SiFKBP10-loaded targeting exosome as well as preparation method and application thereof

Abstract

The invention discloses a targeted exosome loaded with siFKBP10 as well as a preparation method and application of the targeted exosome. The targeted exosome comprises a cell exosome with a membrane protein Lamp2b and a myofibroblast RDYH58 peptide which is combined with the membrane protein, and the cell exosome is modified by the siFKBP10; the cDNA (complementary deoxyribonucleic acid) sequence of the RDYH58 peptide is as shown in SEQ. ID. NO.1; 1, and the positive-sense strand of the siFKBP10 is as shown in SEQ ID NO. 2, and the antisense strand of the siFKBP10 is as shown in SEQ ID NO. 3. The targeting exosome can significantly reduce expression of FKBP10 in cells, inhibits excessive deposition of extracellular matrix, has a good inhibition effect on idiopathic pulmonary fibrosis, and provides a new treatment strategy for treatment of IPF.

Description

Technical Field

[0001] The present invention relates to the technical field of idiopathic pulmonary fibrosis, and in particular to a targeted exosome loaded with siFKBP10, and a preparation method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Idiopathic pulmonary fibrosis (IPF) is a progressive restrictive lung disease characterized by complex mechanisms, signaling pathways, and cellular interactions. The median survival after an acute exacerbation of IPF is approximately 3–5 years, with high morbidity and mortality, particularly in Europe and North America. IPF is often associated with abnormal epithelial cell activation, repeated injury, and impaired repair. The interaction between abnormal epithelial cells and immune cells leads to the activation of myofibroblasts, which in turn leads to the oversecretion of transforming growth factor-β (TGF-β), which causes excessive deposition of extracellular matrix (ECM) such as type I collagen (COL-1), hindering gas exchange between alveoli. In the development of IPF, myofibroblasts are the main effector cells, which are mainly differentiated from activated lung fibroblasts and secrete smooth muscle actin (α-SMA). FK506 binding protein (FKBP10) was originally discovered in mouse fibroblasts, localized to the rough endoplasmic reticulum, and involved in the biosynthesis of procollagen. FKBP10 exhibits peptidylproline cis-trans isomerase activity, which is required for the conversion of proline to trans-proline during the assembly of linear collagen chains into collagen triple helices. FKBP10 directly interacts with collagen within cells. FKBP10 expression is developmentally regulated in bones and ligaments after birth and is reactivated in damaged tissues. Mutations in FKBP10 may lead to recessive osteogenesis imperfecta and Bruck syndrome. Downregulation of FKBP10 expression can reduce the production of collagen and fibronectin (FN) in lung fibroblasts and inhibit the migration of myofibroblasts. However, due to the lack of understanding of the three-dimensional structure of FKBP10, there are currently no effective inhibitors against FKBP10. Summary of the invention

[0004] In view of the above problems, the present invention provides a small interfering RNA (siFKBP10)-targeted exosome loaded with FKBP10 and its preparation method and application, which can significantly reduce the expression of FKBP10 in cells, inhibit the excessive deposition of extracellular matrix (ECM), have a good inhibitory effect on idiopathic pulmonary fibrosis, and provide a new treatment strategy for the treatment of IPF. Specifically, the technical solution of the present invention is as follows.

[0005] First, the present invention discloses a targeted exosome loaded with siFKBP10 (RDYH58-siFKBP10), which includes a cell exosome having a membrane protein Lamp2b and a RDYH58 peptide targeting myofibroblasts bound to the membrane protein, and the cell exosome is loaded with siFKBP10. The cDNA sequence of the RDYH58 peptide is shown in SEQ.ID.NO.1: AGGGACTACCACCCCAGGGACCACACCGCCACCTGGGGCGGCTGC. The sense strand of the siFKBP10 is shown in SEQ.ID.NO.2: AGCUCAAGCUGAAGUCAGA, and the antisense strand is shown in SEQ.ID.NO.3: UCUGACUUCAGCUUGAGCU.

[0006] Secondly, the present invention discloses a method for preparing targeted exosomes loaded with siFKBP10, comprising the following steps:

[0007] (1) The recombinant plasmid GNSTM-RDYH58-Lamp2b-HA was obtained by homologous recombination.

[0008] (2) The recombinant plasmid GNSTM-RDYH58-Lamp2b-HA is transfected into transfected cells, and then cultured. After completion, exosomes are isolated to obtain exosomes RDYH58-exo, which can express RDYH58-Lamp2b-HA.

[0009] (3) The siFKBP10 was loaded into the exosomes RDYH58-exo by ultrasonic microfluidics to obtain the targeted exosomes loaded with siFKBP10 (RDYH58-siFKBP10).

[0010] Furthermore, in step (1), the RVG peptide in the plasmid vector GNSTM-RVG-Lamp2b-HA is replaced with the RDYH58 peptide of myofibroblasts to obtain the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA.

[0011] Furthermore, in step (1), primers are designed at both ends of the RVG peptide sequence on the plasmid vector (GNSTM-RVG-Lamp2b-HA): forward primer: 5'-taactcgactatgggcagtgga-'3, reverse primer: 5'-ggcagtggatctggatccggtg-'3, to facilitate circular plasmid amplification. Then homologous recombination is performed to obtain the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA.

[0012] Furthermore, in step (1), the recombinant plasmid is transformed into Escherichia coli for culture, and the plasmid is extracted after completion to obtain the recombinant plasmid. Optionally, the culture temperature is 37-38°C and the culture time is 16-24h.

[0013] Furthermore, in step (2), the transfected cells include HEK293F, any suspension or adherent cells.

[0014] Furthermore, in step (2), the transfection reagent is mixed with the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA, incubated and then added to the culture medium for the culture. Optionally, the incubation time of the transfection reagent and the recombinant plasmid is 15 minutes, the cell culture time is 48 to 72 hours, and the culture temperature is 37 to 38°C.

[0015] Furthermore, the ratio of the transfection reagent to the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA is 1 mL: 500 μg. Optionally, the transfection reagent includes Lipo293F TM transfection reagent or any other suitable transfection reagent.

[0016] Furthermore, in step (2), the step of isolating exosomes comprises: centrifuging the obtained culture fluid to remove cells and cell debris, filtering the obtained supernatant and then performing ultracentrifugation to obtain exosomes RDYH58-exo.

[0017] Further, in step (3), the ultrasonic microfluidics method includes the steps of: adding the exosomes RDYH58-exo and siFKBP10 to a buffer solution, then adding the resulting mixture to an automatic injection pump, and then injecting under ultrasonic conditions. Optionally, the mass ratio of the exosomes RDYH58-exo to siFKBP10 is 1:5 to 1:1. The power of the ultrasound is 10 to 100W.

[0018] Finally, the present invention discloses the use of the targeted exosomes loaded with siFKBP10 in the preparation of therapeutic drugs for idiopathic pulmonary fibrosis.

[0019] Compared with the prior art, the technical solution of the present invention has at least the following beneficial effects: the targeted exosomes RDYH58-siFKBP10 loaded with siFKBP10 of the present invention are more inclined to co-localize with myofibroblasts rather than with epithelial cells or endothelial cells, which means that RDYH58-siFKBP10 has good targeting to myofibroblasts. Thus, the expression of FKBP10 in myofibroblasts is inhibited, the activation of myofibroblasts is inhibited, and then the excessive deposition of ECM and the migration and differentiation of myofibroblasts are inhibited, and the fibrosis development of cells is inhibited, which is an effective means for treating idiopathic pulmonary fibrosis. The reason is that myofibroblasts are the main effector cells in the development of pulmonary fibrosis, and FKBP10 is a therapeutic target mainly present in myofibroblasts. FKBP10 has peptidyl prolyl cis / trans isomerase activity. In the process of assembling linear collagen chains into collagen triple helices, the isomerization of proline and trans proline is required. The loss of FKBP10 hinders the excessive occurrence of fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] It should be noted that the drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention and do not constitute an improper limitation of the present invention.

[0021] Figure 1 This is the expression test diagram of RDYH58-exo prepared in Example 1 below.

[0022] Figure 2 This is an in vitro targeting test diagram of RDYH58-exo prepared in Example 1 below.

[0023] Figure 3 and Figure 4 This is a diagram of the in vivo targeting test of RDYH58-exo prepared in Example 1 below.

[0024] Figure 5 This is a test diagram of the effect of RDYH58-siFKBP10 prepared in Example 1 below on ECM protein deposition in vitro.

[0025] Figure 6 This is a graph showing the effect of RDYH58-siFKBP10 prepared in the following Example 1 on BLM-induced lung inflammation in mice.

[0026] Figure 7 This is a test diagram of the effect of RDYH58-siFKBP10 prepared in the following Example 1 on BLM-induced pulmonary fibrosis in mice. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Unless otherwise defined, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. The preferred implementation methods and materials described in the present invention are only for demonstration purposes. The reagents or raw materials used in the invention can be purchased through conventional channels. If there are no special instructions, the reagents or raw materials used in the present invention are used in a conventional manner in the art or in accordance with the product instructions.

[0028] The technical solution of the present invention is now further described in conjunction with a specific embodiment. A method for preparing targeted exosomes loaded with siFKBP10 comprises the following steps:

[0029] (1) The cDNA sequence of the RDYH58 peptide of myofibroblasts was obtained using the EMBOSS Backtranseq tool as shown in SEQ.ID.NO.1: AGGGACTACCACCCCAGGGACCACACCG CCACCTGGGGCGGCTGC. Primers were designed at both ends of the RVG sequence on the plasmid vector (GNSTM-RVG-Lamp2b-HA), the forward primer (sequence as shown in SEQ.ID.NO.4): 5'-taactcgactatgggcagtgga-'3, the reverse primer (sequence as shown in SEQ.ID.NO.5): 5'-ggcagtggatctggatccggtg-'3. This facilitates the amplification of the circular plasmid. Then, homologous recombination was performed to replace the RVG peptide in the plasmid vector with the RDYH58 peptide to obtain a recombinant plasmid. The recombinant plasmid was transformed into DH5α Escherichia coli and cultured in liquid Luria Broth medium at 37°C for 12 hours. After completion, the plasmid in the culture medium was extracted using a plasmid extraction kit (catalog number DP117, Vazyme, produced in Nanjing) to obtain the recombinant plasmid (GNSTM-RDYH58-Lamp2b-HA) for use.

[0030] (2) Using serum-free and protein-free Expi293 TM HEK293F cells (A14527, ThermoFisher Scientific, USA) were cultured in expression medium (ThermoScientific, USA). When the cell density reached 2.5×10 6The transfection was performed at 100 μg / mL. The amount of the transfection reagent (C0518, Biyuntian, China) and the recombinant plasmid was 500 μg of recombinant cDNA per 1 mL of transfection reagent, mixed evenly, and incubated for 15 minutes before adding the culture medium. The cells were then cultured for 48 to 72 hours. The cells and cell debris were then removed by differential centrifugation, and the supernatant obtained was filtered (0.22 μm). Exosomes were collected by centrifugation at 100,000 g to obtain exosomes RDYH58-exo.

[0031] (3) The exosomes RDYH58-exo and siFKBP10 (whose sense chain is shown in SEQ.ID.NO.2: AGCUCAAGCUGAAGUCAGA, and the antisense chain is shown in SEQ.ID.NO.3: UCUGACUUCAGCUUGAGCU) were mixed in a mass ratio of 1:1, and PBS buffer was added to mix evenly, and then added to the ultrasonic microfluidic device, the automatic injection pump flow rate was set to 200 μL / min, and the ultrasonic generator was operated at a power of 30 W to load siFKBP10 into the exosomes RDYH58-exo by ultrasonic microfluidic technology. The sample was collected 1 minute after the start of injection to obtain the targeted exosomes (RDYH58-siFKBP10) loaded with siFKBP10. Testing and Characterization:

[0032] (1) The expression of RDYH58-Lamp2b-HA in the RDYH58-exo was tested by Western blotting with anti-HA antibody. The results are as follows: Figure 1 As shown: HA tag in RDYH58-exo was positive, while exosomes without any modification (unm-exo) (control group) did not express HA tag protein.

[0033] (2) The in vitro targeting of RDYH58-exo prepared in this example was tested. The results are as follows Figure 2 As shown. In order to verify the effectiveness of the RDYH58-exo in targeting myofibroblasts, BLM-induced cell injury was used to successfully transform fibroblasts into myofibroblasts, and the cells were treated with unm-exo and RDYH58-exo for 2 and 6 hours. It can be seen that when the BLM concentration was 1.0 μg / mL, the expression of α-SMA, a marker of myofibroblasts, was significantly increased (as shown in Figure 2A). Figure 2 A and 2B), and subsequently in BLM-treated cells, RDYH58-exo was taken up more efficiently compared to unm-exo (as shown in Figure 2 F). In the figure, blue indicates the cell nucleus and green indicates DiO-labeled exosomes. This indicates that RDYH58-exo is more effectively taken up by myofibroblasts than unm-exo (e.g. Figure 2D and 2E), therefore, the RDYH58-siFKBP10 prepared in this example can effectively target myofibroblasts.

[0034] (3) In order to evaluate the targeting effect of the RDYH58-siFKBP10 prepared in this example on myofibroblasts in a BLM-induced pulmonary fibrosis mouse model, a pulmonary fibrosis mouse model (eg, Figure 3 A and 3B). After 14 days of BLM induction in BALB / c mice, DiO-labeled exosomes were administered to healthy and lung fibrosis mice by intratracheal spray, and the retention of exosomes was observed. Figure 3 As shown, the results showed that the fluorescence signal gradually weakened on the third day after administration (e.g. Figure 3 C).

[0035] To further observe the cell types reached by RDYH58-exo and unm-exo in the lungs, C57BL / 6 mice were induced with BLM for 7 days and then administered DiO-labeled exosomes by tracheal spray. One day after administration, the organs were harvested and the fluorescence distribution was observed. The results showed that most of the fluorescence signals were distributed in the lungs of mice (such as Figure 3 D). Frozen sections of mouse lung tissue were prepared, and the colocalization of RDYH58-exo and unm-exo with myofibroblasts, macrophages, epithelial cells, and endothelial cells was observed by immunofluorescence staining. The results showed that more RDYH58-exo colocalized with myofibroblasts compared with unm-exo (as shown in Figure 4 In addition, the RDYH58-exo also showed a strong fluorescence signal in macrophages (as shown in Figure 4 C and 4D), which may be due to the phagocytic activity of macrophages. In mice with pulmonary fibrosis, RDYH58-exo colocalized with myofibroblasts more than epithelial cells (as shown in Figure 4 E and 4F) and endothelial cells (as Figure 4 G and 4H) more (as shown Figure 4 I), which provides a positive role for the subsequent treatment of pulmonary fibrosis by targeting myofibroblasts to deliver siFKBP10.

[0036] (4) To evaluate the effect of RDYH58-siFKBP10 on BLM-induced cell fibrosis, cells were treated with RDYH58-exo, RDYH58-exo loaded with siNC (RDYH58-siNC), naked siFKBP10, unm-exo loaded with siFKBP10 (unm-siFKBP10), and RDYH58-siFKBP10. The test results are shown in Figure 4. Figure 5As shown in Figure 2, it can be seen that after RDYH58-siFKBP10 treatment, BLM (1.0 μg / mL)-induced FKBP10 (such as Figure 5 A and 5B ) and ECM-related proteins (e.g. Figure 5 D and 5E) Figure 2 C) was significantly reduced. The reduction of α-SMA further indicated that the RDYH58-siFKBP10 could inhibit the activation of fibroblasts (as shown in Figure 5 C). The immunofluorescence results reached the same conclusion (as shown in Figure 5 F and 5G). Wound healing assays showed that BLM-induced cell migration rate was reduced in the RDYH58-siFKBP10 treatment group (as shown in Figure 5 H and 5I).

[0037] (5) To detect the expression of FKBP10 in the lungs of mice with pulmonary fibrosis, tissues were collected at 0, 7, 14, and 21 days after BLM induction, and proteins were extracted for Western blotting analysis (e.g. Figure 6 The results showed that the expression of FKBP10 and α-SMA was upregulated 7 days after BLM induction (as shown in Figure 6 C and 6D). Starting from 7 days after BLM induction, mice were treated with PBS, RDYH58-exo, RDYH58-siNC, Naked siFKBP10, Unm-siFKBP10, and RDYH58-siFKBP10 to slow down the progression of pulmonary fibrosis. The frequency of administration was once every two days, and the changes in mouse body weight were recorded throughout the treatment period (as shown in Figure 6 The results showed that BLM-induced changes in body weight were alleviated after two weeks of treatment with RDYH58-siFKBP10 (Figure Figure 6 E and 6G), with minimal changes in body weight compared to the initial body weight. Treatment with RDYH58-siFKBP10 reduced local congestion and necrosis in fibrotic lungs and decreased lung weight (Fig. Figure 6 F and 6H). Histological analysis using H&E, Masson's trichrome, and Sirius Red staining showed (as shown in Figure 6 I and 6J), RDYH58-siFKBP10 effectively ameliorated the extensive fibrosis, thickened alveolar septa, and other structural changes caused by BLM.

[0038] (5) The development of IPF is accompanied by the release of inflammatory factors such as TGF-β1 and connective tissue growth factor, which leads to the activation and proliferation of lung fibroblasts. These fibroblasts subsequently differentiate into myofibroblasts that overexpress α-SMA and secrete excessive fibrotic factors, leading to excessive deposition of ECM. FKBP10 is upregulated in fibrotic lungs and is mainly localized in myofibroblasts and macrophages. The RDYH58-siFKBP10 prepared in this example was delivered to BLM-exposed pulmonary fibrosis mice. The results are as follows: Figure 7 Western blotting results showed that FKBP10 expression was decreased (as shown in Figure 7 A and 7B), while ECM-related proteins include COL-1 (as Figure 7 C), FN (as shown Figure 7 D) and α-SMA (as Figure 7 Immunohistochemistry results showed that the delivery of RDYH58-siFKBP10 reduced the expression of FN and α-SMA in excess ECM (as shown in Figure 5A). Figure 7 G), while the other treatment groups did not show the same therapeutic effect. The whole lung collagen secretion level was further evaluated by hydroxyproline expression, and the results showed that RDYH58-siFKBP10 significantly reduced the hydroxyproline content in the lung compared with the BLM group (as shown in Figure 7 F). siFKBP10 exhibits a strong anti-fibrotic potential in inhibiting collagen secretion.

[0039] (6) In order to evaluate the effect of the RDYH58-siFKBP10 treatment prepared in this example on gene expression, transcriptome sequencing was performed on the control group, BLM treatment group, BLM+unm-siFKBP10 treatment group and BLM+RDYH58-siFKBP10 treatment group. A heat map was generated to intuitively display the changes in gene expression between different groups. Sequencing reads were aligned to genomic regions or gene exons, using two normalization methods: fragments per kilobase exon model per million mapped fragments (FPKM) and transcripts per million (TPM). The StringTie tool was used to quantify gene expression. Differentially expressed gene analysis used DESeq2 software, with log2 (Fold Change) greater than 0.5 and P value less than 0.05 as the criteria for screening differentially expressed genes. Compared with the BLM group, RDYH58-siFKBP10 treatment resulted in differential expression of 1713 genes. In the BLM+RDYH58-siFKBP10 group, 873 mRNAs were upregulated and 840 mRNAs were downregulated. These differentially expressed genes included many genes related to ECM and cell migration, such as FKBP10, MMP14, FN1, and COL1 ( Figure 7 C). Compared with the BLM+Unm-siFKBP10-treated group, 467 genes were differentially expressed in the BLM+RDYH58-siFKBP10 group, of which 245 genes were also differentially expressed compared with the BLM group. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that genes involved in pathways such as ECM-receptor interaction in the BLM+RDYH58-siFKBP10 group showed upregulation or downregulation compared with the BLM group. The top 20 enriched pathways showed that the BLM+RDYH58-siFKBP10 group showed significant enrichment in multiple pathways related to cell migration and ECM, including the Wnt signaling pathway, PI3K-Akt signaling pathway, and ECM-receptor interaction, compared with the BLM group. Gene ontology enrichment analysis (GO) involving biological processes, cellular components, and molecular functions showed that the top 30 GO enrichments showed that the BLM+RDYH58-siFKBP10 treatment group exhibited positive effects in the positive regulation of angiogenesis and ECM organization.

[0040] In summary, in vitro and in vivo studies have shown that the RDYH58-siFKBP10 can successfully target myofibroblasts, alleviate IPF by inhibiting the migration and differentiation of fibroblasts and downregulating the expression of ECM proteins, thereby improving the survival of mice. FKBP10 is an important therapeutic target in myofibroblasts for the treatment of pulmonary fibrosis. The present invention provides a new therapeutic strategy for the treatment of IPF.

[0041] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made shall be included in the protection scope of the present invention.

Claims

1. A targeted exosome loaded with siFKBP10, characterized in that: It includes cell exosomes with membrane protein Lamp2b and RDYH58 peptide of myofibroblasts bound to the membrane protein, and the cell exosomes are modified by the siFKBP10; the cDNA sequence of the RDYH58 peptide is shown in SEQ.ID.NO.1; the positive chain of the siFKBP10 is shown in SEQ.ID.NO.2, and the antisense chain is shown in SEQ.ID.NO.

3.

2. A method for preparing targeted exosomes loaded with siFKBP10, characterized in that: The steps include: (1) Obtain the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA by homologous recombination; (2) transfecting the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA into transfected cells, and then culturing them. After completion, exosomes are isolated to obtain exosomes RDYH58-exo, which can express RDYH58-Lamp2b-HA; (3) Using ultrasonic microfluidics, siFKBP10 was loaded into the exosomes RDYH58-exo to obtain targeted exosomes loaded with siFKBP10.

3. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 2, characterized in that: In step (1), the RVG peptide in the plasmid vector GNSTM-RVG-Lamp2b-HA is replaced with the RDYH58 peptide of myofibroblasts to obtain the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA; Optionally, in step (1), primers are designed at both ends of the RVG peptide sequence on the plasmid vector GNSTM-RVG-Lamp2b-HA: forward primer: 5'-taactcgactatgggcagtgga-'3, reverse primer: 5'-ggcagtggatctggatccggtg-'3, and then homologous recombination is performed to obtain the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA.

4. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 2, characterized in that: In step (1), the recombinant plasmid is transformed into Escherichia coli for culture, and the plasmid is extracted after completion to obtain the recombinant plasmid; optionally, the culture temperature is 37-38° C. and the culture time is 16-24 hours.

5. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 2, characterized in that: In step (2), the transfected cells include HEK293F, any suspension or adherent cells.

6. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 2, characterized in that: In step (2), the transfection reagent is mixed with the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA, incubated and then added to the culture medium for the culture; optionally, the culture time is 48 to 72 hours and the culture temperature is 37 to 38°C.

7. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 6, characterized in that: The ratio of the transfection reagent to the recombinant plasmid GNSTM-RDYH58-Lamp2b-HA is 1 mL: 500 μg; optionally, the transfection reagent includes Lipo293F TM Transfection reagent.

8. The method for preparing targeted exosomes loaded with siFKBP10 according to claim 2, characterized in that: In step (2), the step of isolating exosomes comprises: centrifuging the obtained culture fluid to remove cells and cell debris, filtering the obtained supernatant and then performing ultracentrifugation to obtain the exosomes RDYH58-exo.

9. The method for preparing targeted exosomes loaded with siFKBP10 according to any one of claims 2 to 8, characterized in that: In step (3), the ultrasonic microfluidics method includes the steps of: adding the exosomes RDYH58-exo and siFKBP10 to a buffer solution, then adding the resulting mixture to an automatic injection pump, and then injecting under ultrasonic conditions; optionally, the mass ratio of the exosomes RDYH58-exo to siFKBP10 is 1:5 to 1:

1.

10. Use of the targeted exosomes loaded with siFKBP10 according to claim 1, or the targeted exosomes obtained by the preparation method according to any one of claims 2 to 9 in the preparation of a therapeutic drug for idiopathic pulmonary fibrosis.

Images