A FaSAP6 gene regulating strawberry fruit firmness and its application
By cloning the strawberry FaSAP6 gene and constructing overexpression or RNAi vectors, strawberry fruit firmness was regulated, solving the problem of fruit softening and achieving regulation of fruit firmness and improvement of storage and transportation performance.
Patent Information
- Application Number
- CN202510149332.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-02-11
AI Technical Summary
In the later stages of strawberry fruit development, the degradation of cell wall substances leads to softening of the fruit, reduced firmness, and impact on shelf life. Current technologies have not been able to effectively control fruit firmness.
By cloning the strawberry FaSAP6 gene and constructing overexpression vectors or RNAi interference vectors, the expression or activity of the FaSAP6 gene in strawberry fruits can be regulated to increase or decrease fruit firmness.
Overexpression of the FaSAP6 gene can increase the firmness of strawberry fruit, and RNAi interference can accelerate fruit softening, providing a molecular means to regulate fruit firmness, delay fruit softening, and improve storage and transportation performance.
Smart Images

Figure CN119876179B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular genetic engineering technology, and in particular to a FaSAP6 gene that regulates the firmness of strawberry fruit and its application. Technical Background
[0002] Strawberries are a valuable horticultural crop, but during the later stages of fruit development, the degradation of cell wall materials leads to cell wall breakdown, resulting in softening and reduced firmness, severely impacting shelf life. This softening during fruit development is primarily attributed to the degradation of cell wall materials by cell wall enzymes, causing cell dissociation. In higher plants, the mesoglea and pectin in the primary cell walls are crucial components for cell wall support and rigidity; these components can be lysed by pectinases, disrupting pectin's adhesive properties and achieving fruit softening. Transcription factors directly or indirectly respond to this softening process, and can also participate in cell wall degradation by regulating the transcription of cell wall enzyme genes. Studies have shown that the NAC transcription factor FvRIF positively regulates fruit softening by binding to the promoters of FvPL2, FvPG2, FvXTH, and FvEXP3. Furthermore, FvRIF is located upstream in the regulation of strawberry fruit ripening, positively regulating fruit ripening by binding to the promoters of anthocyanin pathway genes FvCHS1, FvDFR, FvANS, and FvUFGT. FvWRKY48 can bind to the W-box element of the FvPLA promoter, promoting FvPLA expression and causing fruit softening.
[0003] Stress-associated proteins (SAPs) are a class of zinc finger proteins containing A20 / AN1 domains. SAP proteins can enhance plant resistance to biotic and abiotic stresses, ultimately protecting crop yield. Hou et al. (2022) demonstrated that the soybean A20 / AN1 type zinc finger protein GmSAP5 confers drought tolerance by increasing plant sensitivity to abscisic acid (ABA) and reducing stomatal aperture. Chang et al. (2018 and 2022) confirmed that the orchid SAP genes Pha13 and Pha21 play a central role in SA-mediated antiviral immunity. SAP genes can also regulate plant growth and development, but their effects on fruit firmness have not yet been reported. Summary of the Invention
[0004] To address the problems in the prior art, one of the objectives of this invention is to provide a FaSAP6 gene that regulates the firmness of strawberry fruit. The nucleotide sequence of the FaSAP6 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the FaSAP6 gene is shown in SEQ ID NO.2.
[0005] The second objective of this invention is to provide an application of the FaSAP6 gene, as described above, in regulating the firmness of strawberry fruits.
[0006] Preferably, the firmness of strawberry fruit is increased by enhancing the expression or activity of the FaSAP6 gene; or the firmness of strawberry fruit is reduced by inhibiting the expression or activity of the FaSAP6 gene.
[0007] Preferably, the expression of the FaSAP6 gene is enhanced by using a FaSAP6 overexpression vector, wherein the FaSAP6 overexpression vector is pCAMBIA1302-FaSAP6, and the PCR product of the FaSAP6 gene is obtained by using strawberry fruit cDNA as a template and then ligating it into the pCAMBIA1302-GFP vector.
[0008] Preferably, the expression of the FaSAP6 gene is inhibited by an RNAi interference vector, wherein the RNAi interference vector is FaSAP6-TRV2. The PCR product of the FaSAP6 gene is obtained by using strawberry fruit cDNA as a template and then ligating it into the TRV2 vector in the VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.3.
[0009] A third objective of this invention is to provide a construct for increasing the expression level of the FaSAP6 gene in strawberries, wherein the construct contains the FaSAP6 gene as described above.
[0010] The fourth objective of this invention is to provide a construct for reducing or eliminating FaSAP6 gene expression in strawberries, the construct comprising siRNA complementary to the target mRNA of the FaSAP6 gene.
[0011] A fourth objective of this invention is to provide a host cell containing the construct described above.
[0012] Preferably, the host cell is Agrobacterium tumefaciens GV3101.
[0013] Finally, this invention provides the application of the construct or host cell described above in regulating the firmness of strawberry fruit.
[0014] The beneficial effects of this invention are as follows:
[0015] 1) This invention demonstrates through a transient transformation experiment of strawberries that the FaSAP6 gene can positively regulate the firmness of strawberry fruit. When the FaSAP6 gene is overexpressed, it can increase the firmness of strawberry fruit by increasing the cell wall material of the fruit. When the expression of the FaSAP6 gene is reduced, it will accelerate the softening of strawberry fruit.
[0016] 2) This invention utilizes biochemistry, molecular biology, and transgenic technology to explore the molecular regulatory mechanism of FaSAP6 gene in regulating strawberry fruit firmness, providing new gene resources for molecular breeding to delay fruit softening and improve the storage and transportation performance of strawberry fruit. Attached Figure Description
[0017] Figure 1 This is a PCR gel electrophoresis image of the FaSAP6 gene clone in Example 1 of this application, where M is the DL2000 marker and I is the PCR amplification fragment of FaSAP6.
[0018] Figure 2 This is a comparison diagram of fruit phenotypes after transient expression of the FaSAP6 gene in Example 3 of this application.
[0019] Figure 3 This is a comparison of the expression levels of FaSAP6 and FaPL1 in strawberry fruit after transient expression in Example 3 of this application.
[0020] Figure 4 This is a comparison diagram of fruit firmness after transient expression in Example 3 of this application.
[0021] Figure 5 This is a comparison diagram of pectin lyase activity in Example 3 of this application.
[0022] Figure 6 This is a comparison chart of pectin content in Example 3 of this application. Detailed Implementation
[0023] To facilitate understanding, the technical solution of the present invention will be described in more detail below with reference to embodiments:
[0024] Example 1
[0025] Cloning of the strawberry transcription factor FaSAP6 gene
[0026] Using the yeast one-hybrid system, the 'bait' vector pFaPL1-pAbAi was constructed from the FaPL1 promoter of the octoploid strawberry 'Sweet Charlie'. This vector, along with 'prey' vectors constructed from cDNA libraries of strawberry fruits at different developmental stages, was screened in the yeast strain Y1HGold. Positive single clones were obtained and sequenced. By comparing with the strawberry genome database, the FaSAP6 gene was identified and obtained.
[0027] Design full-length primer pairs based on the full-length sequence of the FaSAP6 gene:
[0028] FaSAP6-F:
[0029]
[0030] FaSAP6-R:
[0031]
[0032] The underlined lines represent the homologous arms on the pCAMBIA1302 vector, and the wavy lines represent the Bgl II and Spe I restriction sites, respectively.
[0033] Total RNA was extracted from 'Sweet Charlie' strawberry fruits during the ripening stage and reverse transcribed into cDNA using a reverse transcription kit. Using this cDNA as a template, PCR was performed on TaKaRa LA Taq thermostable DNA polymerase at 94℃ for 4 min, with 35 cycles of 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 40 sec, and 72℃ for 10 min to obtain the full-length PCR product of the FaSAP6 gene. This PCR product was purified and recovered, and ligated with the pCAMBIA1302 vector (which had been digested and recovered with Bgl II and Spe I) at 25℃ for 30 min using homologous cloning enzymes. The ligation product was then introduced into *E. coli* via heat shock and plated on LB solid medium (50 mg / L). -1 Ampicillin was used to incubate the cells in the dark at 37°C for 16 hours to obtain single clones. Positive clones carrying the FaSAP6 gene were identified by PCR and sequenced, ultimately determining the nucleotide sequence of the FaSAP6 gene.
[0034] Figure 1 The image shows a PCR gel electrophoresis image of the FaSAP6 gene clone. The open reading frame of the FaSAP6 gene sequence is 507 bp in length. The nucleotide sequence of the FaSAP6 gene is shown in SEQ ID NO.1. The FaSAP6 gene encodes 168 amino acids (including the stop codon), and the encoded amino acid sequence is shown in SEQ ID NO.2.
[0035] Example 2
[0036] Construction of FaSAP6 binary expression vector and RNAi interference vector
[0037] 1) Construction of FaSAP6 binary expression vector: The positive monoclonal plasmid DNA from Example 1 and the plasmid DNA carrying the empty vector pCMABIA1302 were introduced into Agrobacterium tumefaciens GV3101 to obtain the positive monoclonal 1302-FaSAP6.
[0038] 2) Construction of RNAi interference vector: A fragment of approximately 212 bp was selected from the 5' end of the FaSAP6 gene, avoiding the conserved domain, and primer pairs for this fragment were designed:
[0039] FaSAP6-TRVF:CG GAATTC TGGCAGCAACATCCATTGGT
[0040] FaSAP6-TRVR:CG GGATCC TAAACCAACACGCTTTCGGC
[0041] The underlined sites are EcoRI and BamHI restriction sites, respectively.
[0042] Using the monoclonal plasmid DNA from Example 1 as a template, a fragment of the FaSAP6 gene was amplified by PCR. This fragment and the plasmid DNA carrying the TRV2 vector were subjected to double digestion reactions with EcoRI and BamHI, respectively. The digested FaSAP6 gene fragment and TRV2 vector fragment were recovered using a gel extraction kit. The two recovered fragments were then ligated using T4 ligase. The ligation product was transformed into *E. coli* using a heat shock method and plated onto a substrate containing 50 mg / L... -1 Single clones were obtained after dark incubation at 37°C for 16 h on LB medium containing kanamycin. Positive clones carrying the FaSAP6 fragment were detected by PCR and sequenced. Positive single clones whose sequences matched those in Example 1 were then transformed with their plasmid DNA and plasmid DNA carrying the TRV2 vector into Agrobacterium tumefaciens GV3101, respectively, to obtain GV3101 positive single clones carrying FaSAP6-TRV2 (SEQ ID NO.3) and the TRV2 vector.
[0043] Example 3
[0044] The effect of the FaSAP6 gene on strawberry fruit firmness
[0045] Using Agrobacterium tumefaciens carrying 1302-FaSAP6, 1302 (control), FaSAP6-TRV2 and TRV2 (control) as described in Example 2, the vectors were injected into strawberry fruits during the green-white stage using a disposable 1mL syringe, allowing the vectors to be expressed transiently in the strawberry fruit.
[0046] To reduce the differences between fruits and the influence of the growth environment on fruit phenotypic changes, expression vectors and empty vectors were injected into the left and right sides of the same fruit, respectively, to facilitate the observation of fruit phenotypic changes.
[0047] When testing fruit firmness using a texture analyzer, the firmness of a single fruit needs to be measured at 2-3 different locations. To reduce uneven injection and avoid excessive differences in firmness at the injection sites, the entire fruit is injected. This involves inserting the needle into the fruit through the stem and injecting the solution. The fruit firmness is then compared after the fruit is fully ripe.
[0048] The specific steps are as follows:
[0049] 1) Agrobacterium tumefaciens GV3101 carrying pCMABIA1302-FaSAP6, pCMABIA1302 (control), FaSAP6-TR V2, and TRV2 (control) were cultured in LB solid medium (containing 50 mg·L⁻¹). -1 Kanamycin and 50 mg / L -1 After obtaining monoclonal antibodies by streaking with rifampicin, select a single monoclonal antibody and inoculate it into 20 mL of solution containing 50 mg / L rifampicin. -1 Kanamycin and 50 mg / L -1 In LB liquid medium containing rifampicin, shake at 200 rpm for 12 hours at 28°C until OD is reached. 600 Approximately 0.6-0.8;
[0050] 2) Transfer the bacterial culture from 1) to a 50mL centrifuge tube, centrifuge at 5000rpm for 5min at room temperature, discard the supernatant, and collect the colonies;
[0051] 3) Use the immersion solution (containing MES at a final concentration of 1.0 mol·L⁻¹) -1 The final concentration of MgCl2 was 1.0 mol·L⁻¹. -1 The final concentration of acetylsuccinone was 1.0 mol·L⁻¹. -1 The bacterial colonies were resuspended to obtain an injection solution;
[0052] 4) Select strawberry fruits of uniform size and without deformities during the green-to-white stage. Using a 1mL sterile syringe, draw up the injection solution. To observe phenotypic changes in the fruit, insert the needle 0.5cm into the fruit surface and squeeze out 100μL of the injection solution. To determine fruit firmness and other indicators, insert the needle 1cm into the fruit stem and squeeze out another 500μL of the injection solution into the fruit. Three replicates of the injected strawberry fruits are set up, with three fruits in each replicate.
[0053] 5) Fruit samples were collected 3 days after injection for real-time quantitative analysis; strawberry fruit phenotypic changes were observed and photographed approximately 10 days after injection; after the fruit was fully ripe, fruit firmness was measured using a texture analyzer. The method for measuring fruit firmness using a texture analyzer is as follows: A TA39 probe was inserted into the fruit at a speed of 0.5 mm / s, 6 mm in diameter. The insertion points were a point at the equator and its opposite surface; the average of the two measurements was taken as the fruit firmness.
[0054] Experimental results:
[0055] See Figures 2-6 . Figure 2This is a comparative diagram of fruit phenotypes after transient expression of the FaSAP6 gene. In the diagram, 1302 represents strawberry fruit injected with the empty pCAMBIA1302 vector; FaSAP6-1302 represents strawberry fruit injected with the FaSAP6-1302 fusion expression vector; TRV2 represents strawberry fruit injected with both the empty TRV2 and TRV1 vectors; and FaSAP6-TRV2 represents strawberry fruit injected with both the FaSAP6-TRV2 recombinant vector and the empty TRV1 vector. It can be seen that overexpression of the FaSAP6 gene in the fruit inhibits fruit ripening, while interference with FaSAP6 gene expression promotes fruit ripening.
[0056] Figure 3 This figure compares the expression levels of FaSAP6 and FaPL1 in strawberry fruits after transient expression. In the figure, A represents the expression level of the FaSAP6 gene after injection of the FaSAP6-1302 fusion expression vector; B represents the expression level of the FaPL1 gene after injection of the FaSAP6-1302 fusion expression vector; C represents the expression level of the FaSAP6 gene after injection of the FaSAP6-TRV2 vector; and D represents the expression level of the FaPL1 gene after injection of the FaSAP6-TRV2 vector. It can be seen that the expression level of the FaSAP6 gene increases while the expression level of FaPL1 decreases in strawberry fruits injected with the FaSAP6-1302 fusion expression vector; conversely, the expression level of the FaSAP6 gene decreases while the expression level of FaPL1 increases in strawberry fruits injected with the FaSAP6-TRV2 vector. Increasing FaSAP6 gene expression inhibits the transcriptional activity of the FaPL1 gene, thereby slowing down the fruit softening process.
[0057] Figure 4 This is a comparison of fruit firmness after transient expression. Compared with the control, the firmness of strawberry fruits injected with the FaSAP6-1302 fusion expression vector was significantly increased, while the firmness of strawberry fruits injected with the FaSAP6-TRV2 vector was significantly decreased. This indicates that the expression of the FaSAP6 gene is related to strawberry firmness, and increasing the expression of the FaSAP6 gene is beneficial to improving the firmness of strawberry fruits.
[0058] Figure 5 This is a comparison of pectin lyase activity in fruit after transient expression. Pectin lyase hydrolyzes pectin, a component of the cell wall, leading to cell wall structure disruption and accelerated fruit softening. Compared to the control, strawberry fruit injected with the FaSAP6-1302 fusion expression vector showed significantly reduced pectin lyase activity, while strawberry fruit injected with the FaSAP6-TRV2 vector showed increased pectin lyase activity.
[0059] Figure 6This is a comparison of pectin content in fruits after transient expression. WSP represents water-soluble pectin, CBP represents covalent pectin, and ISP represents ionic pectin. It can be seen that WSP significantly decreased with FaSAP6 overexpression, while ISP content remained unchanged. Conversely, in strawberry fruits with transient inhibition of FaSAP6 gene expression, WSP significantly increased and CBP content decreased compared to the control. Pectin is an important component of the cell wall; increasing FaSAP6 gene expression can increase pectin content in strawberry fruits, thereby improving fruit firmness.
[0060] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Overexpression FaSAP6 The application of genes in improving the firmness of strawberry fruits, the aforementioned FaSAP6 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application as described in claim 1, characterized in that, The FaSAP6 overexpression vector was used to enhance the expression of the substance. FaSAP6 Gene expression was performed using the FaSAP6 overexpression vector pCAMBIA1302-FaSAP6, with strawberry fruit cDNA as a template. FaSAP6 The PCR product of the gene was obtained and ligated into the pCAMBIA1302-GFP vector.
3. Inhibition FaSAP6 The application of gene expression in reducing strawberry fruit firmness involves inhibiting the expression of the FaSAP6 gene using an RNAi interference vector, specifically FaSAP6-TRV2. The FaSAP6 gene PCR product was obtained using strawberry fruit cDNA as a template and ligated into the TRV2 vector in a VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.
3. FaSAP6 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
Citation Information
Patent Citations
FaHSFB1 gene for promoting ripening and softening of strawberry fruits and application of FaHSFB1 gene
CN118581104A