CRISPR / Cas9 gene editing system based on SeqCas9 protein and related application of CRISPR / Cas9 gene editing system

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 gene editing system based on SeqCas9 protein and fusion protein of SeqCas9 and application of the CRISPR / Cas9 gene editing system. The method has a wide application prospect in the field of gene editing.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and specifically to SeqCas9 protein, a fusion protein based on SeqCas9, a CRISPR / Cas9 gene editing system based on the protein, and related applications for gene editing. Background Art

[0002] The CRISPR / Cas9 system is an acquired immune system that bacteria and archaea have evolved to defend against invasion by exogenous viruses or plasmids. The CRISPR / Cas9 system contains tracrRNA (trans-activating RNA) and crRNA (CRISPR-derived RNA), which together with Cas9 form a complex to function. TracrRNA and crRNA can be fused into single-stranded guide RNA (sgRNA) through a linker sequence. After the genomic DNA in eukaryotic cells is broken and damaged by this system, two major DNA damage repair mechanisms in the cell are responsible for repair: non-homologous end-joining (NHEJ) and homologous recombination (HR). The result of NHEJ repair will cause the deletion or insertion of bases, which can be used for gene knockout; when a homologous template is provided, HR repair can be used for site-specific insertion of genes and precise replacement of bases.

[0003] In addition to basic scientific research, the CRISPR / Cas9 gene editing system has broad prospects for clinical application. However, almost all CRISPR / Cas9 have off-target effects, which can lead to incorrect editing of non-target sequences; or the PAM sequence is complex, or the editing activity is low, making it difficult to be widely used. Therefore, the current important research direction in this field is to explore editing tools with higher specificity to reduce off-target effects.

[0004] Therefore, finding a CRISPR / Cas system with high editing activity, high specificity, simple PAM sequence, and narrow base editing window is the hope for solving the above problems. Summary of the invention

[0005] The inventors discovered in their research that the SeqCas9 protein and the corresponding single-stranded guide RNA can play a gene editing role when used together, and further screened out a fusion protein based on the SeqCas9 protein, which also exhibited efficient base editing activity, thereby realizing the present invention.

[0006] In summary, in the first aspect of the present invention, a fusion protein is provided, comprising:

[0007] a) a SeqCas9 mutant protein, which is based on the SeqCas9 protein whose amino acid sequence is shown in SEQ ID NO: 1 and includes a mutation that causes the SeqCas9 protein to lose its endonuclease activity or a mutation that causes the SeqCas9 protein to have only single-stranded DNA cleavage activity;

[0008] b) another protein or polypeptide; and

[0009] c) an optional first linker for connecting the SeqCas9 mutant protein to the additional protein or polypeptide.

[0010] In a second aspect, the present invention provides a conjugate comprising:

[0011] a) the fusion protein described in the first aspect;

[0012] b) a detectable label; and

[0013] c) optionally a seventh linker for connecting the fusion protein to the detectable label.

[0014] In a third aspect, the present invention provides a single-stranded guide RNA, wherein the single-stranded guide RNA comprises a guide sequence and a scaffold sequence from the 5' end to the 3' end, wherein the scaffold sequence is:

[0015] a) the scaffold sequence shown in SEQ ID NO: 11;

[0016] b) A sequence modified based on the sequence shown in SEQ ID NO: 11 and retaining its biological activity.

[0017] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the fusion protein of the first aspect or the conjugate of the second aspect.

[0018] In a fifth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA described in the third aspect.

[0019] In a sixth aspect, the present invention provides a vector comprising: a nucleic acid sequence encoding the fusion protein described in the first aspect or the conjugate described in the second aspect.

[0020] In a seventh aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the single-stranded guide RNA described in the third aspect.

[0021] In an eighth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0022] 1) a protein component, comprising: a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein described in the first aspect, or the conjugate described in the second aspect; and

[0023] 2) the single-stranded guide RNA described in the third aspect;

[0024] Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex;

[0025] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the fusion protein to the detectable label or the combination;

[0026] The fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the fusion protein with the another protein or polypeptide.

[0027] In a ninth aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the cell or in vitro environment:

[0028] (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein described in the first aspect, or the conjugate described in the second aspect; and the single-stranded guide RNA described in the third aspect;

[0029] (2) the isolated nucleic acid molecule of the fourth aspect and, if appropriate, the isolated nucleic acid molecule of the fifth aspect;

[0030] (3) the vector described in the sixth aspect, and, if appropriate, the vector described in the seventh aspect;

[0031] (4) The CRISPR / Cas9 gene editing system described in the eighth aspect;

[0032] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination;

[0033] Wherein, the fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the other protein or polypeptide;

[0034] Wherein, the SeqCas9 protein or its conjugate or fusion protein, the fusion protein described in the first aspect or the conjugate described in the second aspect recognizes a protospacer adjacent motif (PAM) located at the 3' end of the target sequence and having the sequence 5'-NNG.

[0035] In a tenth aspect, the present invention provides a cell, comprising: the isolated nucleic acid molecule of the fourth aspect or the fifth aspect, or the vector of the sixth aspect or the seventh aspect.

[0036] In an eleventh aspect, the present invention provides a kit for gene editing a target sequence in a cell or in vitro environment, comprising:

[0037] a) Any one selected from the following (1) to (4):

[0038] (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein described in the first aspect, or the conjugate described in the second aspect; and the single-stranded guide RNA described in the third aspect;

[0039] (2) the isolated nucleic acid molecule of the fourth aspect and, if appropriate, the isolated nucleic acid molecule of the fifth aspect;

[0040] (3) the vector described in the sixth aspect, and, if appropriate, the vector described in the seventh aspect;

[0041] (4) The CRISPR / Cas9 gene editing system described in the eighth aspect;

[0042] as well as

[0043] b) Instructions for performing gene editing on target sequences in cells or in vitro;

[0044] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination;

[0045] The fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the another protein or polypeptide.

[0046] The inventors have developed a CRISPR / Cas9 gene editing tool suitable for efficient gene editing in a variety of eukaryotic cell environments. The CRISPR / Cas9 gene editing tool uses SeqCas9 protein and corresponding sgRNA, showing characteristics such as high specificity, high editing activity, and simple PAM. In addition, the inventors' experiments have shown that the editing efficiency of SeqCas9 protein at random sites is comparable to that of SpCas9-HF1 protein, and the editing efficiency at multiple genomic sites is better than SpCas9-NG, which is more suitable for the development and application research of gene editing. Further, the inventors found that when developing a base editor based on SeqCas9 protein, the prepared base editor can effectively achieve single-base conversion. The present invention expands the scope of gene editing and has broad application prospects in the field of gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for use in the specific implementation or the description of the prior art will be briefly introduced below.

[0048] Figure 1 A PAM logo diagram showing the recognition of a PAM sequence by the CRISPR / SeqCas9 gene editing system according to an embodiment of the present invention.

[0049] Figure 2 The editing efficiency results after gene editing of six target sites by the CRISPR / SeqCas9 gene editing system according to an embodiment of the present invention are shown.

[0050] Figure 3 The specific detection results of the CRISPR / SeqCas9 gene editing system according to an embodiment of the present invention in the GFP reporter system HEK293T cell line are shown.

[0051] Figure 4 The editing efficiency results of the CRISPR / SeqABE gene editing system after base editing of six target sites according to an embodiment of the present invention are shown.

[0052] Figure 5 The editing efficiency results of the CRISPR / SeqCBE gene editing system after base editing of six target sites according to an embodiment of the present invention are shown. DETAILED DESCRIPTION

[0053] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It should be understood that the following description is only used to illustrate the present invention by way of example, and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the attached claims. In addition, those skilled in the art will understand that the technical solution of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0054] Fixed cover

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.

[0056] Where a numerical range is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value to one-tenth of the unit of the lower limit between the upper and lower limits of the range and any other stated or intervening values ​​in the stated range are included in the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or two limits, ranges excluding either or both of those included limits are also included in the subject matter.

[0057] In the context of the present invention, many embodiments use the expressions "comprising", "including" or "consisting essentially / mainly of..." The expressions "comprising", "including" or "consisting essentially / mainly of..." can usually be understood as open-ended expressions, indicating that in addition to the elements, components, assemblies, method steps, etc. specifically listed after the expression, other elements, components, assemblies, method steps, etc. are also included. In addition, in this article, the expressions "comprising", "including" or "consisting essentially / mainly of..." can also be understood as closed expressions in some cases, indicating that only the elements, components, assemblies, method steps specifically listed after the expression are included, and no other elements, components, assemblies, method steps are included. At this time, the expression is equivalent to the expression "consisting of..."

[0058] In order to better understand the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers and other numerical values ​​used in the specification and claims indicating quantities, percentages or ratios should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. At a minimum, each numerical parameter should at least be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0059] The terms "Cas9 protein", "Cas9" and "Cas" used herein are used interchangeably in this application and refer to RNA-guided nucleases including Cas9 protein or its functionally active fragments. Cas9 protein is a protein component of the CRISPR / Cas9 genome editing system, which can target and cut DNA target sequences under the guidance of single-stranded guide RNA (sgRNA) to form DNA double-strand breaks (DSBs). DNA double-strand breaks can activate the intrinsic repair mechanisms in cells, nonhomologous end joining (NHEJ) and homologous recombination (HR), thereby repairing DNA damage in cells. During the repair process, the specific DNA sequence is edited at the site.

[0060] The terms "single-stranded guide RNA", "sgRNA (single guided RNA)" or "mature crRNA" used herein are used interchangeably in this application and have the meanings generally understood by those skilled in the art. In general, a single-stranded guide RNA may include a scaffold sequence and a guide sequence, which is also referred to herein as a guide RNA (guide RNA or gRNA). In the context of an endogenous CRISPR system, a guide sequence is also referred to as a spacer. In some cases, a guide sequence is any polynucleotide sequence that has sufficient complementarity with a target sequence to hybridize with the target sequence and guide the specific binding of a CRISPR / Cas9 complex to the target sequence. In certain embodiments, when optimally aligned, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. It is within the capabilities of a person of ordinary skill in the art to determine the optimal alignment. For example, there are publicly and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0061] The term "CRISPR / Cas9 complex" as used herein refers to a complex formed by the combination of a single-stranded guide RNA (single guide RNA) or a mature crRNA:tracrRNA hybrid and a Cas9 protein or a mutant protein thereof, which comprises a guide sequence that hybridizes with a target sequence and thereby binds the Cas9 protein or a mutant protein thereof to the target sequence. The complex is capable of recognizing and cleaving a polynucleotide that can hybridize with the single-stranded guide RNA or mature crRNA.

[0062] Therefore, in the case of forming a CRISPR / Cas9 complex, a "target sequence" refers to a polynucleotide targeted by a guide sequence designed to be targeted, such as a sequence complementary to the guide sequence, wherein the hybridization between the target sequence and the guide sequence will promote the formation of the CRISPR / Cas9 complex. Complete complementarity is not required, as long as there is enough complementarity to cause hybridization and promote the formation of the CRISPR / Cas9 complex. The target sequence can include any polynucleotide, such as DNA. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondria or a chloroplast.

[0063] The term "target sequence" or "target polynucleotide" used in this article can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a useless DNA). In some cases, the target sequence should be related to a protospacer adjacent motif (PAM, Protospacer Adjacent Motif). The precise sequence and length requirements of PAM are different depending on the Cas protein used, but PAM is typically a 2-5 base sequence adjacent to the protospacer (target sequence). Those skilled in the art can identify the PAM sequence used with a given Cas protein.

[0064] As used herein, the terms "polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally may contain synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0065] In the sequences used in the present invention, degenerate bases are sometimes used to represent bases at one or more positions. Degenerate bases can be represented by letters R, Y, M, K, S, W, H, B, V, D, and N, wherein R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents C / G, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0066] As used herein, the terms "polypeptide", "peptide", and "protein" are used interchangeably in this application to refer to polymers of amino acid residues. The term is applicable to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0067] The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When the vector can express the protein encoded by the inserted polynucleotide, or when the vector can transcribe the inserted polynucleotide (for example, transcribe to generate mRNA or functional RNA), the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to plasmid vectors, viral vectors, etc. The vector can also contain a variety of regulatory sequences for regulating expression. "Regulatory sequence" and "regulatory element" are used interchangeably herein and refer to nucleotide sequences that are located upstream (5' non-coding sequence), in the middle or downstream (3' non-coding sequence) of a coding sequence and affect the transcription, RNA processing or stability or translation of the relevant coding sequence. Regulatory sequences can include but are not limited to promoter sequences, transcription start sequences, enhancer sequences, selection elements and reporter genes, etc. The regulatory sequences can be from different sources, or they can be from the same source but arranged in a manner different from that usually occurring naturally. In addition, the vector can also contain a replication initiation site.

[0068] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into an organism refers to transforming an organism cell with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. "Transformation" as used in the present invention includes stable transformation and transient transformation.

[0069] The terms sequence "identity", "identity" or "homology" as used herein have their art-recognized meanings, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule (see, e.g., Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G, Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Although there are many methods for measuring the identity between two polynucleotides or polypeptides, the term "identity" is well known to the skilled person to be suitable for conservative amino acid substitutions in peptides or proteins, and generally can be carried out without changing the biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of polypeptides do not substantially change biological activity (see, e.g., Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub.co., p.224).

[0070] The term "complementarity" as used herein refers to the ability of a nucleic acid sequence to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. The percentage of complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with another nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are complementary, then the percentage of complementarity is 50%, 60%, 70%, 80%, 90% and 100%). "Complete complementarity" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in another nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

[0071] The term "stringent conditions" used herein in connection with hybridization refers to conditions under which a nucleic acid having complementarity with a target sequence predominantly hybridizes with the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and depend on many factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology Hybridization With Nucleic Acid Probes, Section I, Chapter II, "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, New York.

[0072] The term "hybridization" as used herein refers to a reaction in which one or more polynucleotide reactions form a complex that is stabilized via hydrogen bonding of bases between the nucleotide residues. Hydrogen bonding can occur by means of Watson-Crick base pairing, Hoogstein binding or in any other sequence-specific manner. The complex may include two chains forming a duplex, three or more chains forming a multi-chain complex, a single self-hybridizing chain, or any combination of these. Hybridization reactions can constitute a step in a more extensive process (such as the beginning of PCR or the cutting of polynucleotides via an enzyme). A sequence that can hybridize with a given sequence is referred to as the "complement" of the given sequence.

[0073] Cas9 protein and its fusion protein

[0074] In the present invention, the "biological activity" of the Cas9 protein or its fusion protein refers to the activity of the protein binding to a single-stranded guide RNA, the endonuclease activity (including single-stranded cleavage activity and double-stranded cleavage activity), and / or the activity of binding to a specific site of the target sequence and cleaving it under the guidance of a guide RNA (gRNA), but is not limited thereto.

[0075] As mentioned above, the present inventors have found that the SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1 can play a gene editing role when used in combination with a single-stranded guide RNA.

[0076] Furthermore, the inventors have further developed an adenine base editor (ABE) and a cytosine base editor (CBE) based on the SeqCas9 protein, which can be used to effectively perform single-base conversion.

[0077] The core components of ABE are nCas9 (D10A) and adenine deaminase (TadA), which form a fusion protein. The specific working principle of ABE is as follows: when the fusion protein targets genomic DNA under the guidance of sgRNA, adenine deaminase can bind to ssDNA and deaminate adenine (A) within a certain range into inosine (I). I will be read and replicated as G at the DNA level, ultimately achieving a direct replacement of AT base pairs to GC base pairs.

[0078] The core components of CBE are nCas9 (Cas9 nickase) or dCas9 (dead Cas9) and cytosine deaminase (APOBEC), and Cas9 protein and cytosine deaminase form a fusion protein. The specific working principle of CBE is as follows: when the fusion protein targets genomic DNA under the guidance of sgRNA, cytosine deaminase can bind to the ssDNA in the R-loop region formed by Cas9 protein, sgRNA and genomic DNA, deaminate cytosine (C) within a certain range on the ssDNA into uracil (U), and then convert U into thymine (T) through DNA replication or repair, and finally achieve direct replacement of C·G base pairs to T·A base pairs.

[0079] Therefore, in a first aspect of the present invention, a fusion protein is provided, comprising:

[0080] a) a SeqCas9 mutant protein, which is based on the SeqCas9 protein whose amino acid sequence is shown in SEQ ID NO: 1 and includes a mutation that causes the SeqCas9 protein to lose its endonuclease activity or a mutation that causes the SeqCas9 protein to have only single-stranded DNA cleavage activity;

[0081] b) another protein or polypeptide; and

[0082] c) an optional first linker for connecting the SeqCas9 mutant protein to the additional protein or polypeptide.

[0083] In a preferred embodiment, the mutation that causes the SeqCas9 protein to lose endonuclease activity includes mutations D10A and H847A made on the basis of the amino acid sequence shown in SEQ ID NO: 1 (i.e., the amino acid sequence of the SeqCas9 protein). In this article, such a SeqCas9 mutant protein may also be referred to as a dSeqCas9 (dead SeqCas9) protein.

[0084] In a preferred embodiment, the mutation that makes the SeqCas9 protein have only single-stranded DNA cleavage activity includes the mutation D10A made based on the amino acid sequence shown in SEQ ID NO: 1. In this article, such a SeqCas9 mutant protein can also be referred to as nSeqCas9 (SeqCas9nickase) protein.

[0085] In a specific embodiment, the additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, a cytosine deaminase, adenine deaminase, a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcriptional activator protein VP64, p65 and RTA, a transcriptional repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, a Gam protein, and an endonuclease FokI.

[0086] In a preferred embodiment, the additional protein or polypeptide is cytosine deaminase, adenine deaminase or a dimer of adenine deaminase, wherein the amino acid sequence of the cytosine deaminase is as shown in SEQ ID NO: 4, the amino acid sequence of the adenine deaminase is as shown in SEQ ID NO: 2, and the dimer of the adenine deaminase comprises an adenine deaminase with an amino acid sequence as shown in SEQ ID NO: 2 and an artificially directed evolved adenine deaminase (evolved TadA) with an amino acid sequence as shown in SEQ ID NO: 3, connected by an optional third linker.

[0087] In the case where the fusion protein comprises cytosine deaminase, the complex formed by the fusion protein and sgRNA may also be referred to as a cytosine base editor (CBE) herein. In the case where the fusion protein comprises adenine deaminase, the complex formed by the fusion protein and sgRNA may also be referred to as an adenine base editor (ABE) herein.

[0088] In a preferred embodiment, the fusion protein may further comprise a nuclear localization signal (NLS) sequence. The purpose of introducing the NLS sequence into the fusion protein is to increase the expression level of the cytosine base editor in the cell, thereby increasing its editing efficiency or increasing the replacement efficiency of the adenine base editor for base A.

[0089] In a preferred embodiment, the fusion protein comprises, from its N-terminus to its C-terminus, an optional nuclear localization signal (NLS) sequence, an optional second linker, the adenine deaminase or its dimer or cytosine deaminase, the optional first linker, the SeqCas9 mutant protein, an optional fourth linker, and an optional nuclear localization signal (NLS) sequence. In a specific embodiment, the amino acid sequence of the nuclear localization signal (NLS) is shown in SEQ ID NO: 7.

[0090] In one embodiment, the fusion protein further comprises Gam protein derived from bacteriophage Mu, which can bind to the end of DSB to prevent its degradation, thereby preventing the occurrence of NHEJ repair pathway.

[0091] In a further preferred embodiment, the amino acid sequence of the fusion protein is shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:9.

[0092] Those skilled in the art know that there is uracil DNA glycosylase (UDG) in cells, which can recognize U·G mismatches and cleave the glycosidic bond between uracil and the phosphate backbone, and reverse U to C through the base excision repair pathway (BER) in cells.

[0093] Therefore, in another specific embodiment, the fusion protein comprises cytosine deaminase and one or two uracil DNA glycosylase inhibitors (UGI), such as the uracil DNA glycosylase inhibitor (UGI) whose amino acid sequence is shown in SEQ ID NO:8.

[0094] In a specific embodiment, the fusion protein comprises, from its N-terminus to its C-terminus, in sequence: an optional nuclear localization signal (NLS) sequence, an optional second linker, the cytosine deaminase (APOBEC), the optional first linker, the SeqCas9 mutant protein, an optional fifth linker, the uracil DNA glycosylase inhibitor (UGI), an optional fourth linker, and an optional nuclear localization signal (NLS) sequence.

[0095] By introducing a uracil DNA glycosylase inhibitor (UGI) into the fusion protein, the CBE of the present invention can utilize UGI to inhibit the repair effect of UDG in cells and improve the efficiency of base editing.

[0096] In addition to its repair function of reversing U to C as mentioned above, UDG can also excise U to form an apyrimidine site (AP). After the action of trans-lesion synthesis (TLS) polymerase and DNA replication, there is a certain probability that C will be converted to other bases. And because the formed AP site will produce a gap under AP cleavage or spontaneous cleavage, it will form a DSB with the gap generated by nCas9 in the non-edited chain, and produce Indels products after the NHEJ repair pathway.

[0097] Therefore, in a preferred embodiment, the fusion protein comprises two uracil DNA glycosylase inhibitors (UGI), which are optionally connected by a sixth linker. In this case, the fusion protein comprises, from its N-terminus to its C-terminus, an optional nuclear localization signal (NLS) sequence, an optional second linker, the cytosine deaminase, the optional first linker, the SeqCas9 mutant protein, an optional fifth linker, the uracil DNA glycosylase inhibitor (UGI), an optional sixth linker, the uracil DNA glycosylase inhibitor (UGI), an optional fourth linker, and an optional nuclear localization signal (NLS) sequence.

[0098] By introducing two UGIs into the fusion protein, the CBE of the present invention can reduce unnecessary editing products, improve base editing efficiency, and reduce the conversion frequency from C to A or G.

[0099] In a further preferred embodiment, the amino acid sequence of the fusion protein is shown in SEQ ID NO:10.

[0100] It is understood that the multiple protein parts in the SeqCas9 fusion protein of the present invention may be connected by a linker or not. Linkers are well known in the art, and examples thereof include but are not limited to linkers comprising 1-50, for example 10-32 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG linkers.

[0101] Therefore, in one embodiment, the first to sixth linkers can each independently be a linker of 1-50, for example 10-32 amino acids (such as Glu or Ser) or an amino acid derivative (such as Ahx, β-Ala, GABA or Ava), or a PEG linker.

[0102] Derivatized Protein

[0103] The fusion protein of the first aspect can be further derivatized, for example, by connecting it to another molecule (e.g., a detectable label). Typically, the derivatization of the protein will not adversely affect the desired activity of the protein (e.g., activity binding to a single-stranded guide RNA, endonuclease activity, activity binding to and cutting a specific site of a target sequence under the guidance of a guide RNA). Therefore, the fusion protein of the present invention is also intended to include such derivatized forms. For example, the fusion protein of the present invention can be functionally connected (by chemical coupling, gene fusion, non-covalent connection or other means) to one or more other molecular parts, such as a detectable label, a pharmaceutical agent, etc.

[0104] In particular, the fusion protein of the first aspect can be connected to other functional units. For example, it can be connected to a targeting moiety to make the fusion protein targeting-friendly. For example, it can be connected to a detectable label to facilitate detection of the fusion protein. For example, it can be connected to an epitope tag to facilitate expression, detection, tracing and / or purification of the fusion protein.

[0105] Therefore, in a second aspect of the present invention, the present invention provides a conjugate, the conjugate comprising:

[0106] a) the fusion protein described in the first aspect;

[0107] b) a detectable label; and

[0108] c) an optional seventh linker for connecting the fusion protein to the detectable label, such as a seventh linker with a length of 1-50 amino acids.

[0109] Detectable labels are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0110] The fusion protein of the present invention may be connected to the detectable label via a linker, or may be directly connected to the detectable label without a linker. Linkers are well known in the art, and examples thereof include, but are not limited to, linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG linkers, etc.

[0111] Single-stranded guide RNA

[0112] In a third aspect, the present invention provides a single-stranded guide RNA, wherein the single-stranded guide RNA comprises a guide sequence and a scaffold sequence from the 5' end to the 3' end, wherein the scaffold sequence is:

[0113] a) a scaffold sequence as shown in SEQ ID NO: 11; or

[0114] b) A sequence modified based on the sequence shown in SEQ ID NO: 11 and retaining its biological activity.

[0115] In a specific embodiment, the modification is one or more of base phosphorylation, base sulfurization, base methylation, base hydroxylation, sequence shortening and sequence lengthening.

[0116] In a further specific embodiment, the shortening of the sequence and the lengthening of the sequence comprise the deletion or addition of one, two, three, four, five, six, seven, eight, nine or ten bases relative to the base sequence.

[0117] In another specific embodiment, the guide sequence is a sequence of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length that is capable of complementary pairing with the target sequence.

[0118] In a preferred embodiment, the guide sequence is a sequence with a length of 20 nucleotides and capable of complementary pairing with the target sequence.

[0119] In a further embodiment, the single-stranded guide RNA further comprises a terminator at the 3' end of the scaffold sequence. As an example, the terminator can be a terminator consisting of multiple, such as at least six (eg, seven or eight) Us.

[0120] The single-stranded guide RNA can bind to the SeqCas9 protein or its conjugate or fusion protein with an amino acid sequence as shown in SEQ ID NO: 1, the fusion protein of the first aspect or the conjugate of the second aspect to form a complex, which can recognize the corresponding PAM (e.g., 5'-NNG) and thereby bind to the target sequence, thereby achieving shearing of the target sequence or gene editing.

[0121] Encoding nucleic acid and vector

[0122] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding the fusion protein of the first aspect or the conjugate of the second aspect.

[0123] In a specific embodiment, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO: 14 or 15 or a degenerate sequence thereof.

[0124] In yet another specific embodiment, the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect.

[0125] In a specific embodiment, the isolated nucleic acid molecule further comprises the nucleic acid sequence shown in SEQ ID NO:12.

[0126] In the fifth aspect, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect.

[0127] In a specific embodiment, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO:12.

[0128] After the isolated nucleic acid molecules of the present invention are transfected into corresponding cells using certain tools known in the art, such as expression vectors, the isolated nucleic acid molecules of the present invention can express the fusion protein of the first aspect or the conjugate of the second aspect, and / or the single-stranded guide RNA described above, and perform corresponding functions therein, such as gene editing.

[0129] In addition, the isolated nucleic acid molecule of the present invention can express the fusion protein of the first aspect or the conjugate of the second aspect, and the single-stranded guide RNA individually / separately, or can express the expression product as a whole. The expression method selected depends on the specific situation.

[0130] Furthermore, the expression product has the corresponding effects and / or functions described above, which will not be repeated here for the sake of brevity.

[0131] In a sixth aspect, the present invention provides a vector, comprising: a nucleic acid sequence encoding the fusion protein of the first aspect or the conjugate of the second aspect.

[0132] In a specific embodiment, the vector comprises the nucleic acid sequence shown in SEQ ID NO: 14 or 15 or a degenerate sequence thereof.

[0133] In yet another specific embodiment, the vector further comprises a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect.

[0134] In yet another specific embodiment, the vector comprises the nucleic acid sequence shown in SEQ ID NO:12.

[0135] In a further specific embodiment, the vector can be an expression vector, such as a plasmid vector such as a pUC19 vector, an episome vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0136] In a seventh aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect.

[0137] In a specific embodiment, the vector comprises the nucleic acid sequence shown in SEQ ID NO:12.

[0138] According to the above description, after the vector of the present invention is transfected into cells, the nucleic acid sequence cloned in the vector can be expressed as the fusion protein of the first aspect or the conjugate of the second aspect, and / or the single-stranded guide RNA described above, and perform corresponding functions therein, such as gene editing.

[0139] In addition, multiple vectors, for example, two vectors, can be transfected into cells, wherein one vector expresses the fusion protein of the first aspect or the conjugate of the second aspect, and the other vector expresses the single-stranded guide RNA. Subsequently, the expressed fusion protein of the first aspect or the conjugate of the second aspect is complexed with the expressed single-stranded guide RNA to form a complex, and the corresponding function is performed therein, such as gene editing.

[0140] Of course, the nucleic acid sequence encoding the fusion protein of the first aspect or the conjugate of the second aspect and the nucleic acid sequence encoding the single-stranded guide RNA can also be cloned into a vector, so that after the vector is transfected into the cell, both the fusion protein of the first aspect or the conjugate of the second aspect and the single-stranded guide RNA are expressed and corresponding functions are performed therein, such as gene editing.

[0141] CRISPR / Cas9 gene editing system

[0142] In an eighth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0143] 1) a protein component, comprising: a SeqCas9 protein with an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein of the first aspect, or the conjugate of the second aspect; and

[0144] 2) the single-stranded guide RNA of the third aspect;

[0145] Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex;

[0146] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the fusion protein to the detectable label or the combination;

[0147] The fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the another protein or polypeptide.

[0148] It is understood that in addition to the SeqCas9 protein itself, the SeqCas9 protein can also be combined with, for example, other proteins, detectable tags or a combination thereof to impart other functionalities to the protein.

[0149] Detectable labels are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0150] In a specific embodiment, the additional protein or polypeptide can be selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal sequence, cytosine deaminase, adenine deaminase, cytosine methylase DNMT3A and MQ1, cytosine demethylase Tet1, transcription activator proteins VP64, p65 and RTA, transcription repressor protein KRAB, histone acetylase p300, histone deacetylase LSD1, Gam protein, and endonuclease FokI.

[0151] Epitope tags are well known to those skilled in the art, examples of which include but are not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select a suitable epitope tag according to the desired purpose (e.g., purification, detection or tracing).

[0152] Reporter proteins are well known to those skilled in the art, and examples thereof include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0153] The SeqCas9 protein of the present invention can be connected to the detectable marker, the additional protein or polypeptide, or the combination of the additional protein or polypeptide and the detectable marker through a linker, or can be directly connected to the detectable marker, the additional protein or polypeptide, or the combination of the additional protein or polypeptide and the detectable marker without a linker. Linkers are well known in the art, and examples thereof include, but are not limited to, linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG linkers, etc. In one embodiment, the eighth and ninth linkers are each independently a linker having 1-50, for example 10-32 amino acids.

[0154] The CRISPR / Cas9 gene editing system of the present invention can be directly composed of a SeqCas9 protein or its conjugate or fusion protein, a fusion protein of the first aspect or a conjugate of the second aspect, and a single-stranded guide RNA, whose amino acid sequence is shown in SEQ ID NO: 1, or can be composed of an isolated nucleic acid molecule or vector as described herein, which can subsequently express the fusion protein, conjugate and single-stranded guide RNA, thereby exerting a gene editing effect. The CRISPR / Cas9 gene editing system of the present invention realizes recognition, positioning, cutting and gene editing of the target sequence through the SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect, and the single-stranded guide RNA contained therein.

[0155] The CRISPR / Cas9 gene editing system of the present invention can accurately locate the target sequence. The so-called "accurate positioning" has two meanings: the first meaning is that the CRISPR / Cas9 gene editing system of the present invention itself can recognize and bind to the target sequence, and the second meaning is that the CRISPR / Cas9 gene editing system of the present invention can bring other proteins fused with the SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect, or the protein that specifically recognizes the sgRNA to the position of the target sequence.

[0156] The CRISPR / Cas9 gene editing system of the present invention has low tolerance for non-target sequences. In this article, the so-called "low tolerance" means that the CRISPR / Cas9 gene editing system of the present invention is basically unable or completely unable to recognize and bind to non-target sequences, or is basically unable or completely unable to bring other proteins fused with the SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect, or the protein that specifically recognizes the sgRNA to the position of the non-target sequence.

[0157] Gene Editing Methods

[0158] In a ninth aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the cell or in vitro environment:

[0159] (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein of the first aspect, or the conjugate of the second aspect; and a single-stranded guide RNA of the third aspect;

[0160] (2) the isolated nucleic acid molecule of the fourth aspect and, where appropriate, the isolated nucleic acid molecule of the fifth aspect;

[0161] (3) the vector of the sixth aspect and, if appropriate, the vector of the seventh aspect;

[0162] (4) The CRISPR / Cas9 gene editing system of the eighth aspect;

[0163] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination;

[0164] Wherein, the fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the other protein or polypeptide;

[0165] Wherein, the SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect recognizes a protospacer adjacent motif (PAM) located at the 3' end of the target sequence and having the sequence 5'-NNG.

[0166] The descriptions above of the SeqCas9 protein or its conjugate or fusion protein, detectable marker, additional protein or polypeptide, epitope tag, reporter protein, linker, etc. are also applicable to this aspect of the present invention and will not be repeated here.

[0167] In a specific embodiment, the cell is a prokaryotic cell or a eukaryotic cell, such as an animal cell, such as a mammalian cell, such as a human cell.

[0168] In another specific embodiment, the gene editing includes one or more of gene knockout of the target sequence, site-specific base changes, site-specific insertions, regulation of gene transcription levels, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base conversion, and chromatin imaging tracking.

[0169] In an exemplary embodiment, the single base conversion includes one or more of conversion of guanine G to adenine A, conversion of adenine A to guanine G, conversion of cytosine C to thymine T, or conversion of cytosine C to uracil U, conversion of thymine T to cytosine C.

[0170] For the above items (2) and (3), it can be known from the above contents that the isolated nucleic acid molecule of the fourth aspect of the present invention and the vector of the sixth aspect, in some cases, only contain a nucleic acid sequence encoding SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect, and in other cases contain a nucleic acid sequence encoding SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect and a nucleic acid sequence encoding a single-stranded guide RNA. Therefore, depending on the circumstances, the isolated nucleic acid molecule or the vector may further contain a nucleic acid sequence encoding a single-stranded guide RNA.

[0171] In yet another specific embodiment, the guide sequence of the single-stranded guide RNA forms a complete base complementary pairing structure with the target sequence, and forms an incomplete base complementary pairing structure with a non-target sequence.

[0172] Herein, the incomplete base complementary pairing structure refers to a structure including a portion of base complementary pairing and a portion of non-base complementary pairing, wherein the non-base complementary pairing includes, for example, base mismatch and / or base bulge.

[0173] In a further specific embodiment, the incomplete base complementary pairing structure comprises one or more, for example, two or more base mismatches.

[0174] In a further specific embodiment, the eighth and ninth linkers are each independently linkers having 1-50, such as 10-32 amino acids.

[0175] Thus, the SeqCas9 protein or its conjugate or fusion protein, the fusion protein of the first aspect or the conjugate of the second aspect of the present invention can cut the target site on the target sequence, and under the cutting action of the protein, a double-strand break (DSB) occurs in the target sequence. Furthermore, when the method is performed in a cell, the cut target sequence can be repaired by non-homologous end joining repair or homologous recombination repair pathways in the cell, thereby achieving gene editing of the target sequence. In addition, the fusion protein of the first aspect or the conjugate of the second aspect of the present invention may also include nCas9 (Cas9 nickase, D10A) having only single-stranded DNA cutting activity or dCas9 (catalytically deadCas9) having no endonuclease activity. The nCas9 with single-stranded DNA cutting activity only cuts the single-stranded DNA complementary to the sgRNA, without cutting the other chain. Under the action of adenine deaminase, adenine (A) on the uncut DNA single strand will be converted to hypoxanthine (H) within a certain range, and hypoxanthine (H) will be recognized as guanine (G) during the replication process, thereby achieving the base replacement of adenine (A) to guanine (G). Subsequently, the cut DNA single strand will be repaired through the homologous recombination (HDR) pathway using the uncut DNA single strand as a template to achieve the base replacement of thymine (T) to cytosine (C) on the complementary strand. Similarly, under the action of cytosine deaminase, cytosine (C) on the uncut DNA single strand will be converted to uracil (U) within a certain range, and uracil (U) will be recognized as thymine (T) during the replication process, thereby achieving the base replacement of cytosine (C) to thymine (T). Next, the cut DNA single strand will be repaired through homologous recombination using the uncut single strand as a template, achieving the base replacement of guanine (G) to adenine (A) on the complementary single strand.

[0176] The CRISPR / Cas9 gene editing system of the present invention and the gene editing method using the gene editing system have been found to have an editing efficiency of 25%-84% through experiments. In addition, for the CRISPR / Cas9 gene editing system, the mismatch of the guide RNA at positions 4-20 has a very low fault tolerance. Therefore, the CRISPR / Cas9 gene editing system can edit the target gene with high specificity, has the characteristics of high editing efficiency and low off-target rate, and can be widely used in gene editing in cells or in vitro environments.

[0177] cell

[0178] In an eleventh aspect, the present invention provides a cell, comprising: the isolated nucleic acid molecule of the fourth aspect or the fifth aspect, or the vector of the sixth aspect or the seventh aspect.

[0179] As an example, the cell can be a prokaryotic cell or a eukaryotic cell such as an animal cell. For the animal cell, as an example, it can be a mammalian cell such as a human cell.

[0180] Reagent test kit

[0181] In a twelfth aspect, the present invention provides a kit for gene editing a target sequence in a cell or in vitro environment, comprising:

[0182] a) Any one selected from the following (1) to (4):

[0183] (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, the fusion protein of the first aspect, or the conjugate of the second aspect; and a single-stranded guide RNA of the third aspect;

[0184] (2) the isolated nucleic acid molecule of the fourth aspect and, where appropriate, the isolated nucleic acid molecule of the fifth aspect;

[0185] (3) the vector of the sixth aspect and, if appropriate, the vector of the seventh aspect;

[0186] (4) The CRISPR / Cas9 gene editing system of the eighth aspect;

[0187] as well as

[0188] b) Instructions for performing gene editing on target sequences in cells or in vitro;

[0189] Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination;

[0190] The fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the another protein or polypeptide.

[0191] The descriptions above of the SeqCas9 protein or its conjugate or fusion protein, detectable marker, additional protein or polypeptide, epitope tag, reporter protein, linker, etc. are also applicable to this aspect of the present invention and will not be repeated here.

[0192] Of course, those skilled in the art will appreciate that the kit of the present invention may also include other reagents that are helpful for gene editing.

[0193] Brief description of the sequence involved in the present invention

[0194] SEQ ID NO: 1: SeqCas9 protein sequence

[0195] SEQ ID NO: 2: Amino acid sequence of WT TadA

[0196] SEQ ID NO: 3: Amino acid sequence of Evolved TadA

[0197] SEQ ID NO: 4: Amino acid sequence of APOBEC

[0198] SEQ ID NO: 5: Amino acid sequence of APOBEC-Linker-nSeqCas9

[0199] SEQ ID NO: 6: Amino acid sequence of TadA-Linker-Evolved TadA-Linker-nSeqCas9

[0200] SEQ ID NO: 7: Amino acid sequence of NLS

[0201] SEQ ID NO: 8: Amino acid sequence of UGI

[0202] SEQ ID NO: 9: Amino acid sequence of NLS-TadA-Linker-Evolved TadA-Linker-nSeqCas9-Linker-NLS

[0203] SEQ ID NO: 10: Amino acid sequence of NLS-APOBEC-Linker-nSeqCas9-Linker-UGI-Linker-UGI-Linker-NLS

[0204] SEQ ID NO: 11: Single-stranded guide RNA scaffold sequence for use with SeqCas9 protein

[0205] SEQ ID NO: 12: DNA sequence of single-stranded guide RNA scaffold sequence associated with SeqCas9 protein

[0206] SEQ ID NO: 13: Coding sequence of SeqCas9 protein

[0207] SEQ ID NO: 14: Coding sequence of NLS-TadA-Linker-Evolved TadA-Linker-nSeqCas9-Linker-NLS

[0208] SEQ ID NO: 15: Coding sequence of NLS-APOBEC-Linker-nSeqCas9-Linker-UGI-Linker-UGI-Linker-NLS

[0209] Example

[0210] The present invention is now described with reference to the following examples which are intended to illustrate but not to limit the present invention. It is understood by those skilled in the art that the examples are provided here only for the purpose of describing the present invention in detail and are not intended to limit the scope of the present invention.

[0211] Unless otherwise specified, the experiments and methods described in the examples were performed in accordance with conventional methods well known in the art and described in the references. In addition, for those examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer were used. The reagents or instruments used where the manufacturer is not specified are all conventional products that can be obtained commercially.

[0212] Example 1

[0213] (1) Construction of plasmid pAAV2_Cas9_ITR

[0214] The amino acid sequence of SeqCas9 protein was downloaded from NCBI (SEQ ID NO: 1, its gene accession number is NZ_UHFK01000003).

[0215] The nucleic acid sequence encoding the SeqCas9 protein was codon optimized to obtain a gene sequence of the Cas9 protein that is highly expressed in human cells, as shown in SEQ ID NO: 13.

[0216] The gene sequence shown in SEQ ID NO: 13 obtained above was synthesized and constructed into the pSpCas9(BB)-2A-Puro(PX459) backbone plasmid V2.0 (Addgene platform, catalog #62988) to obtain the plasmid pAAV2_Cas9_ITR.

[0217] (2) Construction of plasmid SeqCas9-PSK-mU6-sgRNA-scaffold

[0218] The pSKB plasmid (Addgene platform, commercially available, catalog #62540) was digested with ClaI and XhoI restriction enzymes, and the digestion system was: 1 μg of plasmid pSKB, 5 μL of 10×rCutSmart buffer (purchased from NEB), 1 μL of ClaI and 1 μL of XhoI restriction enzyme (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 1 hour.

[0219] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0220] The target size DNA fragment was cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0221] Gene synthesis was performed according to the sgRNA scaffold sequence (SEQ ID NO: 11) and constructed on the linearized pSKB backbone to obtain the plasmid SeqCas9-PSK-mU6-sgRNA-scaffold.

[0222] (3) Construction of plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR vector

[0223] The PCR method was used to linearize the pAAV2_Cas9_ITR plasmid expressing the Cas9 protein in (1) and the SeqCas9-PSK-mU6-sgRNA-scaffold plasmid expressing the sgRNA in (2).

[0224] For the pAAV2_Cas9_ITR plasmid, the primer sequences are:

[0225] gttttagagctagaaatagcaagttaaaat; and

[0226] aggtcttctcgaagacccg;

[0227] For the SeqCas9-PSK-mU6-sgRNA-scaffold plasmid, the primer sequences are:

[0228] ccgggtcttcgagaagacctGTTTTAGAGCTGGAAACAGCG; and

[0229] gctatttctagctctaaaacGACTAGTAAAAAAATGCACCCGA.

[0230] The reaction system is as follows:

[0231]

[0232] The PCR run procedure is as follows:

[0233]

[0234] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and the target DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0235] The linearized pAAV2_Cas9_ITR fragment and the linearized SeqCas9-PSK-mU6-sgRNA-scaffold fragment were homologously recombined according to the ratio required by the instructions. The homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0236]

[0237] The reaction conditions are as follows:

[0238]

[0239] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0240] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0241] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR for future use.

[0242] (4) Preparation of linearized plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR

[0243] The plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR prepared in (3) was digested with BbsI restriction endonuclease. The digestion system was: 1 μg of plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 1 hour.

[0244] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0245] The DNA fragment was cut from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pAAV2_Cas9-mU6-sgRNA_ITR containing the coding gene of the SeqCas9 protein and sgRNA scaffold, and its size is 9152 bp.

[0246] The recovered linearized plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0247] (5) Preparation of plasmid pAAV2_Cas9-mU6-sgRNA_ITR

[0248] Design the gRNA sequence, and add the corresponding sticky end sequences (in capital letters) on both sides of the linearized plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR to its sense and antisense strands, and synthesize these two oligonucleotide single-stranded DNAs. The specific sequences are as follows:

[0249] gRNA: gctcggagatcatcattgcg

[0250] Oligo-F:TTTGgctcggagatcatcattgcgGT

[0251] Oligo-R: TAAAACcgcaatgatgatctccgagc.

[0252] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 3μL 10μM oligo-F, 3μL 10μM oligo-R, and 4μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95℃5min, 85℃1min, 75℃_1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃1min, stored at 4℃, and the cooling rate was 0.3℃ / s. After annealing, the obtained product was connected to the linearized pAAV2_Cas9-mU6-sgRNA-scaffold_ITR plasmid obtained in step (4) by DNA ligase (purchased from NEB).

[0253] Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and culture at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0254] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0255] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Cas9-mU6-sgRNA_ITR containing the target sgRNA sequence for expression, which was set aside.

[0256] (6) Transfection of the GFP reporter system HEK293T cell line library containing the target sequence with the plasmid pAAV2_Cas9-mU6-sgRNA_ITR expressing Cas protein and sgRNA

[0257] The GFP reporter system HEK293T cell line library containing the target sequence is obtained in the following way: a 25bp protospacer (as the target sequence) and a 7bp random sequence (as the PAM sequence) are inserted between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation and not expressing. The GFP gene containing the inserted fragment is started with the CMV promoter and constructed on a lentiviral expression vector. This sequence is randomly inserted into the genome of HEK293T cells by lentivirus, making it a stable GFP reporter cell line library. When the target sequence is cut using the gene editing system, the cells will restore the GFP reading frame to some cells through their own repair system, producing green fluorescence. The editing ability and specificity of the gene editing system can be evaluated by counting the GFP positive cell ratio through flow cytometry.

[0258] The transfection process includes the following steps:

[0259] On day 0, the GFP reporter system HEK293T cell line library containing the target sequence was plated in a 10 cm dish according to the transfection requirements, and the cell density was controlled at 30%.

[0260] The GFP reporter system HEK293T cell line library containing the target sequence contains the nucleotide sequence of CMV-ATG-target site-PAM-GFP, wherein the PAM sequence is a 7bp random sequence and the sequence of the target site is GAACGGCTCGGAGATCATCATTGCG.

[0261] On day 1, transfection was performed. The transfection process was as follows:

[0262] Take 2 μg of the plasmid pAAV2_Cas9-mU6-sgRNA_ITR to be transfected and add it to 100 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0263] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix, and 5 μL was drawn. 2000 or PEI was added to 100 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0264] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 minutes, then added to the culture medium of the GFP reporter system HEK293T cell line library containing the target sequence, and continued to be cultured in a 37°C, 5% CO2 incubator.

[0265] After 5 days of culture, the editing of the target gene in the HEK293T cell line library by the CRISPR / SeqCas9 system was observed under a fluorescence microscope. Under the microscope, it was found that the cells transfected with the CRISPR / SeqCas9 system produced green fluorescence, indicating that the target gene in the cell was successfully edited. Subsequently, the cells expressing GFP fluorescence were sorted out by flow cytometry and continued to be enriched and grown.

[0266] (7) Preparation of Next-Generation Sequencing Library

[0267] The enriched HEK293T cell library was collected and genomic DNA was extracted using a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

[0268] The first round of PCR was performed using 2×Q5 Mastermix. The PCR primers are as follows:

[0269] F1 primer: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNgcgagaaaagccttgttt;

[0270] R1 Primer: ACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNCTGAACTTGTGCCGTTTAC.

[0271] The reaction system is as follows:

[0272]

[0273] The PCR run procedure is as follows:

[0274]

[0275] The second round of PCR for sequencing library construction was performed using 2xQ5 Mastermix. The PCR primers are as follows:

[0276] F2 primer: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC;

[0277] R2 primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTG.

[0278] The reaction system is as follows:

[0279]

[0280] The PCR run procedure is as follows:

[0281]

[0282]

[0283] The second round of PCR products were purified using a gel recovery kit according to the steps provided by the manufacturer to purify the DNA fragments of the target size, and the second-generation sequencing library was prepared.

[0284] (8) Analysis of Next-Generation Sequencing Results

[0285] The prepared second-generation sequencing library was subjected to double-end sequencing on a high-throughput sequencer HiseqXTen (Illumina).

[0286] According to the results of the second generation sequencing, the PAM sequence of the HEK293T cell library was analyzed and the PAMlogo diagram was drawn, as shown in Figure 1 As shown, the PAM sequence recognized by the SeqCas9 protein is NNG, which is a simple PAM sequence, indicating that the SeqCas9 protein is advantageous for cell gene editing.

[0287] Example 2

[0288] (1)-(4): Same as steps (1)-(4) of Example 1 to prepare the linearized plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR.

[0289] (5) Preparation of plasmid pAAV2_Cas9-mU6-sgRNA_ITR

[0290] Each gRNA was designed, and its sequence is shown in Table 1. The corresponding sticky end sequences (indicated by capital letters) on both sides of the linearized plasmid pAAV2_Cas9-mU6-sgRNA_ITR were added to its sense and antisense strands, and these oligonucleotide single-stranded DNAs were synthesized. Their specific sequences are also shown in Table 1 below.

[0291] Table 1. Sequences of gRNA and oligonucleotide single-stranded DNA

[0292]

[0293]

[0294] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 3μL 10μM oligo-F, 3μL 10μM oligo-R, and 4μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95℃5min, 85℃1min, 75℃1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, stored at 4℃, and the cooling rate was 0.3℃ / s. After annealing, the obtained product was connected to the linearized pAAV2_Cas9-mU6-sgRNA_scaffold_ITR plasmid obtained in step (2) by DNA ligase (purchased from NEB).

[0295] Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and culture at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0296] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0297] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Cas9-mU6-sgRNA_ITR containing the target sgRNA sequence for expression, which was set aside.

[0298] (6) Transfection of HEK293T cell line with plasmid pAAV2_Cas9-mU6-sgRNA_ITR expressing Cas protein and sgRNA

[0299] On day 0, HEK293T cells containing the target sequence were plated in 6-well plates according to the transfection requirements, with a cell density of about 30%.

[0300] On day 1, transfection was performed. The transfection process was as follows:

[0301] Take 2 μg of the plasmid pAAV2_Cas9-mU6-sgRNA_ITR to be transfected and add it to 100 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0302] Lipofectamine 2000 (purchased from Invitrogen) or polyethyleneimine (hereinafter referred to as PEI, purchased from Polysciences) was flicked to mix well, and 5 μL 2000 or PEI was added to 100 μL Opti-MEM medium (purchased from Gibco), mixed gently, and allowed to stand at room temperature for 5 min.

[0303] The diluted transfection reagent and the diluted plasmid were mixed, gently pipetted to mix, and allowed to stand at room temperature for 20 min. The mixture was then added to the culture medium containing the HEK293T cells to be transfected, and the cells were then placed in a 37°C, 5% CO2 incubator for further culture for 3 days.

[0304] (7) Preparation of Next-Generation Sequencing Library

[0305] HEK293T cells were collected three days after editing, and genomic DNA was extracted using a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

[0306] The first round of PCR was performed using 2×Q5 Mastermix. The PCR primers are shown in Table 2:

[0307] Table 2. List of primers for the first round of PCR in next-generation sequencing

[0308] Location F1 Primer R1 Primer A1 AGACTCATCGTACCCCAGGA TGACAACCACCCCATGAAGC A2 AACCCCTACCAACTGGGACT TCAGAGGACAGGGAGACCAG A3 TGGTGGGAAAGGTGATGATT AGTTTGCTGACCCCTGCTTA E3 AGGAGCAGTCTTTCTGAGGC TGGATTCTTGCTCCAGAGGC E4 GGCCACATCCACTTGCTTTT AACCATCTTCAGCGTTGGCA E5 TGGAGCGCGCCTTCGAG GAGGAAGAGGCTCTAAAGACGG

[0309] The reaction system is as follows:

[0310]

[0311] The PCR run procedure is as follows:

[0312]

[0313] The second round of PCR for sequencing library construction was performed using 2xQ5 Mastermix. The PCR primers are as follows:

[0314] F2 primer: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC;

[0315] R2 primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTG.

[0316] The reaction system is as follows:

[0317]

[0318] The PCR run procedure is as follows:

[0319]

[0320] The second round of PCR products were purified using a gel recovery kit according to the steps provided by the manufacturer to purify the DNA fragments of the target size, and the second-generation sequencing library was prepared.

[0321] (8) Analysis of Next-Generation Sequencing Results

[0322] The prepared second-generation sequencing library was subjected to double-end sequencing on a high-throughput sequencer HiseqXTen (Illumina).

[0323] The editing efficiency of the six target sites calculated by the second generation sequencing is as follows Figure 2 As shown, the X-axis represents the target site and the Y-axis represents the editing efficiency (Indels%). As can be seen from the figure, the editing efficiency of the gene editing system containing SeqCas9 is at least 20%, and the highest can reach at least 80%, which indicates that the gene editing system of the present invention can be effectively used for cell gene editing.

[0324] Example 3

[0325] (1)-(4): Same as steps (1)-(4) of Example 1 to prepare the linearized plasmid pAAV2_Cas9-mU6-sgRNA-scaffold_ITR.

[0326] (5) Preparation of plasmid pAAV2_Cas9-mU6-on target sgRNA or pAAV2_Cas9-mU6-mismatch-sgRNA_ITR

[0327] The sequences of each on-target gRNA and mismatch gRNA were designed, and the corresponding oligonucleotide single-stranded DNAs were shown in Table 3, where the mismatch bases were shown as underlined bold bases in the sequence table.

[0328]

[0329] The obtained oligonucleotide single-stranded DNA corresponding to the on target gRNA and the oligonucleotide single-stranded DNA corresponding to different mismatch gRNAs were annealed separately. The annealing reaction system was: 3μL 10μM oligo-F, 3μL 10μM oligo-R, and 4μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program; the annealing program was as follows: 95℃5min, 85℃1min, 75℃1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, 4℃ storage, cooling rate 0.3℃ / s. After annealing, the obtained products were connected to the obtained linearized pAAV2_Cas9-mU6-sgRNA_scaffold_ITR plasmid by DNA ligase (purchased from NEB).

[0330] Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and culture at 37°C for 1 h to activate and recover the Escherichia coli DH5α competent cells.

[0331] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0332] The E. coli DH5α clones with correct connection verified by sequencing were shaken and plasmids were extracted, namely, the plasmid pAAV2_Cas9-mU6-on target-sgRNA_ITR expressing the above-mentioned on target gRNA sequence and the plasmid pAAV2_Cas9-mU6-mismatch-sgRNA_ITR expressing the above-mentioned different mismatch gRNA sequences were obtained for use.

[0333] (6) Transfection of HEK293T cell lines with plasmids pAAV2_Cas9-mU6-on target-sgRNA_ITR expressing Cas protein and on-target-sgRNA and plasmids pAAV2_Cas9-mU6-mismatch-sgRNA_ITR expressing Cas protein and mismatch-sgRNA

[0334] The obtained plasmid pAAV2_Cas9-mU6-ontarget-sgRNA_ITR expressing Cas protein and on target gRNA sequence and the plasmid pAAV2_Cas9-mU6-mismatch-sgRNA_ITR expressing Cas protein and mismatch gRNA sequence were transfected into the GFP reporter system HEK293T cell line containing the target sequence by liposome method. The transfection process includes the following steps:

[0335] On day 0, HEK293T cells containing the target sequence of GFP reporter system were plated in 6-well plates according to the transfection requirements, and the cell density was controlled at 30%.

[0336] The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-target site-PAM-GFP, wherein the PAM sequence is GAG, and the sequence of the target site is respectively: TCATCATTGCGCTGGATCGT (see Figure 3 ).

[0337] On day 1, transfection was performed. The transfection process was as follows:

[0338] Take 2 μg of the plasmid pAAV2_Cas9-mU6-on target-sgRNA_ITR or 2 μg of the plasmid pAAV2_Cas9-mU6-mismatch-sgRNA_ITR to be transfected and add them to 100 μL Opti-MEM culture medium (purchased from Gibco) and mix them by gently pipetting.

[0339] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix, and 5 μL was drawn. 2000 or PEI was added to 100 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0340] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 minutes, then added to the culture medium of the HEK293T cell line containing the GFP reporter system of the target sequence, and continued to be cultured in a 37°C, 5% CO2 incubator.

[0341] Flow cytometry analysis technology was used to analyze the editing efficiency and off-target rate of the CRISPR gene editing system of the present invention on the target sequence.

[0342] Specifically, HEK293T cell lines were collected after being cultured in a CO2 incubator for 3 days, and their specificity was detected using a flow cytometer (BD Biosciences FACSCalibur), and the GFP positive ratio was analyzed and plotted using FlowJo analysis software.

[0343] The specific detection results of the CRISPR / SeqCas9 gene editing system of the present invention in the GFP reporter system HEK293T cell line containing the target sequence are shown in Figure 3 , where the upper horizontal bar shows the schematic diagram of the GFP reporter system, with a specific target sequence and PAM sequence inserted between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation. Therefore, when the gene editing system cuts the target sequence, the cell's own repair system will restore the GFP reading frame to some cells, producing green fluorescence. Figure 3 The Y axis in the bar graph below represents the percentage of GFP positive cells (%), and the X axis represents the oligonucleotide single-stranded DNA sequences corresponding to the On-target gRNA and mismatch gRNA. Figure 3 It can be seen that the target sites of the CRISPR / SeqCas9 gene editing system of the present invention in the GFP reporter system HEK293T cell line are all edited, and the gene editing ratio mediated by mismatchgRNA is significantly lower than the gene editing ratio mediated by on-target gRNA, which shows that the CRISPR / SeqCas9 gene editing system of the present invention has high editing activity, low off-target rate and high specificity. In the research results of the CRISPR / SeqCas9 gene editing system, no obvious mismatch phenomenon was found in the double base mismatch of 4-20bp, indicating that the CRISPR / SeqCas9 gene editing system has extremely high requirements for the complete pairing between gRNA and target sequence, and has a low fault tolerance rate and high safety in practical application.

[0344] Example 4

[0345] (1) Preparation of linearized plasmid ABEmax

[0346] ABEmax plasmid (Addgene platform, catalog #112101) was used as a template for PCR reaction, and the primer sequences were:

[0347] Primer 1: TGTCTAAGTTGGGCGAAGAAtctggcggctcaaaaagaac

[0348] Primer 2: CCGATACTGTATGTCTTTTCtgaccccccgctgctgc

[0349] The reaction system is as follows:

[0350]

[0351] The PCR run procedure is as follows:

[0352]

[0353] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and a 5526 bp DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0354] (2) Preparation of plasmid pAAV2_tadA(ABEmax)-SeqCas9_ITR

[0355] The linearized ABEmax backbone fragment and the humanized SeqCas9 fragment (SEQ ID NO: 13) synthesized by the company were homologously recombined according to the ratio required by the instructions. The homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0356]

[0357] The reaction conditions are as follows:

[0358]

[0359] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0360] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0361] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_tadA(ABEmax)-SeqCas9_ITR for future use.

[0362] (3) Preparation of plasmid pAAV2_tadA(ABEmax)-nSeqCas9_ITR

[0363] Circular PCR reaction was performed using pAAV2_tadA(ABEmax)-SeqCas9_ITR as template, and the primer sequences were:

[0364] Primer 3: gccatcggcaccaactct

[0365] Primer 4: AGAAGTACAGCATCGGCCTG

[0366] The reaction system is as follows:

[0367]

[0368] The PCR run procedure is as follows:

[0369]

[0370] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and the target size DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by a Lite spectrophotometer (ThermoScientific), and T4 polynucleotide kinase (T4 PNK) and T4 DNA ligase were treated to introduce the D10A mutation of nSeqCas9. The reaction system was as follows:

[0371]

[0372] The reaction conditions are as follows:

[0373]

[0374] 1 μL of T4 DNA ligase (purchased from NEB) was added to the reaction system, and the mixture was mixed by vortexing and incubated at room temperature for 2 h.

[0375] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0376] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0377] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_tadA(ABEmax)-nSeqCas9_ITR for future use.

[0378] (4) Linearization preparation of pAAV2_tadA(ABEmax)-nSeqCas9_ITR

[0379] The pAAV2_tadA(ABEmax)-nSeqCas9_ITR plasmid was digested with NotI restriction endonuclease (purchased from NEB), and the reaction system was: 2 μg of plasmid pAAV2_tadA(ABEmax)-nSeqCas9_ITR, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of NotI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 2 hours.

[0380] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0381] The DNA fragments were cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0382] The recovered linearized fragment pAAV2_tadA(ABEmax)-nSeqCas9_ITR was transferred to the TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0383] (5) Preparation of pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR plasmid

[0384] The PCR reaction was carried out using SeqCas9-PSK-mU6-sgRNA-scaffold (prepared according to Example 1 (2)) as a template, and the primer sequences were:

[0385] Primer 5: CAGATCCGCTAGATGACCGCGATCCGACGCGCCATCTC

[0386] Primer 6: agtgagtcgtattagcggccgctctt ...

[0387] The reaction system is as follows:

[0388]

[0389] The PCR run procedure is as follows:

[0390]

[0391] The PCR product was electrophoresed on a 1.5% agarose gel at 120 V for 30 min, and a 382 bp SeqCas9 sgRNA DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0392] The linearized pAAV2_tadA(ABEmax)-nSeqCas9_ITR fragment and the SeqCas9sgRNA DNA fragment were homologously recombined according to the ratio required by the instructions. The homologous recombinase used was High-fidelity DNA assembly premix (purchased from NEB), the reaction system is as follows:

[0393]

[0394] The reaction conditions are as follows:

[0395]

[0396]

[0397] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0398] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0399] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR for future use.

[0400] (6) Preparation of plasmid pAAV2_SeqABE-sgRNA_ITR

[0401] The pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR plasmid was digested with BbsI restriction endonuclease. The digestion system was: 2 μg plasmid pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR, 5 μL 10×CutSmart buffer (purchased from NEB), 1 μL BbsI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 2 hours.

[0402] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0403] The DNA fragments were cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0404] The recovered linearized plasmid pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0405] An endogenous site target sequence that meets the PAM requirements of the SeqCas9 protein is randomly selected in the human genome, and its corresponding oligonucleotide single-stranded DNA is shown in Table 4 (the bases represented by capital letters in the table are sticky end sequences).

[0406] Table 4. gRNA sequences and corresponding oligonucleotide single-stranded DNA sequences

[0407]

[0408]

[0409] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 3μL 10μM oligo-F, 3μL 10μM oligo-R, and 4μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95℃_5min, 85℃_1min, 75℃_1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, 4℃ storage, and the cooling rate was 0.3℃ / s. After annealing, the obtained product was connected to the linearized pAAV2_tadA(ABEmax)-nSeqCas9-sgRNA-scaffold_ITR vector by DNA ligase (purchased from NEB).

[0410] Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and culture at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0411] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0412] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_SeqABE-sgRNA_ITR containing the target sgRNA sequence for expression, which was set aside.

[0413] (7) Transfection of wild-type HEK293T cell line with pAAV2_SeqABE-sgRNA_ITR plasmid

[0414] The obtained pAAV2_SeqABE-sgRNA_ITR plasmid was transfected into wild-type HEK293T cell line by liposome. The transfection process included the following steps:

[0415] On day 0, HEK293T cells were plated in 6-well plates according to the transfection requirements, and the cell density was controlled at 30%.

[0416] On day 1, transfection was performed. The transfection process was as follows:

[0417] Take 2 μg of the plasmid pAAV2_SeqABE-sgRNA_ITR to be transfected and add it to 100 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0418] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix, and 5 μL was drawn. 2000 or PEI was added to 100 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0419] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 minutes and then added to the culture medium of HEK293T cells to be transfected. The cells were then placed in a 37°C, 5% CO2 incubator and cultured for 7 days.

[0420] (8) Preparation of Next-Generation Sequencing Library

[0421] HEK293T cells were collected seven days after editing, and genomic DNA was extracted using a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

[0422] The first round of PCR was performed using 2×Q5 Mastermix. The PCR primers are shown in Table 5:

[0423] Table 5. List of PCR primers for each endogenous site

[0424] Location F1 Primer R1 Primer A10 TGACCCTCCTCTACCTGACC CTCAAGTGAAGCCCAGCCC A11 AGCCACCTCTCCATCCTCTT ATCCCTGGAGGCAGCAAAC AN1 GGGTACCATGTGACTTCTGGG GCTTCCTCCCAGTTCTCAGG E1 GAGTCCCTGGATGAATGCTC CAGTTTTTCATCAGCAATCTGG E2 AATACACTCAGAGCCCAGTTCC ACTGCAATAACAGGGTAGTGCTT E3 CTTTCCCTGGCCTACCTCAC GTGAGGGACACCCCATTTGA

[0425] The reaction system is as follows:

[0426]

[0427] The PCR run procedure is as follows:

[0428]

[0429] The second round of PCR was performed using 2×Q5 Mastermix, and the PCR primers were the same as the F2 primer and R2 primer given in Example 1 above.

[0430] The reaction system is as follows:

[0431]

[0432] The PCR run procedure is as follows:

[0433]

[0434] The second round of PCR products were purified using a gel recovery kit according to the steps provided by the manufacturer to complete the preparation of the second-generation sequencing library.

[0435] (9) Analysis of Next-Generation Sequencing Results

[0436] The prepared second-generation sequencing library was subjected to double-end sequencing on a high-throughput sequencer HiseqXTen (Illumina).

[0437] The next generation sequencing results were calculated to obtain the editing ratio of adenine A that meets the editing requirements in each endogenous target site, and the results are shown in Figure 4 As can be seen from the figure, the SeqABE base editor successfully performed single-base editing on these endogenous target sites, indicating that the SeqABE base editor has efficient base editing activity and demonstrates its great potential as a base editing tool.

[0438] Example 5

[0439] (1) Preparation of linearized plasmid AncBE4max

[0440] The PCR reaction was carried out using AncBE4max plasmid (Addgene platform, catalog #112100) as a template, and the primer sequences were:

[0441] Primer 1: TGTCTAAGTTGGGCGAAGAAagcggcgggagcggcggg

[0442] Primer 2: CCGATACTGTATGTCTTTTCgctgccgccgctgctgc

[0443] The reaction system is as follows:

[0444]

[0445] The PCR run procedure is as follows:

[0446]

[0447] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and the target size DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0448] (2) Preparation of plasmid pAAV2_Anc-APOBEC1-SeqCas9_ITR

[0449] The linearized AncBE4max backbone fragment and the humanized SeqCas9 fragment (SEQ ID NO: 13) synthesized by the company were homologously recombined according to the ratio required by the instructions. The homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0450]

[0451]

[0452] The reaction conditions are as follows:

[0453]

[0454] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0455] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0456] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Anc-APOBEC1-SeqCas9_ITR for future use.

[0457] (3) Preparation of plasmid pAAV2_Anc-APOBEC1-nSeqCas9_ITR

[0458] Circular PCR reaction was performed using pAAV2_Anc-APOBEC1-SeqCas9_ITR as template, and the primer sequences were:

[0459] Primer 3: GCCATCGGCACCAATTCTGT

[0460] Primer 4: CAGGCCGATACTGTATGTCT

[0461] The reaction system is as follows:

[0462]

[0463] The PCR run procedure is as follows:

[0464]

[0465]

[0466] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and the target size DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM Lite spectrophotometer (ThermoScientific) was used to measure DNA concentration, and T4 PNK treatment and T4 DNA ligase treatment were performed respectively. The reaction system was as follows:

[0467]

[0468] The reaction conditions are as follows:

[0469]

[0470] Add 1 μL of T4 DNA ligase (NEB) to the reaction system, shake and mix, and incubate at room temperature for 2 h.

[0471] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0472] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0473] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Anc-APOBEC 1-nSeqCas9_ITR for future use.

[0474] (4) Linearization preparation of pAAV2_Anc-APOBEC1-nSeqCas9_ITR

[0475] The pAAV2_Anc-APOBECl-nSeqCas9_ITR plasmid was digested with NotI restriction endonuclease (purchased from NEB), and the reaction system was: 2 μg plasmid pAAV2_Anc-APOBEC1-nSeqCas9_ITR, 5 μL 10×CutSmart buffer (purchased from NEB), 1 μL NotI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 2 hours.

[0476] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0477] The DNA fragments were cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0478] The recovered linearized fragment pAAV2_Anc-APOBEC1-nSeqCas9_ITR was transferred to the TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0479] (5) Preparation of pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA_ITR plasmid

[0480] The PCR reaction was carried out using SeqCas9-PSK-mU6-sgRNA-scaffold (prepared according to Example 1 (2)) as a template, and the primer sequences were:

[0481] Primer 5: CAGATCCGCTAGATGACCGCGATCCGACGCGCCATCTC

[0482] Primer 6: agtgagtcgtattagcggccgctctt ...

[0483] The reaction system is as follows:

[0484]

[0485] The PCR run procedure is as follows:

[0486]

[0487] The PCR product was electrophoresed on a 1.5% agarose gel at 120 V for 30 min, and a 382 bp SeqCas9 sgRNA DNA fragment was purified using a gel recovery kit according to the manufacturer's steps. TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0488] The linearized pAAV2_Anc-APOBEC1-nSeqCas9_ITR fragment and the SeqCas9 sgRNA DNA fragment were homologously recombined according to the ratio required by the instructions. The homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0489]

[0490] The reaction conditions are as follows:

[0491]

[0492] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0493] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0494] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA-scaffold_ITR for future use.

[0495] (6) Preparation of plasmid pAAV2_SeqCBE-sgRNA_ITR

[0496] The pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA-scaffold_ITR plasmid was digested with BbsI restriction endonuclease, and the digestion system was: 2 μg plasmid pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA-scaffold_ITR, 5 μL 10×CutSmart buffer (purchased from NEB), 1 μL BbsI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C for 2 hours.

[0497] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0498] The DNA fragments were cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0499] The recovered linearized plasmid pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA-scaffold_ITR was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0500] An endogenous site target sequence that meets the PAM requirements of the SeqCas9 protein is randomly selected in the human genome, and its corresponding oligonucleotide single-stranded DNA is shown in Table 6 (in the table, capital letters represent the bases of the sticky end sequence).

[0501] Table 6. gRNA sequences and corresponding oligonucleotide single-stranded DNA sequences

[0502]

[0503] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 3μL 10μM oligo-F, 3μL 10μM oligo-R, and 4μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95℃_5min, 85℃_1min, 75℃_1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, 4℃ storage, and the cooling rate was 0.3℃ / s. After annealing, the obtained product was connected to the linearized pAAV2_Anc-APOBEC1-nSeqCas9-sgRNA-scaffold_ITR vector by DNA ligase (purchased from NEB).

[0504] Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and culture at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0505] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0506] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pAAV2_SeqCBE-sgRNA_ITR containing the target sgRNA sequence for expression, which was set aside.

[0507] (7) Transfection of wild-type HEK293T cell line with pAAV2_SeqCBE-sgRNA_ITR plasmid

[0508] The obtained pAAV2_SeqCBE-sgRNA_ITR plasmid was transfected into wild-type HEK293T cell line by liposome. The transfection process included the following steps:

[0509] On day 0, HEK293T cells were plated in 6-well plates according to transfection requirements, and the cell density was controlled at 30%.

[0510] On day 1, transfection was performed. The transfection process was as follows:

[0511] Take 2 μg of the plasmid pAAV2_SeqCBE-sgRNA_ITR to be transfected and add it to 100 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0512] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix, and 5 μL was drawn. 2000 or PEI was added to 100 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0513] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 minutes and then added to the culture medium of HEK293T cells to be transfected. The cells were then placed in a 37°C, 5% CO2 incubator and cultured for 7 days.

[0514] (8) Preparation of Next-Generation Sequencing Library

[0515] HEK293T cells were collected seven days after editing, and genomic DNA was extracted using a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

[0516] The first round of PCR was performed using 2×Q5 Mastermix. The PCR primers are shown in Table 7:

[0517] Table 7. List of PCR primers for each endogenous site

[0518]

[0519] The reaction system is as follows:

[0520]

[0521] The PCR run procedure is as follows:

[0522]

[0523] The second round of PCR was performed using 2×Q5 Mastermix, and the PCR primers were the same as the F2 primer and R2 primer given in Example 1 above.

[0524] The reaction system is as follows:

[0525]

[0526] The PCR run procedure is as follows:

[0527]

[0528] The second round of PCR products were purified using a gel recovery kit according to the steps provided by the manufacturer to complete the preparation of the second-generation sequencing library.

[0529] (9) Analysis of Next-Generation Sequencing Results

[0530] The prepared second-generation sequencing library was subjected to double-end sequencing on a high-throughput sequencer HiseqXTen (Illumina).

[0531] The next-generation sequencing results were calculated to obtain the editing ratio of cytosine C that meets the editing requirements in each endogenous target site, and the results are shown in Figure 5 As can be seen from the figure, the SeqCBE base editor successfully performed single-base editing on these endogenous target sites in cells, indicating that the SeqCBE base editor has efficient base editing activity and demonstrates its great potential as a base editing tool.

[0532] Sequence Listing

[0533] SEQ ID NO: 1: SeqCas9 protein sequence

[0534]

[0535] SEQ ID NO: 2: Amino acid sequence of WT TadA

[0536]

[0537] SEQ ID NO: 3: Amino acid sequence of Evolved TadA

[0538]

[0539] SEQ ID NO: 4: Amino acid sequence of APOBEC

[0540]

[0541]

[0542] SEQ ID NO: 5: Amino acid sequence of APOBEC-Linker-nSeqCas9 (lowercase letters on a gray background represent linker)

[0543]

[0544] SEQ ID NO: 6: Amino acid sequence of TadA-Linker-Evolved TadA-Linker-nSeqCas9 (lowercase letters on a gray background represent linker)

[0545]

[0546]

[0547] SEQ ID NO: 7: Amino acid sequence of NLS

[0548]

[0549] SEQ ID NO: 8: Amino acid sequence of UGI

[0550]

[0551] SEQ ID NO: 9: Amino acid sequence of NLS-TadA-Linker-Evolved TadA-Linker-nSeqCas9-Linker-NLS (grey background capital letters represent NLS, grey background lowercase letters represent linker)

[0552]

[0553] SEQ ID NO: 10: Amino acid sequence of NLS-APOBEC-Linker-nSeqCas9-Linker-UGI-Linker-UGI-Linker-NLS (grey background capital letters represent NLS, grey background lowercase letters represent linker)

[0554]

[0555]

[0556] SEQ ID NO: 11: Scaffold sequence of single-stranded guide RNA

[0557]

[0558] SEQ ID NO: 12: DNA sequence of the scaffold sequence of the single-stranded guide RNA

[0559]

[0560] SEQ ID NO: 13: Coding sequence of SeqCas9 protein

[0561]

[0562]

[0563] SEQ ID NO: 14: Coding sequence of NLS-TadA-Linker-Evolved TadA-Linker-nSeqCas9-Linker-NLS (grey background capital letters represent NLS coding sequence, grey background lowercase letters represent linker coding sequence)

[0564]

[0565]

[0566]

[0567] SEQ ID NO: 15: NLS-APOBEC-Linker-nSeqCas9-Linker-UGI-Linker-UGI-Linker-NLS】coding sequence (grey background capital letters represent NLS coding sequence, grey background lowercase letters represent linker coding sequence)

[0568]

[0569]

[0570]

Claims

1. A fusion protein comprising: a) a SeqCas9 mutant protein, which is based on the SeqCas9 protein whose amino acid sequence is shown in SEQ ID NO: 1 and includes a mutation that causes the SeqCas9 protein to lose endonuclease activity (preferably mutations D10A and H847A) or a mutation that causes the SeqCas9 protein to have only single-stranded DNA cleavage activity (preferably mutation D10A); b) another protein or polypeptide; For example, the additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, a cytosine deaminase, an adenine deaminase, a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcription activator protein VP64, p65 and RTA, a transcription repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, a Gam protein, and an endonuclease FokI; and c) an optional first linker for connecting the SeqCas9 mutant protein to the additional protein or polypeptide; Preferably, the fusion protein comprises, from its N-terminus to its C-terminus, an optional nuclear localization signal (NLS) sequence, an optional second linker, the adenine deaminase (e.g., an adenine deaminase having an amino acid sequence as shown in SEQ ID NO: 2) or a dimer thereof (e.g., a dimer of an adenine deaminase having an amino acid sequence as shown in SEQ ID NO: 2, an optional third linker, and an amino acid sequence as shown in SEQ ID NO: 3) or a cytosine deaminase (e.g., a cytosine deaminase having an amino acid sequence as shown in SEQ ID NO: 4), the optional first linker, the SeqCas9 mutant protein, an optional fourth linker, and an optional nuclear localization signal (NLS) sequence; Preferably, the amino acid sequence of the fusion protein is shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:

9.

2. The fusion protein according to claim 1, wherein The fusion protein comprises cytosine deaminase and one or two uracil DNA glycosylase inhibitors (UGI), such as a uracil DNA glycosylase inhibitor (UGI) whose amino acid sequence is shown in SEQ ID NO: 8, and the fusion protein comprises, from its N-terminus to its C-terminus, an optional nuclear localization signal (NLS) sequence, an optional second linker, the cytosine deaminase, the optional first linker, the SeqCas9 mutant protein, an optional fifth linker, the uracil DNA glycosylase inhibitor (UGI), an optional fourth linker, and an optional nuclear localization signal (NLS) sequence; Preferably, the fusion protein comprises two uracil DNA glycosylase inhibitors (UGI), and the two uracil DNA glycosylase inhibitors (UGI) are optionally connected via a sixth linker; Preferably, the first to sixth linkers are each independently a linker of 1-50, for example 10-32 amino acids; Preferably, the amino acid sequence of the fusion protein is as shown in SEQ ID NO:

10.

3. A conjugate, comprising: a) The fusion protein according to claim 1 or 2; b) a detectable label; and c) an optional seventh linker for connecting the fusion protein to the detectable label, such as a seventh linker with a length of 1-50 amino acids.

4. A single-stranded guide RNA, comprising a guide sequence and a scaffold sequence from the 5' end to the 3' end, wherein the scaffold sequence is: a) the scaffold sequence shown in SEQ ID NO: 11; or b) a sequence modified based on the sequence shown in SEQ ID NO: 11 and retaining its biological activity; For example, the modification is one or more of base phosphorylation, base sulfurization, base methylation, base hydroxylation, sequence shortening and sequence lengthening; For example, the shortening of the sequence and the lengthening of the sequence include deletion or addition of one, two, three, four, five, six, seven, eight, nine or ten bases relative to the basic sequence; Preferably, the guide sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides (preferably 20 nucleotides) and capable of complementary pairing with the target sequence.

5. An isolated nucleic acid molecule comprising: a nucleic acid sequence encoding the fusion protein of claim 1 or 2 or the conjugate of claim 3; For example, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO: 14 or 15 or a degenerate sequence thereof.

6. The isolated nucleic acid molecule according to claim 5, further comprising a nucleic acid sequence encoding the single-stranded guide RNA according to claim 4, such as the nucleic acid sequence shown in SEQ ID NO:

12.

7. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA of claim 4, such as the nucleic acid sequence shown in SEQ ID NO:

12.

8. A vector comprising: a nucleic acid sequence encoding the fusion protein of claim 1 or 2 or the conjugate of claim 3, for example, the nucleic acid sequence shown in SEQ ID NO: 14 or 15 or a degenerate sequence thereof; For example, the vector is a plasmid vector such as a pUC19 vector, an episome vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

9. The vector according to claim 8, further comprising a nucleic acid sequence encoding the single-stranded guide RNA according to claim 4, such as the nucleic acid sequence shown in SEQ ID NO:

12.

10. A vector comprising a nucleic acid sequence encoding the single-stranded guide RNA of claim 4, such as the nucleic acid sequence shown in SEQ ID NO:

12.

11. A CRISPR / Cas9 gene editing system, comprising: 1) a protein component comprising: a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, a fusion protein according to claim 1 or 2, or a conjugate according to claim 3; and 2) The single-stranded guide RNA of claim 4; Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex; in, The conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein to the detectable label or the combination; Wherein, the fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the other protein or polypeptide; For example, the additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal sequence, a cytosine deaminase, an adenine deaminase, a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcription activator protein VP64, p65 and RTA, a transcription repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, a Gam protein, and an endonuclease FokI; Preferably, the eighth linker and the ninth linker are each independently a linker having 1-50, such as 10-32 amino acids.

12. A method for gene editing a target sequence in a cell or in vitro environment, the method comprising: Contacting any of the following (1) to (6) with a target sequence in a cell or in vitro environment: (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, a fusion protein according to claim 1 or 2, or a conjugate according to claim 3; and a single-stranded guide RNA according to claim 4; (2) The isolated nucleic acid molecule of claim 5 and the isolated nucleic acid molecule of claim 7; (3) The isolated nucleic acid molecule of claim 6; (4) The vector according to claim 8 and the vector according to claim 10; (5) The vector according to claim 9; (6) The CRISPR / Cas9 gene editing system of claim 11; Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination; Wherein, the fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the other protein or polypeptide; wherein the protein SeqCas9 or its conjugate or fusion protein, the fusion protein of claim 1 or 2, or the conjugate of claim 3 recognizes a protospacer adjacent motif (PAM) located at the 3' end of the target sequence and having the sequence 5'-NNG; For example, the cell is a prokaryotic cell or a eukaryotic cell such as an animal cell, and the animal cell is, for example, a mammalian cell such as a human cell; For example, the gene editing includes one or more of gene knockout of the target sequence, site-specific base change, site-specific insertion, regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base conversion and chromatin imaging tracking, for example, the single base conversion includes one or more of the conversion of guanine G to adenine A, the conversion of adenine A to guanine G, the conversion of cytosine C to thymine T or the conversion of cytosine C to uracil U, and the conversion of thymine T to cytosine C; Preferably, the eighth linker and the ninth linker are each independently a linker having 1-50, such as 10-32 amino acids.

13. The method according to claim 12, wherein: The guide sequence of the single-stranded guide RNA forms a complete base complementary pairing structure with the target sequence, and forms an incomplete base complementary pairing structure with the non-target sequence; For example, the incomplete base complementary pairing structure includes one or more, for example, two or more base mismatches.

14. A cell comprising: the isolated nucleic acid molecule of any one of claims 5-7, or the vector of any one of claims 8-10; For example, the cell is a prokaryotic cell or a eukaryotic cell, such as an animal cell, such as a mammalian cell, such as a human cell.

15. A kit for gene editing a target sequence in a cell or in vitro environment, comprising: a) Any one selected from the following (1) to (6): (1) a SeqCas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or a conjugate or fusion protein thereof, a fusion protein according to claim 1 or 2, or a conjugate according to claim 3; and a single-stranded guide RNA according to claim 4; (2) The isolated nucleic acid molecule of claim 5 and the isolated nucleic acid molecule of claim 7; (3) The isolated nucleic acid molecule of claim 6; (4) The vector according to claim 8 and the vector according to claim 10; (5) The vector according to claim 9; (6) The CRISPR / Cas9 gene editing system of claim 11; as well as b) Instructions for performing gene editing on target sequences in cells or in vitro; Wherein, the conjugate of the SeqCas9 protein comprises: a SeqCas9 protein, a detectable label or a combination of a detectable label and another protein or polypeptide, and optionally an eighth linker for connecting the SeqCas9 protein and the detectable label or the combination; Wherein, the fusion protein of the SeqCas9 protein comprises: the SeqCas9 protein, another protein or polypeptide, and optionally a ninth linker for connecting the SeqCas9 protein and the other protein or polypeptide; Preferably, the eighth linker and the ninth linker are each independently a linker having 1-50, such as 10-32 amino acids.

Images