Rice TGW7 gene, its encoded protein and its application in breeding to improve plant yield

By editing the rice TGW7 gene to inactivate the C-terminus of its encoded protein, the grain width and thousand-grain weight of rice seeds were significantly increased, solving the problem of increasing rice yield and providing genetic resources and molecular breeding strategies for high-yield rice breeding.

CN119876178BActive Publication Date: 2026-01-06RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510149093.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-11
Publication Date
2026-01-06
Estimated Expiration
2045-02-11

AI Technical Summary

Technical Problem

Existing technologies cannot significantly increase rice seed width and thousand-grain weight through gene editing, thus limiting the increase in rice yield.

Method used

By editing the rice TGW7 gene to inactivate the C-terminus of its encoded protein, specific methods include designing and using gRNA molecules and vectors to perform gene editing, generating mutant TGW7 genes, which cause premature termination of protein translation or deletion of key amino acid sequences, thereby increasing seed width and thousand-grain weight.

Benefits of technology

It significantly increases rice seed width and thousand-grain weight, improves rice yield, provides genetic resources and molecular breeding strategies for high-yield rice breeding, and solves the challenges of high-yield rice breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876178B_ABST
    Figure CN119876178B_ABST
Patent Text Reader

Abstract

This invention relates to the rice TGW7 gene and its mutants, the protein it encodes, and its application in breeding to improve plant yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the rice TGW7 gene and its mutants, the protein it encodes, and its application in breeding to improve plant yield. Specifically, this invention relates to mutants of the TGW7 gene that can increase rice seed width and methods for increasing rice seed width and rice yield. Background Technology

[0002] Rice is one of the most important food crops in China and the world, feeding nearly 60% of the global population. Dwarfing and hybridization breeding in the 1960s and 70s significantly increased rice yields, alleviating food shortages caused by population growth. In recent years, with increasing population, decreasing arable land, and worsening environmental problems, continuously increasing yields has become a major challenge for rice production. Developing high-yield rice varieties is crucial for ensuring national food security and addressing arable land shortages.

[0003] The three determinants of rice yield include the number of effective panicles per plant, the number of filled grains per panicle, and grain weight. Grain size is the main determinant of thousand-grain weight and directly affects yield. Therefore, cloning grain-type-related genes and conducting in-depth research and elucidation of the molecular and genetic mechanisms controlling grain size can provide important genetic resources and molecular breeding strategies for high-yield rice breeding, laying the foundation for developing high-yield rice varieties.

[0004] This invention provides a novel mutant of the TGW7 gene. Unexpectedly, the inventors have discovered for the first time that inactivating the C-terminus of the rice TGW7 protein can significantly increase rice seed width, and that rice plants with significantly increased seed width and thousand-grain weight can be obtained through the inactivation mutation of the C-terminus of the rice TGW7 protein. Summary of the Invention

[0005] This invention relates to mutants of the rice TGW7 gene and their use in increasing rice seed grain width and increasing rice yield, as well as methods for obtaining high-yielding rice and increasing rice yield.

[0006] In a first aspect, the present invention provides a nucleic acid molecule that is a mutant of the TGW7 gene, which, compared with the wild-type TGW7 gene of sequence SEQ ID NO:1, includes a mutation that inactivates the C-terminus of the encoded TGW7 protein.

[0007] In a preferred embodiment, the mutation includes: deletion of AA at positions 1699 and 1700 of sequence SEQ ID NO:1; or deletion of TCTCATAT at positions 1678-1685; or insertion of one T after position 1600; or insertion of one A after position 1601.

[0008] In a second aspect, the present invention relates to a protein expressed by a mutated TGW7 gene from the first aspect.

[0009] In a third aspect, the present invention relates to a gRNA molecule for gene editing of the TGW7 gene with the sequence SEQ ID NO:1 to obtain the aforementioned mutated TGW7 gene.

[0010] In a preferred embodiment, the sequence of the gRNA includes SEQ ID NO:5 or SEQ ID NO:13.

[0011] In a fourth aspect, the present invention relates to a method for obtaining the TGW7 gene with the mutation of the first aspect, comprising gene editing of the wild-type TGW7 gene of sequence SEQ ID NO:1 using a gRNA molecule of the third aspect.

[0012] In a fifth aspect, the present invention relates to a vector comprising the gRNA molecule of the third aspect.

[0013] In a preferred embodiment, the vector is a pYL-HU-U3-CCDB-tRNA(K1) vector containing the gRNA molecule (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocotyledonous gene editing vector kit (Hyg)).

[0014] In a sixth aspect, the present invention relates to the use of the mutated TGW7 gene, protein, gRNA molecule, or vector described above for increasing rice seed grain width or increasing rice yield.

[0015] In a seventh aspect, the present invention relates to a method for increasing rice seed grain width or increasing rice yield, comprising inactivating the C-terminus of the TGW7 protein encoded by the TGW7 gene of sequence SEQ ID NO:1, thereby increasing rice seed grain width or increasing rice yield.

[0016] In a preferred embodiment, the method includes inducing a mutation in the rice TGW7 gene of sequence SEQ ID NO:1 by chemical mutagenesis or gene editing, thereby inactivating the C-terminus of the encoded TGW7 protein.

[0017] In a more preferred embodiment, the mutation of the rice TGW7 gene includes: deleting AA at positions 1699 and 1700 of the rice TGW7 gene; or deleting TCTCATAT at positions 1678-1685 of the rice TGW7 gene; or inserting one T after position 1600 of the rice TGW7 gene; or inserting one A after position 1601 of the rice TGW7 gene.

[0018] In a more preferred embodiment, the gene editing method includes using a third-party gRNA molecule to induce a mutation in the rice TGW7 gene.

[0019] In a more preferred embodiment, the chemical mutagenesis method includes radiation mutagenesis.

[0020] In a more preferred embodiment, the method includes transforming callus or plant cells with a carrier according to the fifth aspect, and then regenerating the callus or plant cells into rice plants, thereby obtaining rice plants with increased seed width or yield.

[0021] In an eighth aspect, the present invention relates to a method for preparing rice plants, comprising transforming callus or plant cells with a carrier of the fifth aspect, and then regenerating rice plants from the callus or plant cells.

[0022] In a ninth aspect, the present invention relates to rice seeds, specifically *Oryza sativa* subsp. *keng*, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46090 on August 26, 2024. Compared with wild-type rice seeds, the seeds and their progeny seeds exhibit significantly increased grain width and thousand-grain weight.

[0023] In a tenth aspect, the present invention relates to the use of the aforementioned preserved rice seeds for increasing rice yield.

[0024] In an eleventh aspect, the present invention relates to a method for increasing rice yield, comprising growing the aforementioned preserved rice seeds and harvesting the seeds of the resulting rice plant.

[0025] In a twelfth aspect, the present invention relates to a method for preparing rice plants, comprising growing the aforementioned preserved rice seeds into rice plants.

[0026] In summary, the inventors have discovered for the first time that inactivating the C-terminus of the rice TGW7 protein can significantly increase rice seed width, thereby significantly increasing rice yield. Based on this, the inventors have further obtained rice plants with significantly increased yield. Attached Figure Description

[0027] Figure 1 The results show the phenotypes and grain widths of rice with different TGW7 gene mutations. Figure 1 A shows the mutation locations of different mutants. Figure 1 B shows photographs of the obtained rice seed grain length and width. Figure 1 C and D are photographs of the obtained rice plant height phenotype. Figure 1EH represents the obtained rice grain length, grain width, length / width ratio, and thousand-grain weight. Among them, the cr-tgw7#1 and cr-tgw7#2 lines are two homozygous edited lines obtained in Example 2, whose protein translation terminates prematurely, consisting of the original 558 amino acids and 16 newly synthesized amino acids; the cr-tgw7#3 line has a deletion of 2 amino acids at the N-terminal site; the cr-tgw7#4 line has prematurely terminated protein translation, consisting of the original 8 amino acids and 4 newly synthesized amino acids. Figure 1 A) This is similar to the reported Osftip7-1 and Osftip7-2 mutation sites (Shiyong Song et al., OsFTIP7 determines auxin-mediated anther dehiscence in rice, Nature Plants. Vol 4. July 2018:495-504), showing a complete sterility phenotype. Therefore, it can be concluded that the mutant TGW7 protein in this application has not completely lost its function, but only its C-terminal function.

[0028] Figure 2 Electrophoresis diagrams showing the transformation positivity rates of multiple gene-edited rice varieties are presented, with DNA molecular weight standards of 1000, 750, 500, 250, and 100 bp.

[0029] Figure 3 The plasmid map of the knockout vector in Example 1 is shown.

[0030] Figure 4 The following describes the rice genetic transformation process in Example 2: A. Callus induction; B. Co-culture; C. Screening stage; D. Differentiation and seedling emergence.

[0031] Figure 5 An electrophoresis diagram of the recovered gRNA from Example 1 is shown. The fragment size is 366 bp, and the DNA molecular weight standards are 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp.

[0032] Figure 6 The image shows an electrophoresis diagram of the results of identifying the knockout vector transformed into E. coli by plaque PCR in Example 1. The fragment size is approximately 1200 bp, and the DNA molecular weight standards are 6000, 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp.

[0033] Figure 7 shows the comparison results of grain length and grain width of wild-type and mutant rice of the TGW7 gene in Examples 3-4. Figure 7A A photo of rice seeds. Figure 7B For based on Figure 7ASpecific data on the length, width, and aspect ratio of rice seeds.

[0034] Figure 8 The results of the comparison of grain length and grain width of another batch of wild-type and mutant TGW7 rice in Example 5 are shown. Figure 8 A photo of rice seeds.

[0035] Figure 9 The plasmid map of the knockout vector in Example 3 is shown.

[0036] Figure 10 The differentiation and emergence of rice seedlings in Example 3 are shown.

[0037] Figure 11 The results of the transgenic complementation function verification in Example 4 are shown. Detailed Implementation

[0038] This invention provides a novel mutant of the TGW7 gene. The inventors discovered that inactivating the C-terminus of the rice TGW7 protein results in rice plants with significantly increased seed width and thousand-grain weight.

[0039] "TGW7 gene" refers to rice gene LOC_Os05g30750 (SEQ ID NO:1) (National Rice Data Center (MSU)). "Mutation of TGW7 gene" refers to a mutation of the TGW7 gene that causes the loss of C-terminal function of the encoded protein.

[0040] “gRNA” refers to guide RNA, which in the CRISPR / Cas9 gene editing system directs the Cas9 nuclease or other Cas proteins to recognize and cut specific DNA sequences.

[0041] The present invention provides the following implementation schemes:

[0042] Implementation Scheme 1: A mutated TGW7 gene, which, compared with the wild-type TGW7 gene of sequence SEQ ID NO:1, includes a mutation that inactivates the C-terminus of the encoded TGW7 protein;

[0043] Preferably, the mutation includes: deletion of AA at positions 1699 and 1700 of sequence SEQ ID NO:1; or deletion of TCTCATAT at positions 1678-1685; or insertion of one T after position 1600; or insertion of one A after position 1601.

[0044] Implementation Scheme 2: A protein expressed by the mutated TGW7 gene as described in Implementation Scheme 1.

[0045] Implementation Scheme 3: A gRNA molecule, wherein the sequence of said gRNA includes SEQ ID NO:5 or SEQ ID NO:13.

[0046] Implementation Scheme 4: A method for obtaining the mutated TGW7 gene as described in Implementation Scheme 1, comprising gene editing of the wild-type TGW7 gene of sequence SEQ ID NO:1 using the gRNA molecule as described in Implementation Scheme 3.

[0047] Implementation Scheme 5: A vector comprising the gRNA molecule described in Implementation Scheme 3; preferably, the vector is a pYL-HU-U3-CCDB-tRNA(K1) vector comprising the gRNA molecule.

[0048] Implementation Scheme 6: The use of the mutated TGW7 gene described in Implementation Scheme 1, the protein described in Implementation Scheme 2, the gRNA molecule according to Implementation Scheme 3, or the vector according to Implementation Scheme 5 for increasing rice seed grain width or increasing rice yield.

[0049] Implementation Scheme 7: A method for increasing rice seed grain width or increasing rice yield, comprising inactivating the C-terminus of the TGW7 protein encoded by the TGW7 gene of sequence SEQ ID NO:1, thereby increasing rice seed grain width or increasing rice yield.

[0050] Implementation Scheme 8: According to the method described in Implementation Scheme 7, the rice TGW7 gene with sequence SEQ ID NO:1 is mutated by chemical mutagenesis or gene editing, thereby inactivating the C-terminus of the encoded TGW7 protein;

[0051] Preferably, the mutations in the rice TGW7 gene include: deletion of AA at positions 1699 and 1700 of the rice TGW7 gene; deletion of TCTCATAT at positions 1678-1685 of the rice TGW7 gene; insertion of one T after position 1600 of the rice TGW7 gene; or insertion of one A after position 1601 of the rice TGW7 gene.

[0052] More preferably, the gene editing method includes mutating the rice TGW7 gene using a gRNA molecule according to embodiment 3.

[0053] More preferably, the chemical mutagenesis method includes radiation mutagenesis.

[0054] Implementation Scheme 9: The method according to Implementation Scheme 7, wherein the method includes transforming callus or plant cells with the carrier according to Implementation Scheme 5, and then regenerating rice plants from the callus or plant cells to obtain rice plants with increased seed width or yield.

[0055] Implementation Scheme 10: A method for preparing rice plants, comprising transforming callus tissue or plant cells with a carrier according to Implementation Scheme 5, and then regenerating rice plants from the callus tissue or plant cells. Alternatively, a method for preparing rice plant seeds, comprising transforming callus tissue or plant cells with a carrier according to Implementation Scheme 5, then regenerating rice plants from the callus tissue or plant cells, and harvesting the seeds of the rice plants.

[0056] Implementation Scheme 11: A rice seed, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46090 on August 26, 2024. Compared with wild-type rice seeds, this seed and its progeny seeds showed significantly increased grain width and thousand-grain weight.

[0057] Implementation Plan 12: The aforementioned preserved rice seeds are used to increase the grain width of rice seeds or to increase rice yield.

[0058] Implementation Plan 13: A method for increasing rice seed grain width or increasing rice yield, comprising growing the aforementioned preserved rice seeds and harvesting the seeds of the resulting rice plants.

[0059] Implementation Scheme 14: A method for preparing rice plants, comprising growing the aforementioned preserved rice seeds into rice plants.

[0060] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. All reagents and other materials used in this application are obtainable by those skilled in the art through conventional or commercially available means.

[0061] The following examples are illustrative and not restrictive.

[0062] Example 1: Construction of a knockout vector for the rice TGW7 gene

[0063] 1. Design of gRNA and PCR primers

[0064] Three target sites were designed on the TGW7 gene (SEQ ID NO:1) using the online software CCTop (https: / / cctop.cos.uni-heidelberg.de / ):

[0065] TGGATGTTGACTCTCATATG TGG(SEQ ID NO:2)

[0066] GGCAAACTTTTTCCGTATCATGG(SEQ ID NO:3)

[0067] GTGGAGCATGCGGAAGAGCA AGG(SEQ ID NO:4)

[0068] Three gRNA units (SEQ ID NO:5) were synthesized in tandem with tRNA to edit the TGW7 gene by deleting eight TCTCATAT bases from positions 1678 to 1685. This resulted in a newly translated protein consisting of 558 amino acids and 16 newly synthesized amino acids, compared to the wild-type protein of 774 amino acids translated from the gene.

[0069] tggatgttgactctcatatggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcaggcaaacttttt ccgtatcagttttagagctagaaatagcaagttaaaaaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcagtggagcatgcggaagagca(SEQ IDNO:5)

[0070] Synthesize the following primers for amplifying the target gene:

[0071] D5013-F:cagtGGTCTCatgcatggatgttgactctcatatggttttagagctag(SEQ ID NO:6)

[0072] D5013-R:cagtGGTCTCaaaactgctcttccgcatgctccactg(SEQ ID NO:7)

[0073] 2. PCR amplification

[0074] Using the gRNA unit synthesized from the whole gene as an amplification template, 1 μL of amplification template, 2 μL each of 100 μM D5013-F and D5013-R primers, 20 μL ddH2O, and 25 μL PCR MIX (Wuhan Boyuan Biotechnology Co., Ltd.) were added to a 50 μL PCR system.

[0075] Element volume Nuclease-free water 20μL 2x Biorun pfu PCR Mix (#RBC00) 25μL D5013-F (100μM) 2μL D5013-R (100μM) 2μL template 1μL total 50μL

[0076] Amplification was performed using a PCR instrument according to the prescribed procedure.

[0077]

[0078]

[0079] 3. Electrophoretic recycling

[0080] The PCR amplification products were electrophoresed on a 1.5% agarose gel (5V / cm, 20min). The 366bp sample was separated (electrophoresis image shown below). Figure 5 The electrophoretic fragments were cut out under UV light and recovered using a DNA gel recovery kit (Axygen). The DNA was dissolved and recovered using 30 μL of water.

[0081] 4. Enzyme digestion and ligation

[0082] The empty vector pYL-HU-U3-CCDB-tRNA(K1) (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocotyledonous Gene Editing Vector Kit (Hyg)) was ligated to the fragment using the BSAI one-step method (see [link]). Figure 3 The system and reaction conditions are as follows:

[0083] Enzyme digestion ligation system Element volume Nuclease-free water 8μL 10x buffer 2μL BsaI / Eco31I(#RCA02) 1μL T4 ligase 1μL pYL-HU-U3-CCDB-tRNA(K1) 4μL DNA recycling 4μL total 20μL

[0084] Enzyme digestion and ligation reaction conditions Cycle number 37℃ for 20 minutes 1 37℃ for 10 minutes 5 20℃ for 10 minutes 5 37℃ for 20 minutes 1 80℃ for 5 minutes 1

[0085] 5. The ligation product transforms into competent cells.

[0086] According to the manufacturer's instructions, 5-10 μL of the ligation product was transformed into competent E. coli DH5α cells (produced by Shanghai Weidi Biotechnology Co., Ltd.), and the transformed cells were plated on kanamycin-resistant LB medium and incubated at 37°C for 12 hours.

[0087] 6. Plaque PCR identification

[0088] Ten bacterial colonies were selected, inoculated into 1.5 ml EP tubes, and subjected to PCR identification. The identification primers are as follows:

[0089] Pbw2_F:accggtaaggcgcgccgtagt(SEQ ID NO:8)

[0090] Pbw2_R:gcgattaagttgggtaacgccaggg(SEQ ID NO:9)

[0091] Amplification was performed using the following reaction system and procedure:

[0092] Reaction system:

[0093] Element volume Nuclease-free water 9.5μL 2x Biorun Magic PCR Mix(#RAA00) 12.5μL Pbw2_F(100μM) 1μL Pbw2_R(100μM) 1μL template 1μL total 25μL

[0094] Reaction Procedure

[0095] step Cycle number 94℃ for 5 minutes 1 94℃ 30sec 30 50℃ 45sec 30 72℃ 22sec 30 72℃ for 10 minutes 1 16℃ for 30 minutes 1

[0096] The target band is around 1200bp (see Figure 6 Take the bacterial solutions corresponding to the 3 positive bands and send them for sequencing. Extract plasmids from the bacterial solutions that are correctly sequenced.

[0097] Example 2: Rice mutants obtained by transforming rice callus tissue

[0098] 1. Preparation of Agrobacterium

[0099] 1.1 Plasmid Transformation

[0100] Take 1 μL of the plasmid prepared in Example 1 and add it to 50 μL of EHA105 Agrobacterium competent cells (Wuhan Boyuan Biotechnology Co., Ltd.). After thorough mixing, transfer the mixture to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer the mixture to a 1.5 mL centrifuge tube. Incubate the mixture on a shaker at 30°C and 180 rpm for 30 min. Take 50 μL of the activated Agrobacterium culture and inoculate it onto LB solid medium. Incubate the mixture in the dark at 30°C for 48 h.

[0101] 1.2 Agrobacterium detection

[0102] 1.2.1 Synthesize the corresponding detection primers;

[0103] cas9pl(pyl)-393F:TCGAGAACGGTCGTAAGAGGA(SEQ ID NO:10)

[0104] cas9pl(pyl)-393R:TGTAACGCTTCCTGTCGATGGT(SEQ ID NO:11)

[0105] 1.2.2 Selecting plaques for PCR identification. As shown in the table below, prepare the PCR amplification system, mix thoroughly after preparation, and amplify using a PCR instrument. The amplification program should be set accordingly based on primer information, etc.

[0106] Components volume Forward primer (10 μM) 1μL Negative primer (10 μM) 1μL 2×Taq PCR Mix(#RAB00) 10μL <![CDATA[ddH2O]]> 7μL template 1μL total 20μL

[0107] 1.2.3 Gel electrophoresis detection: Prepare a 1% agarose gel (weigh 1.5g of agarose powder and dissolve it in 150mL of 1×TAE buffer, microwave for about 3 minutes until the liquid becomes transparent. Add EB to the gel casting plate, pour the dissolved agarose liquid into the plate, mix well, insert the comb, and let it stand for 40 minutes until the gel turns milky white), spot the sample, and complete the electrophoresis process.

[0108] 1.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and the sample are clear and the correct size, and the negative control has no band, it indicates that the sample can proceed to the next step.

[0109] 2. Genetic transformation of rice

[0110] 2.1 Induction of callus tissue

[0111] Select rice grains of the Kitaake strain that are free of mold and have normal bud openings. Disinfect with 75% alcohol for 1 min, rinse with sterile water for 1 min each time; disinfect with 15% sodium hypochlorite for 20 min, soak in sterile water for 30 min, and rinse 3 times for 1 min each time; inoculate the disinfected rice grains into induction medium (N6B5 medium) and induce in full light at 27℃ for 6-7 days.

[0112] The components of the induction culture medium are as follows:

[0113]

[0114] 2.2 Agrobacterium infection

[0115] Agrobacterium was picked into the infection solution to prepare OD. 600 =0.2% Agrobacterium resuspension, pick up the callus tissue from 2.1 and place it in an Erlenmeyer flask, add Agrobacterium resuspension, infect for 10-15 minutes, discard the bacterial solution and place it on a filter paper to dry the bacterial solution on the callus surface for 1-2 hours, then transfer the callus tissue to a layer of filter paper (co-culture medium) with the infection solution and co-culture, air dry for about half an hour, and then co-culture at 20℃ for 48-72 hours.

[0116] The components of the inoculum are as follows:

[0117]

[0118]

[0119] 2.3 Callus screening

[0120] Wash the callus from 2.2 with cephalosporin solution 6 to 7 times, soak for 2 hours, dry on filter paper, inoculate into selection medium, and incubate in the dark at 30°C for 20-30 days; inoculate the positive callus grown on the selection medium into the secondary selection medium, and be sure to select single-clone callus during the callus selection process, and incubate in the dark at 30°C for 7-10 days.

[0121] The components of the screening culture medium are as follows:

[0122]

[0123]

[0124] 2.4 Differentiation and Rooting

[0125] Positive callus was inoculated onto differentiation medium (MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L plant gel, final pH of differentiation medium = 5.8), and cultured at 27-30℃ under full light for 15-20 days. After shoots of 2-5 cm differentiated, they were inoculated onto rooting medium (1 / 2 MS medium) and cultured at 30℃ under light for 7-10 days until the seedling stage (see...). Figure 4 ).

[0126] The components of the differentiation culture medium are as follows:

[0127] The components of the rooting medium are as follows:

[0128]

[0129]

[0130] 2.5 Positive vaccine detection

[0131] 2.5.1 Extraction of rice genomic DNA

[0132] Leaves at approximately 2 cm in diameter during the seedling stage were placed in centrifuge tubes and frozen at -80°C for 1 hour. The samples were then homogenized using a tissue homogenizer. 300 μL of extraction buffer containing 200 mM pH 8.0 Tris-HCl, 25 mM pH 8.0 EDTA, and 1% SDS was added and thoroughly mixed. 150 μL of 7.5 M NH4AC solution was added, and the mixture was gently shaken for 2 minutes. The mixture was then centrifuged at 4000 rpm for 15 minutes. 200 μL of the supernatant was extracted and placed in a new centrifuge tube. Two volumes of ice-cold anhydrous ethanol were added, and the tube was centrifuged at 4000 rpm for 15 minutes. The supernatant was discarded, and the sample was thoroughly dried at room temperature. The DNA was dissolved in double-distilled water to obtain the genomic DNA sample to be tested. The sample was stored at 4°C for later use.

[0133] 2.5.2 Perform PCR detection (PCR primers are the same as in 1.2.1), and the detection method is the same as in 1.2 Agrobacterium detection ( Figure 2 ).

[0134] 2.5.3 Genomic DNA of the sample was sequenced (Beijing Bokaisen Biotechnology Co., Ltd.) to confirm the mutation status. The sequencing results showed that the TCTCATAT base was deleted at positions 1678-1685 of the TGW7 gene sequence SEQ ID NO:1 in the rice genome.

[0135] 3. Cultivation of rice and grain width detection

[0136] The gene-edited lines were cultured in artificial climate chambers until maturity. Ten wild-type Kitaake lines and ten tgw7 mutant lines were collected, and grain length, grain width, and thousand-grain weight were recorded. Figure 1 The results showed that the grain length of the tgw7 mutant lines was basically the same as that of the wild-type lines (cr-tgw7#1 and cr-tgw7#2 lines), while the grain width was significantly larger than that of the wild-type lines. Figure 1 B and 1F), with a thousand-grain weight significantly greater than that of the wild-type line (B and 1F). Figure 1 H). This indicates that the C-terminus of the TGW7 gene can regulate rice seed grain shape and yield, and has the potential for production application.

[0137] All reagents used in the above culture medium formulations are commercially available.

[0138] Example 3: Preparation of rice TGW7 gene mutants cr-tgw7#5 and cr-tgw7#6

[0139] The following target site, CCAACATTGTATCAACAAGG (SEQ ID NO:12), was designed on the TGW7 gene, and gRNA was synthesized for gene editing of the TGW7 gene to obtain the following two mutants:

[0140] 1)cr-tgw7#5: An A base is inserted after position 1601 of the TGW7 gene, causing premature termination of TGW7 protein translation. The mutant protein consists of the original 532 amino acids and the newly synthesized 25 amino acids.

[0141] 2)cr-tgw7#6: A T base is inserted after position 1600 of the TGW7 gene, causing premature termination of TGW7 protein translation. The mutant protein consists of the original 532 amino acids and the newly synthesized 25 amino acids (532+25).

[0142] CCTTGTTGATACAATGTTGGGTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTT(SEQ ID NO:13)

[0143] Synthesize the following primers for amplifying the target gene:

[0144] D705-F:cagtggtctcatgcaCCAACATTGTATCAACAAGG(SEQ ID NO:14)

[0145] D750-R:cagtggtctcaaaacCCTTGTTGATACAATGTTGG(SEQ ID NO:15)

[0146] 2. PCR amplification

[0147] Add 1 μL of amplification template, 5 μL each of 100 μM D750-F and D750-R primers, and 40 μL of ddH2O to a 50 μL PCR system. The PCR product sgRNA: CCAACATTGTATCAACAAGG (SEQ ID NO: 12) is obtained by denaturation annealing.

[0148] Element volume Nuclease-free water 40μL D750-F (100μM) 5μL D750-R (100μM) 5μL total 50μL

[0149] Amplification was performed using a PCR instrument according to the prescribed procedure.

[0150] step Cycle number 95℃ for 10 minutes 1 55℃ for 10 minutes 1 14℃ for 5 minutes 1

[0151] The PCR product obtained by denaturation and annealing was removed from the PCR instrument and stored at 4°C to facilitate ligation with the vector pYL-HU-U3-CCDB-tRNA(K1) (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocotyledonous gene editing vector kit (Hyg)).

[0152] 4. Enzyme digestion and ligation

[0153] The empty vector pYL-HU-U3-CCDB-tRNA(K1) (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocotyledonous Gene Editing Vector Kit (Hyg)) was ligated to the fragment using the BSAI one-step method (see [link]). Figure 9 The system and reaction conditions are as follows:

[0154] Enzyme digestion ligation system Element volume Nuclease-free water 8μL 10x buffer 2μL BsaI / Eco31I(#RCA02) 1μL T4 ligase 1μL pYL-HU-U3-CCDB-tRNA(K1) 4μL DNA recycling 4μL total 20μL

[0155] Enzyme digestion and ligation reaction conditions Cycle number 37℃ for 20 minutes 1 37℃ for 10 minutes 5 20℃ for 10 minutes 5 37℃ for 20 minutes 1 80℃ for 5 minutes 1

[0156] 5. The ligation product transforms into competent cells.

[0157] According to the manufacturer's instructions, 5-10 μL of the ligation product was transformed into competent E. coli DH5α cells (produced by Shanghai Weidi Biotechnology Co., Ltd.), and the transformed cells were plated on kanamycin-resistant LB medium and incubated at 37°C for 12 hours.

[0158] 6. Plaque PCR identification

[0159] Ten bacterial colonies were selected, inoculated into 1.5 ml EP tubes, and subjected to PCR identification. The identification primers are as follows:

[0160] Hz5F:accggtaaggcgcgccgtagt(SEQ ID NO:16)

[0161] Hz5R:gcgattaagttgggtaacgccaggg(SEQ ID NO:17)

[0162] Amplification was performed using the following reaction system and procedure:

[0163] Reaction system:

[0164] Element volume Nuclease-free water 9.5μL 2x Biorun Magic PCR Mix(#RAA00) 12.5μL Hz5_F(100μM) 1μL Hz5_R(100μM) 1μL template 1μL total 25μL

[0165] Reaction Procedure

[0166] step Cycle number 94℃ for 5 minutes 1 94℃ 30sec 30 50℃ 45sec 30 72℃ 22sec 30 72℃ for 10 minutes 1 16℃ for 30 minutes 1

[0167] The target band is 1035bp. The bacterial cultures corresponding to the three positive bands are sent for sequencing. Plasmids are extracted from the bacterial cultures that are correctly sequenced.

[0168] 7. Preparation of Agrobacterium

[0169] 7.1 Plasmid Transformation

[0170] Take 1 μL of the prepared plasmid and add it to 50 μL of EHA105 Agrobacterium competent cells (Wuhan Boyuan Biotechnology Co., Ltd.). After thorough mixing, transfer the mixture to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer the mixture to a 1.5 mL centrifuge tube. Incubate the mixture on a shaker at 30℃ and 180 rpm for 30 min. Then, take 50 μL of the activated Agrobacterium culture and inoculate it onto LB solid medium. Incubate the mixture in the dark at 30℃ for 48 h.

[0171] 7.2 Agrobacterium detection

[0172] 7.2.1 Synthesize the corresponding detection primers;

[0173] F:gatcaccgacgagtacaagg(SEQ ID NO:18)

[0174] R:gggtacttctcgtggtaggc(SEQ ID NO:19)

[0175] Fragment size: 339bp

[0176] 7.2.2 Selecting plaques for PCR identification. As shown in the table below, prepare the PCR amplification system, mix thoroughly after preparation, and amplify using a PCR instrument. The amplification program should be set accordingly based on primer information, etc.

[0177] Components volume Forward primer (10 μM) 1μL Negative primer (10 μM) 1μL 2×Taq PCR Mix(#RAB00) 10μL <![CDATA[ddH2O]]> 7μL template 1μL total 20μL

[0178] 7.2.3 Gel electrophoresis detection: Prepare a 1% agarose gel (weigh 1.5g of agarose powder and dissolve it in 150mL of 1×TAE buffer, microwave for about 3 minutes until the liquid becomes transparent. Add EB to the gel casting plate, pour the dissolved agarose liquid into the plate, mix well, insert the comb, and let it stand for 40 minutes until the gel turns milky white), spot the sample, and complete the electrophoresis process.

[0179] 7.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and the sample are clear and the correct size, and the negative control has no band, it indicates that the sample can proceed to the next step.

[0180] 8. Genetic transformation of rice

[0181] 8.1 Induction of callus tissue

[0182] Select rice grains of the Kitaake strain that are free of mold and have normal bud openings. Disinfect with 75% alcohol for 1 min, rinse with sterile water for 1 min each time; disinfect with 15% sodium hypochlorite for 20 min, soak in sterile water for 30 min, and rinse 3 times for 1 min each time; inoculate the disinfected rice grains into induction medium (N6B5 medium) and induce in full light at 27℃ for 6-7 days.

[0183] The components of the induction culture medium are as follows:

[0184]

[0185]

[0186] 8.2 Agrobacterium infection

[0187] Agrobacterium was picked into the infection solution to prepare OD. 600=0.2% Agrobacterium resuspension, pick up the callus tissue from 2.1 and place it in an Erlenmeyer flask, add Agrobacterium resuspension, infect for 10-15 minutes, discard the bacterial solution and place it on a filter paper to dry the bacterial solution on the callus surface for 1-2 hours, then transfer the callus tissue to a layer of filter paper (co-culture medium) with the infection solution and co-culture, air dry for about half an hour, and then co-culture at 20℃ for 48-72 hours.

[0188] The components of the inoculum are as follows:

[0189]

[0190] 8.3 Callus Screening

[0191] Wash the callus from section 8.2 with cephalosporin solution 6 to 7 times, soak for 2 hours, dry on filter paper, inoculate into selection medium, and incubate in the dark at 30°C for 20-30 days; inoculate the positive callus grown on the selection medium into the secondary selection medium, and be sure to select single-clonal callus during the callus selection process, and incubate in the dark at 30°C for 7-10 days.

[0192] The components of the screening culture medium are as follows:

[0193]

[0194] 8.4 Differentiation and Rooting

[0195] Positive callus was inoculated onto differentiation medium (MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L plant gel, final pH of differentiation medium = 5.8), and cultured at 27-30℃ under full light for 15-20 days. After shoots of 2-5 cm differentiated, they were inoculated onto rooting medium (1 / 2 MS medium) and cultured at 30℃ under light for 7-10 days until the seedling stage (see...). Figure 4 ).

[0196] The components of the differentiation culture medium are as follows:

[0197]

[0198]

[0199] The components of the rooting medium are as follows:

[0200]

[0201] 8.5 Positive vaccine detection

[0202] 8.5.1 Extraction of rice genomic DNA

[0203] Leaves at approximately 2 cm in diameter during the seedling stage were placed in centrifuge tubes and frozen at -80°C for 1 hour. The samples were then homogenized using a tissue homogenizer. 300 μL of extraction buffer containing 200 mM pH 8.0 Tris-HCl, 25 mM pH 8.0 EDTA, and 1% SDS was added and thoroughly mixed. 150 μL of 7.5 M NH4AC solution was added, and the mixture was gently shaken for 2 minutes. The mixture was then centrifuged at 4000 rpm for 15 minutes. 200 μL of the supernatant was extracted and placed in a new centrifuge tube. Two volumes of ice-cold anhydrous ethanol were added, and the tube was centrifuged at 4000 rpm for 15 minutes. The supernatant was discarded, and the sample was thoroughly dried at room temperature. The DNA was dissolved in double-distilled water to obtain the genomic DNA sample to be tested. The sample was stored at 4°C for later use.

[0204] 8.5.2 Perform PCR detection (PCR primers are the same as in 1.2.1), and the detection method is the same as in 7.2 Agrobacterium detection.

[0205] 8.5.3 Genomic DNA of the samples was sequenced (Beijing Bokaisen Biotechnology Co., Ltd.) to confirm the mutation status. The results showed that two mutants were successfully obtained: cr-tgw7#5: one A base was inserted after the 1601st position of the TGW7 gene; and cr-tgw7#6: one T base was inserted after the 1600th position of the TGW7 gene.

[0206] 9. Cultivation of rice and detection of grain width

[0207] The gene-edited lines were cultured in artificial climate chambers until maturity. Ten wild-type Kitaake lines and ten tgw7 mutant lines were collected, and grain length, grain width, and thousand-grain weight were recorded. Figure 7A and 7B The results showed that the grain length of the tgw7 mutant lines cr-tgw7#5 and cr-tgw7#6 was basically the same as that of the wild-type lines, while the grain width was significantly larger than that of the wild-type lines. Figure 7A and 7B The thousand-grain weight was significantly greater than that of the wild-type strain. Figure 7B ).

[0208] All reagents used in the above culture medium formulations are commercially available.

[0209] Example 4: Preparation of rice TGW7 gene mutant (566+22)

[0210] 1. Chemical mutagenesis of the panicle of the Kitaake rice line during the flowering stage.

[0211] During the rice flowering period, the panicles of the rice variety "Kitaake" were chemically mutagenized for 40 minutes using a 1mM MNU solution (N-methyl-N-nitrosourea) at pH 4.8 and a 10mM phosphate buffer solution. Specifically, from 10:30 to 11:30 a.m. during the rice flowering period, the pretreated "Kitaake" plants were moved from the field to appropriately sized flowerpots, and five panicles were selected from each pot and marked. In order to control the reproductive cells of the panicles to be at the same growth stage during the MNU solution mutagenization treatment, the unflowered spikelets in the marked panicles were cut off with small scissors.

[0212] 2. Plants with chemically induced ear growth are grown in an artificial climate chamber (30℃ during the day, 12h of light; 22℃ at night, 12h of light; 60% humidity) until maturity for seed harvesting.

[0213] 3. The seeds harvested from the chemical mutagenesis treatment in step 2 were planted again. At maturity, progeny rice seeds were harvested. The grain width and weight of the progeny seeds were compared, and seeds with significantly increased grain width and thousand-grain weight were selected. The mutant strain corresponding to this seed was named tgw7 (see [link to relevant documentation]). Figure 7A , Figure 7B , Figure 8 Meanwhile, the progeny seeds were deposited at the China General Microbiological Culture Collection Center under accession number CGMCC No. 46090 on August 26, 2024.

[0214] 3. By crossing the tgw7 mutant with wild-type Kitaake rice plants, F1 generation seeds were obtained. The F1 generation seeds showed a phenotype similar to that of the wild type. The F2 generation population was then planted. Genetic analysis showed that the seeds of plants with the wild-type phenotype and the seeds of plants with the mutant phenotype had a segregation ratio of 3:1, indicating that the mutant phenotype is controlled by a single recessive nuclear gene.

[0215] 4. Further, 76 typical single plants with the mutant phenotype of tgw7 were selected as pools and their genomes were resequencing and compared with wild-type Kitaake (Beijing Bokaisen Biotechnology Co., Ltd.). It was found that the TGW7 gene has two AA bases deleted at positions 1699 and 1700 of its sequence, which prematurely terminates the protein translation. The mutant protein is composed of the original 566 amino acids and 22 newly synthesized amino acids (566+22).

[0216] 5. Verification of transgenic complementary function

[0217] The wild-type TGW7 gene (SEQ ID NO:1) was transferred into the above mutant using conventional methods, and the grain shape phenotype was restored (see results). Figure 11 This indicates that the granular phenotype is caused by the aforementioned TGW7 gene mutation.

[0218] 5.1 Carrier Construction

[0219] A TGW7 gene overexpression vector was constructed using the plant binary expression plasmid pCAMBIA3300-UBI (Miaoling Biotechnology). Primers 750F / R were designed, and the full-length CDS sequence of the TGW7 gene (which has no introns) was amplified using rice Kitaake DNA as a template. Simultaneously, the pCAMBIA3300-UBI vector and the gene fragment were digested with SacI and BamHI, and the linearized fragment was recovered. The full-length TGW7 gene CDS and the linearized vector were ligated using T4 ligase. Enzyme digestion and sequencing verified the correct overexpression vector: pCAMBIA3300-UBI-TGW7.

[0220] pCAMBIA3300-UBI-TGW7 was transformed into competent Agrobacterium tumefaciens EHA105 cells to obtain Agrobacterium tumefaciens culture of pCAMBIA3300-UBI-TGW7.

[0221] The primer sequences are as follows:

[0222] 750F:CAGgagctcATGATGCAGAGGCCGTTCCG (SEQ ID NO: 20)

[0223] 750R:AGAggatccTTACAACATGCTATCAGTTC(SEQ ID NO:21)

[0224] 5.2 Genetic transformation (specific transformation method is the same as in Example 2)

[0225] To obtain overexpression material of the TGW7 gene, Agrobacterium-mediated genetic transformation was used. The overexpression vector pCAMBIA3300-UBI-TGW7 was transformed into the mutant variety tgw7, and the grain shape phenotype was restored.

[0226] The primers for detecting positive plants are:

[0227] UBI-F: CCTGCCTTCATACGCTAT(SEQ ID NO:22)

[0228] 750JCR:TGAGTACCCATCCAAACG(SEQ ID NO:23)

[0229] The detected fragment size is 584bp.

[0230] Given this mutation, the same mutation can be achieved in the rice TGW7 gene using conventional gene editing techniques.

Claims

1. A mutated TGW7 gene, which, compared to a wild-type TGW7 gene of the sequence SEQ ID NO: 1, lacks the bases AA at positions 1699 and 1700, said mutation inactivating the C-terminal end of the encoded TGW7 protein.

2. A protein expressed from the mutated gene of claim 1. TGW7 2. A protein expressed from the mutated gene of claim 1.

3. The use of the mutated gene of claim 1 or the protein of claim 2 for increasing grain width of rice seeds or for increasing yield of rice. TGW7 3. The use of the mutated gene of claim 1 or the protein of claim 2 for increasing grain width of rice seeds or for increasing yield of rice.

4. A method for increasing grain width of rice seed or increasing yield of rice, comprising inactivating C-terminal of TGW7 protein encoded by wild type gene of sequence SEQ ID NO: 1, thereby increasing grain width of rice seed or increasing yield of rice. TGW7 1. A method for increasing yield of rice, comprising inactivating C-terminal of TGW7 protein encoded by wild type gene of sequence SEQ ID NO: 1, thereby increasing yield of rice. wherein the rice plant is obtained by introducing into a rice plant a nucleic acid molecule encoding a TGW7 protein having the amino acid sequence of SEQ ID NO: 1, wherein the nucleic acid molecule is operably linked to a promoter, and wherein the nucleic acid molecule is not endogenous to the rice plant. TGW7 a deletion of bases AA at positions 1699 and 1700 of the gene, thereby inactivating 5. A method of making a rice plant, comprising deleting the bases AA at positions 1699 and 1700 of the wild type gene of sequence SEQ ID NO: 1 in rice, thereby inactivating the C-terminus of the encoded TGW7 protein, and growing the rice plant to regeneration. TGW7 1. A method of making a rice plant, comprising deleting the bases AA at positions 1699 and 1700 of the wild type gene of sequence SEQ ID NO: 1 in rice, thereby inactivating the C-terminus of the encoded TGW7 protein, and growing the rice plant to regeneration.

Citation Information

Patent Citations

  • Rice thousand kernel weight gene tgw6 mutant as well as preparation method and application thereof

    CN105063061A

  • Application of TGW3 mutant protein in regulation and control of rice grain traits

    CN118308405A