotide sequences of the chloramphenicol gene amplification primer pair are shown in SEQ ID NOs.14-15, and the nucleotide sequences of the Ori sequence amplification primer pair are shown in SEQ ID NOs.16-17.

[0053] One embodiment of the present invention provides the use of the Zymomonas mobilis chassis cells as described above in large-fragment gene editing, especially large-fragment gene editing with a sequence length ranging from 9 to 30 kb, more preferably 9 to 25 kb.

[0054] The gene editing mentioned above includes, but is not limited to, gene knockout, gene replacement and point mutation, which are achieved according to the structural form of the exogenous donor DNA. Specifically, when the donor DNA only includes the upstream homology arm (US) and downstream homology arm (DS) of the target sequence of the guide RNA (gRNA), the deletion of the target sequence can be achieved (see the principle). Figure 1 ), when the target gene includes not only the upstream and downstream homology arm sequences of the targeting sequence, but also the target gene to be knocked in between the upstream and downstream homology arm sequences, the target gene can replace the targeting sequence, thereby realizing the operation of large-fragment gene replacement or point mutation.

[0055] The present invention also provides a method for gene editing of Zymomonas mobilis chassis cells, comprising the following steps:

[0056] According to the target sequence to be edited, the guide RNA and donor DNA are designed, and the donor DNA includes the upstream homology arm and downstream homology arm sequences of the guide RNA targeting sequence. The guide RNA and the donor DNA are connected to the expression vector to obtain the editing plasmid, and the chassis cells of Zymomonas mobilis as described above are transformed. The chassis cells transformed with the editing plasmid are cultured, and the gene editing of the targeting sequence can be achieved by homologous recombination technology.

[0057] Optionally, the expression vector is artificially modified pEZ15A, and the modification process thereof is described in patent "CN110358767A". Specifically, pEZ15a is used as the vector backbone, into which the sequence is inserted: The underlined wavy line indicates the constitutive promoter PJ23119, the underlined solid straight line indicates the 19nt repeat sequence, and the underlined dotted straight line indicates two BsaⅠ restriction sites, which are the gRNA insertion sites.

[0058] After the gRNA primer pair with the BsaⅠ restriction site upstream is withdrawn, it is connected to the pEZ15A vector after BsaⅠ digestion. The enzyme-linked pEZ15A vector is then amplified and connected to the donor DNA to obtain the editing plasmid.

[0059] In the context of the present invention, upstream refers to the 5' end of a gene, and downstream refers to the 3' end of a gene, with upstream to downstream being from the 5' end to the 3' end.

[0060] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually based on conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or the conditions recommended by the manufacturer.

[0061] Example

[0062] 1. Introduction of RecET system into ZMNP-Cas12a and determination of the optimal promoter

[0063] Using Zymomonas mobilis ZMNP-Cas12a (Pt-Cas12a) as the starting strain, the homologous recombination plasmid pUC57-P was transferred into the strain ZMNP-Cas12a. tet -RecET (vector map see Figure 2 Middle left) and pUC57-P BAD -RecET (vector map see Figure 2 RecET was integrated into the genomic ZMO0028 site by homologous recombination, and two inducible promoters P tet and P BAD Control its expression to obtain the recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET. By comparing with the control strain Ptet-Cas12a test, the promoter corresponding to the expression of RecET with the highest editing plasmid transformation efficiency and the highest large fragment knockout efficiency was determined.

[0064] Zymomonas mobilis ZMNP-Cas12a is based on Zymomonas mobilis ZM4 (ATCC31821) as the starting strain, in which the Cas12a gene and spectinomycin gene are integrated at the ZMO0038 gene locus of the genome, and the tetracycline-inducible promoter P is operably connected upstream of Cas12a. tet The recombinant strain ZM4-Cas12a was obtained by controlling the expression of nuclease. The four endogenous plasmids pZM32 (32791bp, Genbank No. CP023678), pZM33 (33006bp, Genbank No. CP023679), pZM36 (36494bp, Genbank No. CP023680) and pZM39 (39266bp, Genbank No. CP023681) of ZM4-Cas12a were further eliminated to obtain the recombinant strain ZMNP-Cas12a of Zymomonas mobilis.

[0065] 1.1. Homologous recombination plasmid pUC57-P tet -RecET and pUC57-P BAD -RecET build

[0066] In the embodiment of the present invention, the upstream homologous sequence (US) and the downstream homologous sequence (DS) of the ZMO0028 site of the ZM4 genome are amplified, and the P tet Promoter or P BAD The fusion sequence of the promoter operator and the RecET gene (P tet -RecET or P BAD -RecET) was placed between the US and DS sequences, and the fusion sequence P was synthesized by homologous recombination. tet -RecET or P BAD -RecET was integrated into the corresponding site of the genome. At the same time, in order to facilitate screening, a resistance marker screening gene, chloramphenicol Cat gene, was added. The Cat gene includes the Cat coding sequence and its psp promoter. In addition, in order to facilitate the transformation of the fusion gene sequence, P tet -RecET or P BAD -RecET and Cat gene as well as US and DS sequences are connected with the backbone sequence high copy replicon Ori (replication origin) of pUC57 vector to form a circularized homologous recombination plasmid pUC57-P tet -RecET and pUC57-P BAD -RecET, the gene and primer sequences used to construct the RecET gene homologous recombination plasmid are shown in Table 1, and the construction process is as follows:

[0067] Table 1 Gene and primer sequences used to construct homologous recombination plasmids in the present invention

[0068]

[0069]

[0070]

[0071] (1) Extracting ZM4 genome: 2 mL of overnight cultured ZM4 bacterial solution was collected and the genome was extracted using a bacterial genome extraction kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd., catalog number EE10101R30722-V2R137).

[0072] (2) The ZMO0028 US sequence (abbreviated as 0028US) ​​was amplified using the ZM4 genome as a template using the 0028US-F / R primer pair; the ZMO0028 DS sequence (abbreviated as 0028DS) was amplified using the ZM4 genome as a template using the 0028DS-F / R primer pair; the chloramphenicol gene Cat was amplified using the pEZ15A plasmid as a template using the Cat-F / R primer pair; the Ori sequence was amplified using the pUC57 plasmid as a template using the Ori-F / R primer pair; the RecET gene was amplified using the Escherichia coli MG1655 genome as a template using the RecET-F / R primer pair; and the P tet / P BAD -F and P tet -R primer pair, P tet / P BAD -F and P BAD -R primer pair, using p39-Ptet-araC-T7P-Cm plasmid as template, amplified P tet Operator (including tetR and tetA) and P BAD For the construction method of operon (including araC and araBAD), p39-Ptet-araC-T7P-Cm plasmid, please refer to patent "CN114774453A".

[0073] (3) The amplified 0028US, 0028DS, and P tet The operon, RecET and Cat gene sequences and the vector backbone Ori sequence were added to 5 μL 2×CE Mix (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number 027E4210KD3) and mixed. The concentration of each sequence was 0.03 pM, and ddH2O was added to 10 μL. The fragments were connected through a one-step Gibson assembly reaction of the clone enzyme to obtain pUC57-P tet -RecET plasmid. BAD The operon, RecET and Cat gene sequences and the vector backbone Ori sequence were connected based on the same reaction system to obtain pUC57-P BAD -RecET plasmid.

[0074] (4) The homologous recombination plasmid pUC57-P tet -RecET and pUC57-P BAD-RecET were transformed into competent E. coli DH5α cells, and positive clones were verified by LB plates containing chloramphenicol resistance. The positive clones were cultured overnight and the plasmids were extracted. The plasmid extraction was carried out according to the standard steps of the plasmid extraction kit (purchased from Daling Biotechnology, catalog number 1N7012490010213).

[0075] 1.2. Construction of recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET

[0076] Transformation of Zymomonas mobilis ZMNP-Cas12a: Take 100 μL of frozen strain of Zymomonas mobilis ZMNP-Cas12a and inoculate it into a cryovial containing 1 mL of RMG5 liquid medium. Incubate it in a 30°C incubator to activate the strain. After culturing until turbid, transfer it to a 250 mL blue-cap bottle containing 200 mL of RMG5 liquid medium to an initial OD of 600nm Incubate in a 30°C incubator until OD 600nm When it exceeds 0.3, collect the bacteria by centrifugation at 100 rpm at room temperature, then wash once with sterile water and twice with 10% glycerol, and finally slowly resuspend the bacteria with 1-2 mL of 10% glycerol to obtain the ZMNP-Cas12a competent state, and distribute 55 μL of the competent state into a 1.5 mL EP tube.

[0077] Add 500ng homologous recombination plasmid to a 1.5mL EP tube containing 55μL competent medium, mix gently and transfer to a 1mm electroporation cup. Electroporation instrument program settings: 200Ω, capacitance: 25μF, voltage: 1.6KV. Place the electroporation cup in the electroporation instrument for electroporation. Immediately after electroporation, add 1mL RMG5 liquid culture medium, mix well and transfer to a sterile EP tube, seal with sealing film and incubate in a 30℃ constant temperature incubator for 4-6h. Then take 100μL of culture and evenly spread it on an RMG5 plate containing 100μg / mL chloramphenicol (Cm resistance), invert and culture in a 30℃ incubator, and culture at 30℃ for 2 days.

[0078] Single colonies were selected for colony PCR verification. The primer pair for verification of the recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET was RecET-YZ-F / R. The colony PCR system (10 μL) included: RecET-YZ-F (10 μM) 0.4 μL, RecET-YZ-R (10 μM) 0.4 μL, 2×T5 Super PCR Mix (Tsingke) 5 μL, Template (single colony dissolved in 10 μL ddH2O) and ddH2O 3.2 μL; the colony PCR program was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 55°C annealing for 10 s, 72°C extension for 70 s, 29 cycles; 72°C extension for 3 min, 16°C hold. The positive clones verified by colony PCR were further sequenced and verified to obtain P tet -recET and P BAD The -recET expression cassette was integrated into the genomic ZMO0028 site of the target strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET.

[0079] 1.3. Detection of gene editing efficiency of recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET

[0080] The editing plasmid pKO-ZMO0252 (~9 kb) with ZMO0252 knockout was transferred into the Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET strains and the control strain Pt-Cas12a, respectively. Figure 3 Figure A in the middle), compare and determine the editing plasmid transformation efficiency and large fragment gene editing efficiency of each strain. The pKO-ZMO0252 plasmid contains gRNA targeting the ZMO0252 gene and upstream and downstream homologous sequences of the ZMO0252 gene. The gRNA is used to guide the nuclease Cas12a to cut the target site. The upstream and downstream homologous sequences of ZMO0252 are used as donor DNA to perform homologous recombination with the upstream and downstream of the ZMO0252 gene in the cell genome to achieve the deletion of ZMO0252. The preparation method is described in detail in the subsequent section.

[0081] The transformation efficiency of the edited plasmid is defined as: the number of colonies on the Kana-resistant RMG2 plate after the edited plasmid is transferred into the recombinant strain / the number of colonies on the Kana-resistant RMG2 plate after the empty plasmid pEZ15A is transferred into the recombinant strain; the determination method includes: adding 200ng of the edited plasmid and the empty plasmid to a 1.5mL EP tube containing 55μL of competent medium, mixing gently and transferring to a 1mm electroporation cup. The electroporation instrument program settings: 200Ω, capacitance: 25μF, voltage: 1.6KV. The electroporation cup is placed in the electroporation instrument for electroporation. After electroporation, 1mL of RMG5 liquid culture medium is immediately added, mixed and transferred to a sterile EP tube, sealed with a sealing film and incubated in a constant temperature incubator at 30℃ for 4h. Take 100μL of bacterial solution respectively and evenly spread it on the RMG2+Kana plate (300μg mL -1 The plate was sealed with sealing film and placed upside down in a 30°C incubator. After two days of incubation, the colonies on the plate were counted.

[0082] The large-fragment editing efficiency is defined as: the number of colonies with successful ZMO0252 knockout verified by PCR / the total number of colonies verified by PCR; the determination method includes: randomly selecting a single colony of the recombinant strain transformed with the editing plasmid on the above-mentioned RMG2+Kana plate, and using the 0252-check-F / R primer pair to amplify the ZMO0252 gene. The colony PCR system and PCR procedure are the same as above. If a band of about 1 kb is detected, it proves that the gene has been knocked out.

[0083] Figure 3 The results of large-fragment gene knockout efficiency detection in the recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET are shown, wherein Figure A is a schematic diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252, Figure B is a transformation efficiency (Ratio of transformer numbers) diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252, on-target represents the number of colonies on the Kana resistance RMG2 plate after the editing plasmid is transferred into the recombinant strain, off-target represents the number of colonies on the Kana resistance RMG2 plate after the empty plasmid pEZ15A is transferred into the recombinant strain, and Figure C is a large-fragment editing efficiency diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252. The results showed that the transformation efficiency of the editing plasmid of the control strain ZNMP-Cas12a (Pt-Cas12a) was 0.01±0.01%, and the transformation efficiencies of the recombinant strains Pt-cas12a_Pt-recET and Pt-cas12a_PB-recET were 0.36±0.07% and 0.13±0.03%, respectively, indicating that the introduction of the RecET system can improve the transformation efficiency of the editing plasmid, and P tetThe promoter-driven RecET expression level is more conducive to improving the efficiency of editing plasmid transformation. The knockout efficiency of ZMO0252 in Pt-cas12a_Pt-recET was 53.33±4.71%, and the knockout efficiency of ZMO0252 in Pt-cas12a_PB-recET was 45.83±5.89%, while the knockout efficiency of ZMO0252 in the control strain Pt-Cas12a was 27.08±2.95%, indicating that the introduction of the RecET system can improve the knockout efficiency of large fragment genes, P tet The promoter-driven RecET expression level is more conducive to improving the efficiency of large-fragment gene knockout.

[0084] 2. Optimization of the Cas12a promoter in Zymomonas mobilis

[0085] Although the introduction of the RecET system improved the transformation efficiency of the editing plasmid and the efficiency of large-fragment gene editing, the knockout efficiency of the ZMO0252 gene was still less than 60%, which may be due to the P tet The Cas12a promoter driven by the gene is too high to be toxic to cells. Therefore, the Cas12a promoter was replaced with a more rigorous inducible promoter P BAD . The homologous recombination plasmid pUC57-P was transferred into the Pt-Cas12a strain. BAD -Cas12a, and obtained the recombinant strain PB-Cas12a by homologous recombination.

[0086] pUC57-P BAD The construction process of -Cas12a is as follows: primers with homology to pUC57-Ori and spectinomycin gene Spe were designed, and the ZM4 genome was used as a template to amplify the ZMO0038 US sequence (abbreviated as 0038US) through the 0038US-F / R primer pair, and the ZMO0038 DS sequence (abbreviated as 0038DS) through the 0038DS-F / R primer pair; the spectinomycin gene Spe was amplified through the Spe-F / R primer pair using the pEZ15A plasmid as a template; the Ori sequence was amplified through the Ori-F / R primer pair using the pUC57 plasmid as a template; BAD -F1 / R1 primer pair, with P BAD The p39-Ptet-araC-T7P-Cm plasmid with a promoter was used as a template. The plasmid construction method is described in patent "CN114774453A". BAD Operator (including araC and araBAD); Cas12a gene was amplified using primer pair Cas12a-F / R and strain ZM4-Cas12a genome as template. The amplified 0038US, 0038DS, P BADThe operon, Cas12a gene, Spe gene sequence and vector backbone Ori sequence were added to 5 μL 2×CE Mix, and the concentration of each sequence was 0.03 pM. The concentration was supplemented to 10 μL with ddH2O, and the fragments were connected by Gibson assembly to obtain pUC57-P BAD -Cas12a plasmid, the vector map is shown in Figure 4 The aforementioned primer sequences are shown in Table 1.

[0087] Homologous recombination plasmid pUC57-P BAD -Cas12a was transformed into competent Escherichia coli DH5α cells, and the positive clones were verified by LB plates containing Spe resistance and colony PCR. The primer pair was verified to be Cas12a-YZ-F / R. The positive clones were cultured overnight and the plasmids were extracted and transformed into Zymomonas mobilis ZMNP-Cas12a to obtain the recombinant strain PB-Cas12a.

[0088] The editing plasmid pKO-ZMO0252 was transferred into the recombinant strain PB-Cas12a to determine the editing plasmid transformation efficiency and large-fragment gene editing efficiency of the recombinant strain PB-Cas12a. Figure 5 The results of the large-fragment gene knockout efficiency test in the recombinant strain PB-Cas12a are shown, wherein Figure A is a schematic diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252, Figure B is a transformation efficiency diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252, and Figure C is a large-fragment editing efficiency diagram of the recombinant strain transformation editing plasmid pKO-ZMO0252. The results show that the transformation efficiency of the control strain Pt-Cas12a is almost 0, and the transformation efficiency of the recombinant strain PB-cas12a is 12.37±0.36%, indicating that reducing the expression of Cas12a can improve the transformation efficiency of the editing plasmid, P BAD The promoter-driven Cas12a expression level is more conducive to improving the efficiency of editing plasmid transformation. The knockout efficiency of ZMO0252 in PB-cas12a was 91.55±4.05%, while the knockout efficiency of ZMO0252 by the control strain Pt-Cas12a was 27.00±2.83%. The large-fragment gene editing efficiency of the PB-cas12a strain was 3 times higher than that of the Pt-Cas12a strain, indicating that the expression level of Cas12a is crucial for large-fragment gene knockout. BAD The promoter-driven Cas12a expression level is more conducive to improving the efficiency of large-fragment gene knockout.

[0089] 3. Construction of Zymomonas mobilis PB-cas12a_Pt-recET

[0090] A series of recombinant strains with different expression levels of Cas12a and RecET were constructed, including single-system expression strains Pt-cas12a, PB-cas12a, and Pt-recET, and dual-system expression strains Pt-cas12a_Pt-recET, Pt-cas12a_PB-recET, and PB-cas12a_Pt-recET. The recombinant strain Pt-recET was transformed with pUC57-P using Zymozymomonas ZMNP as the host. tet -RecET obtained, verified by RecET-YZ-F / R primer pair and sequencing P tet -recET expression cassette was integrated into the ZMO0028 site of the ZMNP genome. The recombinant strain PB-cas12a_Pt-recET was transformed into pUC57-P using Pt-cas12a_Pt-recET as the host. BAD -Cas12a, or use PB-cas12a as the host and transform pUC57-P tet -RecET was obtained and will not be described in detail here.

[0091] pKO-ZMO0252 was electroporated into each recombinant strain, 16 positive colonies were randomly selected, and the knockout efficiency of the ZMO0252 gene in different strains was verified by colony PCR using the 0252-check-F / R primer pair. Figure 6 As shown, Figure A is a colony PCR amplification result diagram of each recombinant strain transformation editing plasmid pKO-ZMO0252, lane M represents a molecular marker, lane - represents PCR amplification using the ZMNP genome as a template, lanes 1-16 represent 16 positive colonies, and Figure B is a large fragment editing efficiency diagram of each recombinant strain transformation editing plasmid pKO-ZMO0252. The results show that the knockout efficiency of ZMO0252 in Pt-cas12a, PB-cas12a, Pt-recET, Pt-cas12a_Pt-recET, Pt-cas12a_PB-recET, and PB-cas12a_Pt-recET are 4 / 16, 13 / 16, 2 / 16, 8 / 16, 6 / 16, and 15 / 16, respectively, among which the large fragment knockout efficiency of PB-cas12a_Pt-recET is the highest, about 98.53±2.07%.

[0092] 4. Test of knockout / insertion efficiency of large DNA fragments of different lengths by Zymomonas mobilis PB-cas12a_Pt-recET

[0093] In order to determine the knockout efficiency of PB-cas12a_Pt-recET on large DNA fragments of different lengths, PB-cas12a was used as the control strain, the ZMO0252-ZMO0269 gene range was selected, and the editing plasmids pKO-ZMO0252, pKO-ZMO0252_0254, pKO-ZMO0252_0256, pKO-ZMO0252_0262, and pKO -ZMO0252_0266, pKO-ZMO0252_0269, respectively, ZMO0252 (9kb), ZMO0252_0254 (13kb), ZMO0252_0256 (16kb), ZMO0252_0262 (20kb), ZMO0252_0266 (25kb), ZMO0252_0269 (30kb) were tested for knockout efficiency. The PB-cas12a_Pt-recET strain was further used to knock out the transport / secretion protein gene clusters ZMO1455-1466 (14kb) and ZMO0793-0803 (15kb), and the editing plasmids pEZKO-1455_1466 and pEZKO-0793_0803 were constructed. In addition, in order to test the knock-in efficiency of large fragments in PB-cas12a_Pt-recET, the 2,3-butanediol metabolic pathway Ptet-als Pgap-aldC_bdh was selected to knock into the genome ZMO1650 position to construct the editing plasmid pEZTH-2,3-BDO-1650 targeting ZMO1650.

[0094] The embodiment of the present invention adopts the genome editing method of Zymomonas mobilis based on the CRISPR-Cas12a system in patent CN110358767A. The editing plasmid uses pEZ15a as the vector backbone (kanamycin (Cm) resistance), and the constitutive promoter PJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC), a 19nt repeat sequence (AATTTCTACTCTTGTAGAT) and two BsaⅠ restriction sites (GGAGACCGAGGTCTCA) are connected in series and assembled into the pEZ15a vector. The guide RNA sequence is inserted between the two BsaⅠ restriction sites to form a guide RNA expression unit to guide the cutting of the target site by the nuclease Cas12a. The guide RNA is obtained by annealing a guide RNA primer pair with a BsaⅠ restriction site upstream. The upstream primer structure is 5′-AGAT+(target sequence)-3′, and the downstream primer structure is 5′-TGAC+(target sequence complementary sequence)-3′. The annealed primer pair is connected to the pEZ15a vector after BsaⅠ restriction digestion to obtain an editing plasmid containing a CRISPR expression unit. The editing plasmid also includes donor DNA, which serves as a template for homologous recombination repair to edit the guide RNA targeting sequence. The specific construction method of the relevant editing plasmid is as follows:

[0095] (1) Primer design: The 23 bp downstream of the TTTN sequence at the PAM site in the ZMO0252-0269 gene cluster, ZMO1455-1466 gene cluster, ZMO0793-0803 gene cluster, and ZMO1650 was selected as the target sequence of the guide RNA in the construction of the target plasmid to guide the nuclease to cut the target site. The guide RNA primer pair for the ZMO0252, ZMO0252-0254, and ZMO0252-0256 knockout plasmids was 0252-gR-F / R, and the guide RNA primer pair for the ZMO0252-0262 knockout plasmid was 0252-gR-F / R. The guide RNA primer pair is 0254-gR-F / R, the guide RNA primer pair for the ZMO0252-0266 and ZMO0252-0269 knockout plasmids is 0256-gR-F / R, the guide RNA primer pair for the ZMO1455-1466 knockout plasmid is 1455-1466-gR-F / R, the guide RNA primer pair for the ZMO0793-0803 knockout plasmid is 0793-0803-gR-F / R, and the guide RNA primer pair for the ZMO1650 replacement plasmid is 1650-gR-F / R.

[0096] (2) Guide RNA ligation vector: First, the vector was linearized using restriction endonuclease Bsa I, and then the guide RNA primer pair was annealed (1 μL of each 10 μM primer was added with water to 10 μL, denatured at 95°C for 5 min, and then cooled to room temperature for use). The annealed product was ligated to the linearized vector using T4 DNA ligase. The ligation system was calculated in 50 μL and included: 2 μL of annealed oligonucleotide, 2 μg of linearized vector, 0.5 μL of T4 DNA ligase, 5 μL of T4 ligase buffer, ddH2O to 50 μL, and enzyme ligation at 22°C for 3 hours. Then, the ligation product was transferred into the Escherichia coli cloning strain DH5α for plasmid construction by conventional methods, and the recombinants were screened by colony PCR and finally verified by sequencing.

[0097] (3) Donor DNA ligation vector: Use primers PEZ-FK-F / R to reversely amplify the T4 The vector was connected by DNA ligase, and the homology arms of about 700bp upstream and downstream of the ZMO0252-0269, ZMO1455-1466, ZMO0793-0803, and ZMO1650 gene clusters were amplified from the ZM4 genome using primer pairs, wherein the primer pairs for amplifying the upstream and downstream homology arms of ZMO0252 were 0252-US-F / R and 0252-DS-F / R, the primer pairs for amplifying the upstream homology arms of ZMO0252-0254, ZMO0252-0256, ZMO0252-0262, ZMO0252-0266, and ZMO0252-0269 were 0252-US-F / R, and the primer pairs for amplifying the downstream homology arms were 0254-DS-F / R, 0256-DS-F / R, and 0262-DS-F / R, respectively. -F / R, 0266-DS-F / R and 0269-DS-F / R, the upstream and downstream homology arm amplification primer pairs of ZMO1455-1466 are 1455-1466-US-F / R and 1455-1466-DS-F / R, the upstream and downstream homology arm amplification primer pairs of ZMO0793-0803 are 0793-0803-US-F / R and 0793-0803-DS-F / R, and the upstream and downstream homology arm amplification primer pairs of 2,3-BDO synthesis pathway knock-in ZMO1650 are 1650-US-F / R and 1650-DS-F / R; the 2,3-BDO synthesis pathway genes were amplified from the first edited plasmid pl2r-1650-BDO of patent "CN117778291A" using the BDO-F / R primer pair. The fragments were connected by Gibson assembly, transformed into competent E. coli DH5α cells, PCR verified positive clones, and the editing plasmid was extracted after overnight culture.

[0098] The upstream primer used to verify the ZMO0252-0269 gene cluster is 0252-check-F, the downstream primers are 0252-check-R, 0254-check-R, 0256-check-R, 0262-check-R, 0266-check-R and 0269-check-R, the primer pair for knockout verification of the ZMO1455-1466 gene cluster is 1455-1466-check-F / R, the primer pair for knockout verification of the ZMO0793-0803 gene cluster is 0793-0803-check-F / R, and the primer pair for knocking in the 2,3-BDO synthesis pathway into ZMO1650 is BDO-in-F / R. The primer sequences mentioned above are shown in Table 2.

[0099] Table 2 Guide RNA and donor DNA amplification primers used to construct editing plasmids in this example

[0100]

[0101]

[0102]

[0103] Figure 7 The knockout of the ZMO0252-0269 gene cluster by PB-cas12a and PB-cas12a_Pt-recET strains is shown, wherein Figure A is a schematic diagram of the knockout principle of the ZMO0252-0269 gene cluster, Figure B is the accuracy of the knockout sequence verified by Sanger sequencing, and Figure C is an editing efficiency diagram of different fragment lengths of the ZMO0252-0269 gene cluster. Figure 8 The knockout results of the recombinant strain PB-cas12a_Pt-recET for different fragment lengths of the ZMO0252-0269 gene cluster are shown, lane M represents the molecular marker, and lanes 1-16 represent 16 positive colonies. The results show that the knockout efficiency of the large fragment gene of 9-16kb in PB-cas12a_Pt-recET is about 100%, the knockout efficiency of 20-25kb is about 80%, and the knockout efficiency of 30kb is about 5%; while the knockout efficiency of the large fragment gene of 9-16kb in the control strain PB-cas12a is about 60-80%, the knockout efficiency of 20kb is about 5%, and the knockout efficiency of 25kb and 30kb is almost 0.

[0104] PB-cas12a_Pt-recET was further used to knock out the transport / secretion protein gene clusters ZMO1455-1466 (14 kb) and ZMO0793-0803 (15 kb), and colony PCR was used to verify the knockout efficiency. Fig. 9, wherein Figure A shows the knockout efficiency of ZMO1455-1466 and ZMO0793-0803 gene clusters, and Figures BC show the colony PCR amplification results of ZMO1455-1466 and ZMO0793-0803 gene clusters, respectively. The results show that the knockout efficiency of the two gene clusters exceeds 95%.

[0105] In order to test the knock-in efficiency of large fragments in PB-cas12a_Pt-recET, the 2,3-butanediol metabolic pathway Ptet-als Pgap-aldC_bdh was selected to knock into the genome ZMO1650 position (see Fig.10 The editing plasmid pEZTH-2,3-BDO-1650 targeting ZMO1650 was constructed and transformed into PB-cas12a_Pt-recET and the control strain PB-cas12a. Colony PCR was used to verify the knock-in efficiency. The results are shown in Fig.10 Figures B and C. The results showed that the knock-in efficiency of the 2,3-butanediol pathway gene cluster in PB-cas12a_Pt-recET was about 56.25%, and the knock-in efficiency of the 2,3-butanediol pathway gene cluster in the control strain was about 37.50%, indicating that the application of CRISPR-Cas12a combined with the RecET system is beneficial to improve the insertion efficiency of large genomic genes.

[0106] 5. Method for eliminating the editing plasmid in Zymomonas mobilis PB-cas12a_Pt-recET

[0107] The PB-cas12a_Pt-recET strain was inoculated in RMG5 liquid medium without resistance. After it grew to turbidity, 100 μL of bacterial solution was transferred to 1 mL of fresh RMG5 liquid medium. After 4-5 generations of continuous passage, 100 μL of bacterial solution was diluted and applied to the RMG5 plate. After a single colony grows on the plate, the single colony is verified by PCR using primers for verifying the edited plasmid. If there is no band in the PCR, the edited plasmid may be lost. The single colony with no band in the colony PCR was inoculated in RMG5 liquid medium and RMG5+Cm liquid medium respectively, and placed in static culture at 30°C. The culture results under the two culture media were observed the next day. If it can grow and become turbid in the RMG5 liquid medium, but cannot grow in the RMG5+Cm liquid medium and is clear, it can be confirmed that the edited plasmid has been eliminated.

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A Zymomonas mobilis chassis cell, characterized in that The chassis cell uses ZMNP-Cas12a, a ZMO0038 site of the genome, as the starting strain, and the RecET gene is integrated into the ZMO0028 site of the ZMNP-Cas12a genome, and the upstream of the RecET gene is connected to P tet Promoter, the Cas12a gene upstream is connected to P BAD Promoter.

2. The Zymomonas mobilis chassis cell according to claim 1, characterized in that The nucleotide sequence of the Cas12a gene is shown in SEQ ID NO.1, the nucleotide sequence of the RecET gene is shown in SEQ ID NO.2, and the P tet The nucleotide sequence of the promoter is shown in SEQ ID NO.

3. BAD The nucleotide sequence of the promoter is shown in SEQ ID NO.

4.

3. The method for constructing the chassis cells of Zymomonas mobilis according to any one of claims 1 to 2, characterized in that: The following steps are involved: Obtain the upstream homology arm 0038US and downstream homology arm 0038DS sequences of the genomic ZMO0038 site, and convert P BAD The promoter and Cas12a gene were connected in series between the 0038US and 0038DS sequences to construct the first homologous recombination plasmid; Obtain the upstream homology arm 0028US and downstream homology arm 0028DS of the genomic ZMO0028 site, and convert P tet The promoter and RecET gene were connected in series between the 0028US and 0028DS sequences to construct a second homologous recombination plasmid; The first homologous recombination plasmid and the second homologous recombination plasmid were transformed into Zymomonas mobilis ZMNP-Cas12a respectively, and P BAD The promoter and Cas12a gene were integrated into the ZMO0038 site and the P tet The promoter and RecET gene were integrated into the ZMO0028 locus, and Zymomonas mobilis chassis cells were screened.

4. The method for constructing chassis cells of Zymomonas mobilis according to claim 3, characterized in that: The first homologous recombination plasmid and the second homologous recombination plasmid carry different resistance marker genes.

5. The method for constructing chassis cells of Zymomonas mobilis according to claim 3, characterized in that: The first homologous recombination plasmid and the second homologous recombination plasmid further include an Ori sequence, and the Ori sequence is derived from a pUC57 vector.

6. The method for constructing chassis cells of Zymomonas mobilis according to claim 3, characterized in that: The construction of the first homologous recombination plasmid includes the following steps: obtaining the upstream homology arm 0038US and the downstream homology arm 0038DS sequence of the ZMO0038 site by PCR amplification, and obtaining the P BAD promoter, RecET gene, spectinomycin gene and Ori sequence of pUC57 vector, and the amplified 0038US sequence, RecET gene, P BAD The promoter, spectinomycin gene and 0038DS sequence were sequentially connected with the Ori sequence by Gibson assembly to obtain a second homologous recombination plasmid; The construction of the second homologous recombination plasmid includes the following steps: obtaining the upstream homology arm 0028US and the downstream homology arm 0028DS sequence of the ZMO0028 site by PCR amplification, and obtaining the P tet promoter, RecET gene, chloramphenicol gene and Ori sequence of pUC57 vector, and the amplified 0028US sequence, RecET gene, P tet The promoter, chloramphenicol gene and 0028DS sequence were sequentially connected with the Ori sequence by Gibson assembly to obtain a second homologous recombination plasmid; Among them, the nucleotide sequence of the 0038US sequence amplification primer pair is shown in SEQ ID NO.20-21, the nucleotide sequence of the 0038DS sequence amplification primer pair is shown in SEQ ID NO.22-23, the nucleotide sequence of the 0028US sequence amplification primer pair is shown in SEQ ID NO.10-11, the nucleotide sequence of the 0028DS sequence amplification primer pair is shown in SEQ ID NO.12-13, the nucleotide sequence of the Cas12a gene amplification primer pair is shown in SEQ ID NO.18-19, the nucleotide sequence of the RecET gene amplification primer pair is shown in SEQ ID NO.5-6, P BAD The nucleotide sequences of the promoter amplification primer pairs are shown in SEQ ID NOs. 7 and 9. tet The nucleotide sequence of the promoter amplification primer pair is shown in SEQ ID NOs.7-8, the nucleotide sequence of the spectinomycin gene amplification primer pair is shown in SEQ ID NOs.24-25, the nucleotide sequence of the chloramphenicol gene amplification primer pair is shown in SEQ ID NOs.14-15, and the nucleotide sequence of the Ori sequence amplification primer pair is shown in SEQ ID NOs.16-17.

7. Use of the Zymomonas mobilis chassis cells as described in any one of claims 1-2 in large-fragment gene editing.

8. The use of the Zymomonas mobilis chassis cells in large-fragment gene editing according to claim 7, characterized in that: The sequence length of the gene ranges from 9 to 30 kb, and the gene editing is gene knockout, gene replacement and / or point mutation.

9. The use of the Zymomonas mobilis chassis cells according to claim 8 in large-fragment gene editing, characterized in that: The sequence length of the gene ranges from 9 to 25 kb.

10. A method for gene editing of chassis cells of Zymomonas mobilis, characterized in that: The following steps are involved: Design guide RNA and donor DNA according to the target sequence to be edited, wherein the donor DNA includes upstream homology arm and downstream homology arm sequences of the guide RNA target sequence, connect the guide RNA and donor DNA to the expression vector to obtain an editing plasmid, The editing plasmid is transformed into the Zymomonas mobilis chassis cells as described in any one of claims 1-2, and the positive chassis cells transformed with the editing plasmid are cultured.

Images