Culture system for generating alveolar organs with alveolar vesicle form based on adult lung stem cells and application of culture system

Abstract

The invention discloses a culture system for generating a pulmonary alveolar organ with an alveolar vesicle form based on adult lung stem cells and application of the culture system. Belongs to the technical field of lung organ three-dimensional culture. By utilizing the culture system, the adult lung stem cells can be efficiently and stably induced to be differentiated to generate the pulmonary alveolar organ with a near-physiological state pulmonary alveolar sac structure. Compared with a Matrigel system dependent on pulmonary alveolar organ induction culture in the prior art, the culture system established by the invention has the following outstanding advantages: 1) the generated pulmonary alveolar organ has a near-physiological state pulmonary alveolar sac structure and also contains a functional pulmonary alveolar epithelial cell system; 2) the proliferation and differentiation speed of the adult lung stem cells in the culture system is high, the generation period of the alveolar organs is short and only needs 2-3 weeks, and the generation period of the alveolar organs based on a Matrigel system needs 4-12 weeks; and 3) the culture system is clear in composition, low in price and cost and simple in preparation method.

Description

Technical Field

[0001] The present invention relates to the technical field of three-dimensional culture of lung organoids, and more specifically to a culture system and application of alveolar organoids having alveolar sac morphology generated based on adult lung stem cells. Background Art

[0002] In the respiratory system, the lung is an important organ for gas exchange and host defense in higher animals. With the intensification of environmental pollution and population aging, and the emergence and spread of new influenza viruses, respiratory diseases have become the main cause of death worldwide. Acute and chronic damage to lung epithelial cells can induce severe respiratory diseases and lead to death, such as chronic obstructive pulmonary disease or idiopathic pulmonary fibrosis. At present, many issues related to the pathogenic mechanisms of lung diseases remain to be elucidated. As "artificial organs" cultured in vitro, organoids have increasingly prominent advantages in studying organ development, complex pathological pathogenic mechanisms, drug screening, and pharmacological toxicity. Lung organoids have also become a good model for the development of the respiratory system, the pathogenesis of respiratory diseases, and drug screening. Alveoli are an important part of distal lung tissue and the main place where blood oxygen exchange occurs. In the late stage of pulmonary fibrosis, the loss of alveolar function leads to the patient's final death by suffocation. At present, there is still no effective treatment except lung transplantation. It is of great medical value to develop alveolar organoids close to the physiological homeostasis in vivo, study pulmonary fibrosis and its pathogenic mechanism, and screen drugs for improving pulmonary fibrosis.

[0003] The research on alveolar organoids is still in its infancy. Organoids are mainly derived from the induced differentiation of iPSCs and the generation of adult stem cells, and must rely on the Matrigel system. The generated organoids are small in size and have a single spherical morphology. They cannot effectively simulate the development process and steady-state environment of the alveolar system in vivo. There are few reports on the generation of alveolar organoids from adult lung stem cells. Given that Matrigel is derived from tumor tissue extracts, the specific composition is unclear, the batch product varies greatly, and the price is expensive, the use of this system for the induction and culture of alveolar organoids is not only costly, but also has the important problem of batch instability.

[0004] In summary, how to establish a culture system with clear components and capable of efficiently and stably culturing functional alveolar organoids is an urgent problem that technical personnel in this field need to solve. Summary of the invention

[0005] In view of this, the present invention provides a culture system and application for generating alveolar organoids with alveolar sac morphology based on adult lung stem cells. The culture system of the present invention has clear components, low price and cost, and a simple preparation method. More importantly, it can efficiently induce the formation of alveolar organoids with functional alveolar sac structures in a short period of time. The organoids not only have a morphological structure similar to the alveolar sac structure composed of multiple alveoli in the body, but also contain functional alveolar epithelial cells, which provides a preferred solution for inducing functional alveolar organoids based on adult lung stem cells. It is of great significance to promote the research on the pathogenic mechanism of alveolar respiratory diseases, the regulation of alveolar development in the respiratory system, influenza virus infection, clinical drug screening and toxicity testing, and the construction of functional alveolar organoids.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A culture system for generating alveolar organoids with alveolar sac morphology based on adult lung stem cells, including an alveolar organoid hydrogel system;

[0008] The alveolar organoid hydrogel system uses DMEM / F12 as solvent and includes the following components at final concentrations:

[0009] Type I rat tail collagen 1.5-2.5 mg / mL, gelatin 10-100 mg / mL, hyaluronic acid 5-50 μg / mL, chondroitin sulfate 50-200 μg / mL, low melting point agarose 5-20 mg / mL, elastin 20-100 μg / mL, epidermal growth factor 25-100 ng / mL, fibroblast growth factor 25-100 ng / mL and transglutaminase 15 U / mL.

[0010] Furthermore, the alveolar organoid hydrogel system uses DMEM / F12 as a solvent and includes the following components at final concentrations:

[0011] Type I rat tail collagen 2 mg / mL, gelatin 50 mg / mL, hyaluronic acid 25 μg / mL, chondroitin sulfate 100 μg / mL, low melting point agarose 10 mg / mL, elastin 50 μg / mL, epidermal growth factor 50 ng / mL, fibroblast growth factor 50 ng / mL and transglutaminase 15 U / mL.

[0012] Furthermore, the alveolar organoid hydrogel system also includes 1M NaOH.

[0013] Further, it also includes alveolar organoid induction medium;

[0014] The alveolar organoid induction medium uses DMEM / F12 as a solvent and includes the following components at final concentrations:

[0015] 1×B27 supplement, 1×N2 supplement, 0.1% BSA, glutamine 2mM, CHIR-9902110μM, SB43154210μM, rh-KGF 10ng / mL, IBMX 0.1mM, 8-Br-cAMP 0.1mM, dexamethasone 50nM, FGF1020ng / ml, TGFb 20ng / ml, EGF 20ng / ml, OSM protein 20ng / ml, TNFa 10ng / ml and IL-1b10ng / ml.

[0016] A method for culturing alveolar organoids, using the above-mentioned culture system.

[0017] Further, the specific steps are as follows:

[0018] (1) Preparation and collection of adult lung stem cells;

[0019] (2) resuspending adult lung stem cells in DMEM / F12 basal medium containing Y-27632, and then diluting to obtain a cell suspension;

[0020] (3) Mix the cell suspension with the alveolar organoid hydrogel system, then cross-link with 1 M NaOH and place in a cell culture incubator for culture;

[0021] (4) Add alveolar organoid induction medium for culture and replace with fresh medium every three days.

[0022] The application of the above-mentioned culture system in the preparation of alveolar organoids with alveolar sac structure.

[0023] An alveolar organoid is obtained by culturing using the above-mentioned culture system or the above-mentioned method.

[0024] The above-mentioned application of alveolar organoids for non-diagnostic and therapeutic purposes is any one of the following:

[0025] A: In vitro study of the regulatory mechanisms, physiological homeostasis and function of alveolar development;

[0026] B: In vitro study of the pathological characteristics of alveoli and the pathogenic mechanisms of alveolar structural dysfunction or loss;

[0027] C: Establish disease models related to the alveolar system to study the corresponding pathogenic mechanisms and drug action mechanisms;

[0028] D: Develop and screen drugs targeting alveolar structural dysfunction or loss, and evaluate their pharmacological efficacy;

[0029] E: Testing the toxicity of inhaled substances or the effectiveness of inhaled drugs;

[0030] F: Studying the infection of respiratory viruses on alveolar epithelial cells provides experimental evidence for medical protection.

[0031] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0032] The present invention discloses a culture system that can generate functional alveolar organoids with alveolar sac structures. The culture system of the present invention can efficiently and stably culture functional alveolar organoids with alveolar sac structures based on mouse adult lung stem cells. Compared with the Matrigel culture system relied on internationally, the alveolar organoid culture system we established has the following significant advantages: 1) clear composition, low price and cost, and simple preparation method; 2) adult lung stem cells proliferate and differentiate more efficiently in the culture system, and the cycle of organoid induction generation is short; 3) the generated alveolar organoids have an alveolar sac structure similar to that of in vivo tissues and contain functional alveolar epithelial cells at the same time, which provides a more preferred solution for the culture of alveolar organoids. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0034] Figure 1 This is a morphological diagram of the alveolar organoids on the 14th day of induction culture in Example 5 of the present invention. From left to right, the alveolar organoid hydrogel systems prepared in Example 1, Example 2, and Example 3 are used, and the scale is 200 μm;

[0035] Figure 2 This is a morphological diagram of the alveolar organoids on the 28th day of induction culture in Example 5 of the present invention. From left to right, the alveolar organoid hydrogel systems prepared in Example 1, Example 2, and Example 3 are used in sequence, and the scale is 500 μm;

[0036] Figure 3 This is a graph showing the fluorescent labeling results of alveolar organoid type I pneumocytes (PDPN) and type II pneumocytes (SFTPC) on day 14 of induction culture of adult lung stem cells using the alveolar organoid hydrogel system prepared in Example 2 in Example 6 of the present invention, with a scale of 100 μm;

[0037] Figure 4This is a graph showing the fluorescent labeling results of alveolar organoid type I pneumocytes (PDPN) and type II pneumocytes (SFTPC) on day 28 of induction culture of adult lung stem cells in Example 6 of the present invention using the alveolar organoid hydrogel system prepared in Example 2, with a scale of 100 μm;

[0038] Figure 5 The electron microscopic results of the formation of lamellar body structures lbl by type II alveolar cells of alveolar organoids on day 28 of induction culture of adult lung stem cells in Example 6 of the present invention using the alveolar organoid hydrogel system prepared in Example 2 are as follows from left to right: the distribution of lamellar body structures lbl formed by type II alveolar cells in alveolar organoids; the enlarged lamellar body structure lbl in the left figure; the distribution of alveolar epithelial microvilli;

[0039] Figure 6 The results of identification of adult alveolar epithelial cell marker genes highly expressed in alveolar organoids after qPCR identification of alveolar organoids on the 14th day of induction culture of adult lung stem cells using the alveolar organoid hydrogel system prepared in Example 2 in Example 7 of the present invention, wherein LSC represents adult lung stem cells, Lung represents adult lung tissue, and Alveolar-organoid represents alveolar organoids prepared using the alveolar organoid hydrogel system of Example 2 of the present invention;

[0040] Figure 7 These are the morphological images and fluorescence identification images of alveolar organoids on the 35th day of induction culture of adult lung stem cells using the Matrigel system in Comparative Example 1 of the present invention, wherein a is the bright field and fluorescence images of the alveolar organoids, and b is the immunofluorescence identification of type I alveolar cells (PDPN) and type II alveolar cells (SFTPC) in the alveolar organoids, and the scale is 50 μm. DETAILED DESCRIPTION

[0041] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0042] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0043] Example 1

[0044] Preparation of alveolar organoid hydrogel system

[0045] Using DMEM / F12 as solvent, prepare a culture medium containing the following final concentrations:

[0046] Type I rat tail collagen 1.5 mg / mL, gelatin 10 mg / mL, hyaluronic acid 5 μg / mL, chondroitin sulfate 50 μg / mL, low melting point agarose 5 mg / mL, elastin 20 μg / mL, epidermal growth factor 25 ng / mL, fibroblast growth factor 25 ng / mL and transglutaminase 15 U / mL.

[0047] Also included: 1 M NaOH as a cross-linking agent, with a volume of 0.023 times the volume of type I rat tail collagen.

[0048] The preparation method is as follows:

[0049] (1) Dissolving type I rat tail collagen, gelatin, hyaluronic acid, chondroitin sulfate, low melting point agarose, elastin, epidermal growth factor, fibroblast growth factor, and transglutaminase in DMEM / F12 to prepare a stock solution;

[0050] (2) Add the mother solutions of step (1) to DMEM / F12 according to the final concentrations of the substances in the hydrogel system, and finally add 0.023 times the volume of type I rat tail collagen 1M NaOH as a cross-linking agent for cross-linking, so that the pH value of the hydrogel system is 7.2.

[0051] Example 2

[0052] Preparation of alveolar organoid hydrogel system

[0053] Using DMEM / F12 as solvent, prepare a culture medium containing the following final concentrations:

[0054] Type I rat tail collagen 2 mg / mL, gelatin 50 mg / mL, hyaluronic acid 25 μg / mL, chondroitin sulfate 100 μg / mL, low melting point agarose 10 mg / mL, elastin 50 μg / mL, epidermal growth factor 50 ng / mL, fibroblast growth factor 50 ng / mL and transglutaminase 15 U / mL.

[0055] Also included: 1 M NaOH as a cross-linking agent, with a volume of 0.023 times the volume of type I rat tail collagen.

[0056] The preparation method is the same as that of Example 1.

[0057] Example 3

[0058] Preparation of alveolar organoid hydrogel system

[0059] Using DMEM / F12 as solvent, prepare a culture medium containing the following final concentrations:

[0060] Type I rat tail collagen 2.5 mg / mL, gelatin 100 mg / mL, hyaluronic acid 50 μg / mL, chondroitin sulfate 200 μg / mL, low melting point agarose 20 mg / mL, elastin 100 μg / mL, epidermal growth factor 100 ng / mL, fibroblast growth factor 100 ng / mL and transglutaminase 15 U / mL.

[0061] Also included: 1 M NaOH as a cross-linking agent, with a volume of 0.023 times the volume of type I rat tail collagen.

[0062] The preparation method is the same as that of Example 1.

[0063] Example 4

[0064] Preparation of alveolar organoid induction medium

[0065] Using DMEM / F12 as solvent, prepare a culture medium containing the following final concentrations:

[0066] 1×B27 supplement, 1×N2 supplement, 0.1% BSA, glutamine 2mM, CHIR-9902110μM, SB43154210μM, rh-KGF 10ng / mL, IBMX 0.1mM, 8-Br-cAMP 0.1mM, dexamethasone 50nM, FGF1020ng / ml, TGFb 20ng / ml, EGF 20ng / ml, OSM protein 20ng / ml, TNFa 10ng / ml and IL-1b10ng / ml.

[0067] Example 5

[0068] Alveolar Organoid Culture Methods

[0069] (1) Mouse adult lung stem cells with a cell confluence of 80% to 90% (for the separation, extraction and culture methods, see patent CN 115896002 A) were digested with 0.25% trypsin to make them fall off the bottom of the collagen-coated cell culture dish, and the digestion was terminated with DMEM / F12 basal medium containing 10% FBS, and the adult lung stem cells were collected by centrifugation.

[0070] (2) Resuspend adult lung stem cells in DMEM / F12 basal medium containing 10 μM Y-27632 and dilute to 7.5×10 5 / mL to obtain cell suspension.

[0071] (3) Take 50 μL of the cell suspension and mix it with 500 μL of the alveolar organoid hydrogel system prepared in Example 1, Example 2 or Example 3, then mix and cross-link it with 11.5 μL of 1M NaOH, then add it to a 12-well cell culture dish and culture it in a cell culture incubator at 37° C. for 30 min to form a 3D gel.

[0072] (4) 1 mL of the alveolar organoid induction medium prepared in Example 4 was added for culturing, and the cell morphology was observed every day. Fresh medium was replaced every three days. After 14 days of culturing, organoids with a spherical morphology visible to the naked eye were formed in the 3D gel. On the 28th day, the morphology of the organoids increased significantly and the branching structure became significantly more complex (see Figure 1-2 ).

[0073] Example 6

[0074] Characterization of the cellular composition of alveolar organoids

[0075] In order to verify that the alveolar organoid hydrogel system and alveolar organoid induction medium of the present invention can be stably and effectively used for the induction culture of alveolar organoids, alveolar organoids cultured for 14 and 28 days were selected to verify the lineage of their alveolar epithelial cells.

[0076] The alveolar organoids cultured for 14 and 28 days were visible to the naked eye. The culture medium was discarded, the gel was washed with PBS, fixed with 4% paraformaldehyde solution at room temperature for 2 hours, and dehydrated with 30% sucrose until the gel sank to the bottom of the dish. The gel was embedded in OCT for frozen sections with a thickness of 10 μm. The frozen sections were immunofluorescently stained, and the corresponding alveolar epithelial cells were traced with antibody proteins that could mark type I alveolar cells (PDPN) and type II alveolar cells (SFTPC). The antibodies and tissue sections were incubated overnight at 4°C, and the tissue sections were washed 3 times with PBS. Then, the immunofluorescent secondary antibodies corresponding to the corresponding antibodies were added, incubated at room temperature for 1 hour, and the tissue sections were washed 3 times with PBS, and then incubated with DAPI stain for 5 minutes. After washing 3 times with PBS, the sections were observed under a fluorescence microscope.

[0077] Among them, the alveolar organoids cultured for 14 days formed a relatively simple alveolar sac morphology, which was composed of flat and long type I alveolar cells (PDPN) and square type II alveolar cells (SFTPC) at the corners of the alveolar sac (see Figure 3 ).

[0078] After 28 days of culture, alveolar organoids formed a more complex alveolar sac structure, which also contained type I alveolar cells (PDPN) and type II alveolar cells (SFTPC) (see Figure 4 ).

[0079] At the same time, electron microscopy analysis of alveolar organoids revealed functional lamellar structures (lbl) generated by type II alveolar cells, which is one of the important markers of mature alveolar cells ( Figure 5 ).

[0080] Example 7

[0081] Real-time fluorescence quantitative PCR verifies that alveolar organoids express genes of mature alveolar epithelial cells in adult lung tissue

[0082] The alveolar organoids cultured for 14 days and the cells extracted from adult lung tissue were washed with PBS, fully lysed with Trizol, and 1 / 2 the volume of Trizol chloroform was added. The mixture was centrifuged at 4°C, 12,000 rpm, and 15 minutes. The upper aqueous phase was taken and an equal volume of isopropanol was added to mix thoroughly. The mixture was allowed to stand at room temperature for 10 minutes, and centrifuged at 4°C, 12,000 rpm, for 15 minutes. After that, the precipitate was fully washed with 75% ethanol, dried at room temperature until translucent, and RNase-free ddH2O water was added to dissolve the RNA.

[0083] RNA reverse transcription was performed using a reverse transcription kit (Promega, A5001). First, 500 ng RNA was added with 1 μL primer dT, and the volume was adjusted to 5 μL with ddH2O. The mixture was heated at 70°C for 5 minutes to open the helical structure in the RNA, and then immediately placed in an ice bath for more than 5 minutes. Then, 4 μL 5× Reaction buffer, 4 μL MgCl2, 1 μL PCR dNTP, 0.5 μL RNase inhibitors, 1 μL Reverse Transcriptase and 4.5 μL ddH2O were added to the reaction system. After thorough mixing, the mixture was renatured at 25°C for 5 minutes, extended at 42°C for 1 hour, and reacted at 70°C for 15 minutes to inactivate the reverse transcriptase. The expression level of the corresponding gene was detected by real-time fluorescence quantitative PCR. The reaction system of real-time fluorescence quantitative PCR is shown in Table 1, the reaction conditions are shown in Table 2, and the primer sequences are shown in Table 3.

[0084] Table 1 Reaction system of real-time fluorescence quantitative PCR

[0085] Reagents Volume (μL) 2×SYBGreenTaq 10.0 Forwardprimer 0.6 Reverseprimer 0.6 cDNA 0.6 <![CDATA[ddH2O]]> 8.2 Total volume 20

[0086] Table 2 Reaction conditions of real-time fluorescence quantitative PCR

[0087]

[0088] Table 3 List of primer sequences for real-time fluorescence quantitative PCR

[0089] Primer name Primer sequences Sftpa-F ACCTGGATGAGGAGCTTCAGAC, SEQ ID NO.1 Sftpa-R CTGACTGCCCATTGGTGGAAAAG, SEQ ID NO.2 Sftpb-F TGTCCTCCGATGTTCCACTGAG, SEQ ID NO.3 Sftpb-R AGCCTGTTCACTGGTGTTCCAG, SEQ ID NO.4 Sftpc-F GTCCTCGTTGTCGTGGTGATTG, SEQ ID NO.5 Sftpc-R AAGGTAGCGATGGTGTCTGCTC, SEQ ID NO.6 Pdpn-F ACAACCACAGGTGCTACTGGAG, SEQ ID NO.7 Pdpn-R GTTGCTGAGGTGGACAGTTCCT, SEQ ID NO.8 Rage-F GCCACTGGAATTGTCGATGAGG, SEQ ID NO.9 Rage-R GCTGTGAGTTCAGAGGCAGGAT, SEQ ID NO.10 Aqp5-F TCCATGAACCCAGCCCGATCTT, SEQ ID NO.11 Aqp5-R GAAGTAGAGGATTGCAGCCAGG, SEQ ID NO.12 Hopx-F GCAGACGCAGAAATGGGTTTAAG, SEQ ID NO.13 Hopx-R GGAGTTCCAAGAGCAAGCT, SEQ ID NO.14 GAPDH-F AGGTCGGTGTGAACGGATTTG, SEQ ID NO.15 GAPDH-R TGTAGACCATGTAGTTGAGGTCA, SEQ ID NO.16

[0090] qPCR further confirmed that type I alveolar cells (Pdpn, Rage, Aqp5, Hopx) and type II alveolar cells (Sftpa, Sftpb, Sftpc) were generated in alveolar organoids. Figure 6 . It shows that the alveolar organoid hydrogel system and alveolar organoid induction culture medium described in the present invention can induce adult lung stem cells to generate functional alveolar organoids with alveolar sac structure.

[0091] Comparative Example 1

[0092] Matrigel-based alveolar organoid culture

[0093] (1) Mouse adult lung stem cells with a cell confluence of 80% to 90% (for the separation, extraction and culture methods, see patent CN 115896002 A) were digested with 0.25% trypsin to make them fall off the bottom of the collagen-coated cell culture dish, and the digestion was terminated with DMEM / F12 basal medium containing 10% FBS, and the adult lung stem cells were collected by centrifugation.

[0094] (2) Resuspend adult lung stem cells in DMEM / F12 basal medium containing 10 μM Y-27632 and dilute to 7.5×10 5 / mL to obtain cell suspension.

[0095] (3) Take 50 μL of cell suspension and mix with 500 μL of Matrigel, then place one drop of 50 μL in a 24-well plate and culture in a cell culture incubator at 37°C for 30 min to form a 3D gel.

[0096] (4) Add 1 mL of the alveolar organoid induction medium prepared in Example 4 for culturing, observe the cell morphology every day, replace the fresh medium every three days, and alveolar organoids can be formed in the 3D gel after 35 days of culturing (see Figure 7 ).

[0097] Compared with the alveolar organoid hydrogel system based on the present invention ( Figure 1 to Figure 4 ), based on Matrigel( Figure 7 ) The generated alveolar organoids have a single alveolar morphology, and type I pneumocytes (PDPN) and type II pneumocytes (SFTPC) are closely arranged, which is quite different from the physiological flat type I pneumocytes (PDPN) and round fluorescent type II pneumocytes (SFTPC).

[0098] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0099] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A culture system for generating alveolar organoids with alveolar sac morphology based on adult lung stem cells, characterized in that: Including alveolar organoid hydrogel system; The alveolar organoid hydrogel system uses DMEM / F12 as solvent and includes the following components at final concentrations: Type I rat tail collagen 1.5-2.5 mg / mL, gelatin 10-100 mg / mL, hyaluronic acid 5-50 μg / mL, chondroitin sulfate 50-200 μg / mL, low melting point agarose 5-20 mg / mL, elastin 20-100 μg / mL, epidermal growth factor 25-100 ng / mL, fibroblast growth factor 25-100 ng / mL and transglutaminase 15 U / mL.

2. The culture system according to claim 1, characterized in that The alveolar organoid hydrogel system uses DMEM / F12 as solvent and includes the following components at final concentrations: Type I rat tail collagen 2 mg / mL, gelatin 50 mg / mL, hyaluronic acid 25 μg / mL, chondroitin sulfate 100 μg / mL, low melting point agarose 10 mg / mL, elastin 50 μg / mL, epidermal growth factor 50 ng / mL, fibroblast growth factor 50 ng / mL and transglutaminase 15 U / mL.

3. The culture system according to claim 1, characterized in that The alveolar organoid hydrogel system also includes 1M NaOH.

4. The culture system according to claim 1, characterized in that Also included is alveolar organoid induction medium; The alveolar organoid induction medium uses DMEM / F12 as a solvent and includes the following components at final concentrations: 1×B27 supplement, 1×N2 supplement, 0.1% BSA, glutamine 2mM, CHIR-9902110μM, SB43154210μM, rh-KGF 10ng / mL, IBMX 0.1mM, 8-Br-cAMP 0.1mM, dexamethasone 50nM, FGF1020ng / ml, TGFb20ng / ml, EGF 20ng / ml, OSM protein 20ng / ml, TNFa 10ng / ml and IL-1b 10ng / ml.

5. A method for culturing alveolar organoids, characterized in that: Use the culture system according to any one of claims 1 to 4.

6. The culture method according to claim 5, characterized in that The specific steps are as follows: (1) Preparation and collection of adult lung stem cells; (2) resuspending adult lung stem cells in DMEM / F12 basal medium containing Y-27632, and then diluting to obtain a cell suspension; (3) Mix the cell suspension with the alveolar organoid hydrogel system, then cross-link with 1 M NaOH and place in a cell culture incubator for culture; (4) Add alveolar organoid induction medium for culture and replace with fresh medium every three days.

7. Use of the culture system according to any one of claims 1 to 4 in preparing alveolar organoids having alveolar sac structure.

8. An alveolar organoid, characterized in that: Alveolar organoids cultured using the culture system described in any one of claims 1 to 4 or the method described in any one of claims 5 to 6.

9. The use of alveolar organoids for non-diagnostic and therapeutic purposes according to claim 8, characterized in that: The application is any of the following: A: In vitro study of the regulatory mechanisms, physiological homeostasis and function of alveolar development; B: In vitro study of the pathological characteristics of alveoli and the pathogenic mechanisms of alveolar structural dysfunction or loss; C: Establish disease models related to the alveolar system to study the corresponding pathogenic mechanisms and drug action mechanisms; D: Develop and screen drugs targeting alveolar structural dysfunction or loss, and evaluate their pharmacological efficacy; E: Testing the toxicity of inhaled substances or the effectiveness of inhaled drugs; F: Study the infection of alveolar epithelial cells by respiratory viruses.

Images