Application of LbMYB88 gene or LbMYB88 gene overexpression vector in improving plant resistance to drought stress

Abstract

This invention belongs to the field of genetic engineering, specifically involving LbMYB88 Gene or LbMYB88 Application of gene overexpression vectors in improving plant resistance to drought stress. This invention utilizes a newly created... LbMYB88 Overexpression of the gene in wolfberry plants was observed after drought treatment. LbMYB88 The overexpression of the gene in wolfberry plants showed significant resistance compared to the wild type, providing genetic resources for breeding stress-resistant wolfberry varieties and possessing good potential application value. It also lays a theoretical foundation for studying the molecular mechanism of drought resistance in wolfberry.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving LbMYB88 Gene or LbMYB88 Application of gene overexpression vectors in improving plant resistance to drought stress. Background Technology

[0002] Drought stress is a key factor affecting plant survival and growth. In recent years, due to global warming and increased water evaporation, the threat of drought stress to plants has become increasingly severe. Northwest my country is an arid and semi-arid region, and water scarcity is its main characteristic. Therefore, the cultivation of drought-resistant varieties is of great significance for agricultural development and ecological protection in this region.

[0003] Goji berries ( Lycium barbarum ) belongs to the Solanaceae family ( Solanaceae Lycium genus ( Lycium Goji berries are perennial deciduous shrubs whose fruits contain abundant carotenoids, anthocyanins, vitamin C, polysaccharides, and other substances, possessing various physiological functions such as anti-oxidation, anti-aging, and lowering blood sugar and lipids. Goji berries have strong drought resistance, cold resistance, and salt tolerance, making them an important plant in the saline-alkali desert regions of Northwest my country. To further enhance the drought resistance of goji berries and adapt them to more severe environments, it is necessary to accelerate the breeding process and cultivate goji berry germplasm resistant to drought and other abiotic stresses.

[0004] The R2R3-MYB transcription factor family is widely involved in plant growth, development, and abiotic stress processes. For example, in Arabidopsis thaliana... AtMYB59 It exerts a negative regulatory effect, inhibiting root growth. In rice, the OsMYB30 transcription factor negatively regulates the expression of downstream low-temperature response genes during cold stress, thus participating in the cold stress response. (Tomato) SlMYB102 Genes enhance salt tolerance in tomatoes by upregulating the expression of salt stress-related genes. Tomato SlMYB49, as a positive regulator, can enhance the ability to scavenge ROS, inhibit cell membrane damage and cell death, and improve plant resistance to salt stress. However, whether there are related factors in wolfberry involved in abiotic stress remains to be explored. Summary of the Invention

[0005] In view of the above technical problems, the present invention provides LbMYB88 Gene or LbMYB88 Application of gene overexpression vectors in improving plant resistance to drought stress. Utilizing this... LbMYB88 Gene or LbMYB88 Gene overexpression vectors can be used to cultivate wolfberry plants with improved drought resistance.

[0006] The specific technical solution provided by this invention is as follows:

[0007] In a first aspect, the present invention provides LbMYB88 Gene or LbMYB88 Application of gene overexpression vectors in improving plant resistance to drought stress;

[0008] The LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is wolfberry.

[0009] In a preferred embodiment of the present invention, the overexpression vector is composed of the LbMYB88 The gene was obtained by ligating it into the overexpression vector pHellsgate2; the overexpression vector was used for LbMYB88 Gene function studies are used to improve plant resistance to drought stress.

[0010] More preferably, the overexpression vector is constructed according to the following steps:

[0011] Using wolfberry cDNA as a template, primers were designed for PCR amplification to obtain PCR amplification products;

[0012] endonuclease Xba I and Xho I. The overexpression vector pHellsgate2 was double-digested to obtain the linearized overexpression vector pHellsgate2.

[0013] The PCR amplification product is ligated to the linearized overexpression vector pHellsgate2, and the resulting recombinant product is transformed into tool cells to obtain the overexpression vector.

[0014] Furthermore, the primer sequences for PCR amplification are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] Furthermore, the PCR amplification reaction system is as follows: 1 μL of each primer, 7.5 μL of ddH2O, and 2 μL of cDNA; the reaction program is as follows: 95℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 90 s, for 35 cycles; 72℃ for 5 min.

[0016] In a second aspect, the present invention provides LbMYB88 Gene or LbMYB88 The application of gene overexpression vectors in cultivating drought-resistant plants, the aforementioned LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

[0017] As a preferred embodiment of the present invention, cultivating drought-resistant plants includes promoting the growth of drought-resistant plants in the plant. LbMYB88 Gene expression.

[0018] Furthermore, cultivating drought-resistant plants includes... LbMYB88 Gene or LbMYB88 Gene overexpression vectors are introduced into plants.

[0019] Furthermore, cultivating drought-resistant plants involves the following steps:

[0020] The overexpression vector was transferred into competent cells, cultured, and the infection solution was obtained.

[0021] The plant cotyledons were infected with the aforementioned infection solution and cultured to obtain drought-resistant plants.

[0022] Transgenic plants were constructed by transferring the overexpression vector into plants to inhibit the accumulation of MDA, reduce relative conductivity, and increase the SOD and POD activities of wolfberry leaves, thereby reducing the damage of drought stress to wolfberry.

[0023] The competent cells mentioned above can be Agrobacterium competent cells GV3101.

[0024] After infecting the cotyledons of the plant with the aforementioned infection solution, the plants were successively subjected to subculture, selection culture, and rooting culture, and finally transferred to a substrate for culture to obtain drought-resistant transgenic plants; the substrate was vermiculite.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] The present invention provides LbMYB88 Gene overexpression vectors can inhibit the accumulation of MDA content in wolfberry, reduce relative conductivity, and increase SOD and POD activities, thereby reducing the damage of drought stress to wolfberry. Therefore LbMYB88 Genes and their overexpression vectors can be used to improve the drought resistance of wolfberry or to breed drought-resistant varieties of wolfberry.

[0027] The present invention provides LbMYB88 Gene overexpression vectors were used to analyze the drought resistance function of genetically transformed plants, providing a basis for further research. LbMYB88 This provides a theoretical basis for the resistance mechanism of genes and gene utilization. Attached Figure Description

[0028] Figure 1 For pHELLSgate2- LbMYB88 Carrier construction process diagram; among which, Figure 1 The A in the text represents LbMYB88 Image of gene sequence PCR amplification results; Figure 1 In the image, B represents the result of double digestion of the pHELLSgate2 vector; Figure 1 The C in the text represents pHELLSgate2- LbMYB88 Image showing the results of E. coli detection in vectors; Figure 1In this context, D represents pHELLSgate2- LbMYB88 Image showing the detection results of Agrobacterium-mediated recombinant plasmid vector.

[0029] Figure 2 This is a diagram illustrating the genetic transformation stages of black goji berries; among them, Figure 2 In this context, A represents black goji berry seedlings that have been cultured at 25℃ / 22℃ for 16 h of light and 8 h of darkness for 7 days. Figure 2 The B in the text indicates that it contains pHELLSgate2- LbMYB88 Black wolfberry leaf explants infected with Agrobacterium plasmids; Figure 2 In this context, C represents black goji berry explants cultured on a screening medium for 34 days. Figure 2 In this context, D represents a positive black goji berry plant transferred to a rooting medium.

[0030] Figure 3 for LbMYB88 Figure showing the results of obtaining and identifying gene overexpression lines; among them, Figure 3 The A in the text represents pHELLSgate2- LbMYB88 Image of carrier detection results; Figure 3 B in the text represents LbMYB88 Image showing the results of gene expression level detection.

[0031] Figure 4 for LbMYB88 Phenotypic images of plants overexpressing the gene before and after drought stress treatment and after rehydration, with two replicates for each group.

[0032] Figure 5 for LbMYB88 The results of drought tolerance assessment of plants overexpressing the gene before and after drought treatment are shown in the figure; among them, Figure 5 In the figure, A represents the relative electrical conductivity of the plants before and after drought treatment. Figure 5 In the figure, B represents the results of malondialdehyde (MDA) content determination in plants before and after drought treatment. Figure 5 The C in the figure represents the SOD activity measurement results of the plants before and after drought treatment; Figure 5 The "D" in the figure represents the results of POD activity measurement of plants before and after drought treatment. Detailed Implementation

[0033] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0034] Example 1: LbMYB88 Construction of gene overexpression vectors

[0035] 0. Plant materials:

[0036] Ningxia wolfberry ( Lycium barbarum L.), provided by the Lycium barbarum Research Institute of Ningxia Academy of Agricultural and Forestry Sciences.

[0037] two, LbMYB88 Construction of gene overexpression vectors

[0038] 1. RNA extraction

[0039] RNA was extracted from the leaves of Ningxia wolfberry using the NGzol Reagent Total RNA Rapid Extraction Kit (Huiling) according to the kit instructions, and stored at -80℃ for later use.

[0040] 2. Synthesis of the first strand of cDNA

[0041] Reverse transcription was performed using RNA as a template to synthesize the first strand of cDNA using All-in-One First-Strand Synthesis MasterMix (with dsDNase) (Jiangsu Yugong Biotechnology, EG15133S). The specific procedures are as follows:

[0042] Gently pipette and mix 1 μg RNA, 1 μL dsDNase, 1 μL 10× dsDNase buffer, and 10 μL Nuclease-Free Water. Incubate briefly at 37°C for 2 min to remove genomic DNA contamination, then incubate at 65°C for 2 min to obtain the reaction product. Store on ice for later use. Next, take 10 μL of the reaction product, 4 μL All-in-One First-Strand Synthesis Master Mix, and 6 μL Nuclease-Free Water, gently pipette and mix briefly. Incubate at 50°C for 15 min. After the reaction is complete, incubate at 65°C for 5 min to terminate the reaction and obtain cDNA. Store at -20°C.

[0043] 3. Construction of overexpression vectors

[0044] (1) Obtaining PCR products: Primers were designed using Primer Premier 5.0 software. LbMYB88 F and LbMYB88 R, using the cDNA obtained in step 2 as a template, performs PCR amplification with high-fidelity enzyme (Phanta Max SuperFidelity DNA Polymerase, Vazyme) to obtain the target gene. LbMYB88 Products. The PCR products were then analyzed by agarose gel electrophoresis (e.g., ...). Figure 1 As shown in A, the target gene LbMYB88 A clear band was observed at 1395 bp, and the PCR product was recovered using a purification and recovery kit (Huiling, Shanghai).

[0045] PCR reaction conditions: 95℃ for 3 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 90 s, 35 cycles; 72℃ for 5 min.

[0046] The PCR reaction system, totaling 25 μL, consisted of: ddH2O 7.5 μL, 2×Phanta Max Master Buffer 12.5 μL, LbMYB88-F 1 μL, LbMYB88-R 1 μL, dNTP 0.5 μL, template cDNA 2 μL, and Phanta Max Super-Fidelity DNA Polymerase 0.5 μL.

[0047] (2) Use Xho I and Xba I. Restriction endonuclease linearization of the pHELLSgate2 vector. The pHELLSgate2 vector is as follows: Figure 1 As shown in B in the diagram.

[0048] (3) Homologous recombination is used to connect the target gene fragment and the linearized vector.

[0049] Reaction system: LbMYB88 3 μL of the target gene fragment, 2 μL of linearized pHELLSgate2 Vector, and 5 μL of LightNing DNA Assembly Mix Plus.

[0050] Reaction conditions: 50℃ for 60 min.

[0051] (4) pHELLSgate2- LbMYB88The ligation product was transformed into *E. coli* via heat shock. The specific procedure was as follows: 100 μL of competent *E. coli* cells (DH5α) were removed from 80°C and placed on ice to thaw naturally. After thawing, 10 μL of the recombinant product was added to the 100 μL of competent *E. coli* cells, the tube was gently tapped to mix thoroughly, and the mixture was incubated on ice for 30 min. The mixture was then heat-shocked at 42°C for 90 s and immediately placed on ice for 5 min. Next, 600 μL of antibiotic-free LB broth was added, and the mixture was incubated at 37°C with shaking at 200 rpm for 1 h to obtain the bacterial suspension. The suspension was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, and the suspension was resuspended in 50 μL of sterile water. The resuspended suspension was spread onto solid LB broth containing 50 mg / mL spectinomycin (spec) and incubated upside down at 37°C until single colonies were picked. The picked single colonies were resuspended in water and used as templates for 35S-F and... LbMYB88 PCR detection was performed using the -R primers, and the PCR results are as follows: Figure 1 The product, with a length of 1451 bp, was obtained from the C-type gene. After PCR detection, the recombinant plasmid was extracted after overnight incubation in LB liquid medium containing 50 mg / mL spec at 37°C. Using 35S-F primers, the plasmid was sent to a sequencing company for sequencing. The correctly sequenced plasmid was named pHELLSgate2- LbMYB88 .

[0052] (5) Sequencing the correct plasmid pHELLSgate2- LbMYB88 Agrobacterium was transformed using the heat shock method. The specific procedure was as follows: 100 μL of Agrobacterium competent cells GV3101 (Weidi Biotechnology, Shanghai) was removed from 80℃ and placed on ice to thaw naturally; after the Agrobacterium competent cells GV3101 thawed, 5 μL of the recombinant plasmid pHELLSgate2- was aspirated in a clean bench. LbMYB88 Add Agrobacterium competent cells GV3101, gently tap the test tube to mix thoroughly, incubate on ice for 30 min, then in liquid nitrogen for 5 min, water bath at 28°C for 5 min, and then quickly place on ice for 5 min; then add 600 μL of antibiotic-free LB liquid medium, shake on a shaker at 200 rpm / min for 3 h at 28°C; centrifuge the bacterial suspension at 5000 rpm for 5 min, discard the supernatant, and resuspend the bacterial suspension in 100 μL of sterile water; spread the resuspended bacterial suspension onto solid LB medium containing 50 mg / mL kana and 50 mg / mL rifampin, and incubate upside down at 28°C; pick single colonies from the solid LB medium and incubate them in LB liquid medium containing 50 mg / mL kana and 50 mg / mL Rifampin, and then use this as a template for 35S-F and LbMYB88 PCR detection was performed using the -R primer, and the results are as follows: Figure 1The product, with a length of 1451 bp, successfully contained the recombinant plasmid pHELLSgate2-. LbMYB88 The obtained Agrobacterium-mediated bacterial solution was preserved at 80°C with 50% glycerol for later use.

[0053] LbMYB88 The sequence and detection primers are as follows:

[0054] LbMYB88 sequence:

[0055]

[0056] LbMYB88 -F: 5'- CATTTGGAGAGGACACGCTCGAG ATGCAAAATATGAAGAAAAGTGG-3', SEQ IDNO.2;

[0057] LbMYB88 -R: 5'- TCTCATTAAAGCAGGACTCTAGA TTATAGACTGTGGAGGAGGGCT-3', SEQ IDNO .3;

[0058] 35S-F: 5'-GACGCACAATCCCACTATCC-3', SEQ ID NO.4.

[0059] Note: The underlined areas represent homologous sequences at the ends of the upstream / downstream vectors.

[0060] Example 2 LbMYB88 Obtaining gene overexpression plants

[0061] I. Treatment of Black Goji Berry Seeds

[0062] Soak black goji berry seeds in clean water for 20 minutes, discard the water, wash with 75% ethanol for 60 seconds, then wash with a 1:1 volume ratio of 84 disinfectant and sterile water for 8 minutes, shaking continuously. Discard the disinfectant solution, wash three times with sterile water, and then inoculate the black goji berry seeds onto 1 / 2 MS medium. Incubate in a climate chamber at 25℃ / 22℃ with 16 h / 8 h light for 7 days, until most cotyledons are fully expanded. Figure 2 A.

[0063] II. Preparation of explants

[0064] In a clean bench, select sterile seedlings with fully expanded cotyledons, and cut each cotyledon into one explant.

[0065] The obtained cotyledon explants were placed on KCMS pre-culture medium and cultured at 25°C in the dark for 1 day.

[0066] The KCMS pre-culture medium formula is as follows: weigh 4.43 g / L MS powder, 30 g / L sucrose, adjust the pH to 5.8, add 7.5 g / L agar, and autoclave at 121℃ for 21 min.

[0067] III. Explant Infection

[0068] 1. Take pHELLSgate 2- LbMYB88 Agrobacterium GV3101 was activated by streaking on LB solid medium containing 50 mg / L Rif and 50 mg / L Kan.

[0069] 2. Pick a single colony and add it to 15 mL of LB liquid medium containing 50 mg / L Rif and 50 mg / L Kan. Incubate at 28°C with shaking until OD reaches 100%. 600 = Around 0.8.

[0070] 3. Centrifuge at 5000 rpm for 5 minutes to collect bacteria, discard the supernatant, add an equal volume of Agrobacterium suspension, and infect the wolfberry explants. Figure 2 B.

[0071] The LB liquid medium consisted of 5 g / L yeast extract, 5 g / L tryptone, and 10 g / L sodium chloride; the LB solid medium consisted of 5 g / L yeast extract, 5 g / L tryptone, 10 g / L sodium chloride, and 15 g / L agar.

[0072] Agrobacterium suspension: Weigh 4.43 g / L MS powder and 30 g / L sucrose, adjust the pH to 5.8, and autoclave at 121℃ for 21 min.

[0073] MS powder: Phytotech, M524.

[0074] IV. Screening and Rooting Culture

[0075] After explant infection, the surface of Agrobacterium was aspirated and the explants were cultured in the dark on KCMS medium for two days. They were then transferred to selection medium until adventitious shoots appeared. The selection medium was changed every two weeks during this period. Figure 2 C; Transfer the adventitious buds to a rooting medium to induce rooting, such as Figure 2 In the middle D; after rooting, wild-type and transgenic plants with similar growth were selected and transferred to vermiculite to obtain wolfberry seedlings for subsequent experiments.

[0076] Screening medium formulation: Weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose, and bring the volume to 1L. Adjust the pH to 5.8, add 7.5g agar, autoclave at 121℃ for 21min, and after cooling, add antibiotics: 0.05mg / L 6-BA + 0.02mg / L NAA + 360mg / L TMT (termethin) + 50mg / L kana.

[0077] Rooting medium: Weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose and 2mg / L IBA (indole-3-butyric acid), and bring the volume to 1000mL. Adjust the pH to 5.8, add 7.5g agar, autoclave at 121℃ for 21min, and after cooling, add antibiotics 360mg / L TMT + 50mg / L kana.

[0078] V. Identification of Transgenic Plants

[0079] 1. Extraction of transgenic black goji berry plants using the CTAB method ( LbMYB88 DNA from leaves of wild-type black goji berry (WT-Lr) plants (-OE-Lr). The specific procedure was as follows:

[0080] (1) Take fresh leaves and place them in a 2mL centrifuge tube containing steel balls. After being quickly frozen with liquid nitrogen, grind them into powder evenly.

[0081] (2) Add 600 μL CTAB extract, shake to mix, and incubate in a water bath at 65°C for 30 min.

[0082] (3) Add 600 μL of chloroform to the fume hood, shake to mix, and centrifuge at 12000 rpm for 10 min.

[0083] (4) Carefully aspirate 400 μL of supernatant with a 1 mL pipette, transfer it to a new centrifuge tube, add an equal volume of isopropanol, mix well, and place in a -20℃ refrigerator for 1 h to settle.

[0084] (5) Centrifuge at 12000 rpm for 10 min and discard the supernatant.

[0085] (6) Add 1 mL of 75% ethanol by volume, shake to mix, centrifuge at 12000 rpm for 5 min, discard the supernatant, and place in a fume hood to evaporate the ethanol.

[0086] (7) Finally, add 100 μL of Tris-HCl solution, mix thoroughly, and store the DNA sample in a -20°C freezer. Tris-HCl: 10 mM, pH 8.0.

[0087] 2. Using primers 35SF and LbMYB88 R was used to perform PCR detection on the extracted DNA. The results are as follows: Figure 3 As shown in A in Table 1, positive wolfberry seedlings were successfully obtained. Subsequently, the primers in Table 1 were used... LbMYB88 RTF and LbMYB88 RTR, with LbACTIN As an internal reference gene, it was detected in the leaves of 8 positive wolfberry seedlings and wild-type wolfberry plants using qRTPCR. LbMYB88 Gene expression levels were measured, and the results showed that, compared with the wild type, the expression levels of the eight overexpressing wolfberry seedlings were significantly lower. LbMYB88 Gene expression levels were significantly higher in the human body than in the wild type. Figure 3 (B in the middle).

[0088] Table 1 Quantitative Primers

[0089]

[0090] Example 3 LbMYB88 Analysis of drought resistance genes in wolfberry

[0091] 1. Select wild-type wolfberry plants (WTLr) and transgenic wolfberry plants with uniform growth. LbMYB88 OELr8 and LbMYB88- OELr14 was subjected to drought treatment.

[0092] The specific procedures are as follows: Wild-type wolfberry plants (WTLr) and transgenic wolfberry plants cultured for 30 days were respectively... LbMYB88 OELr8 and LbMYB88- OELr14: Water thoroughly, drain excess water after the plant has absorbed enough water, stop watering, and allow it to dry naturally; wild-type wolfberry plants (WTLr) and transgenic wolfberry plants (no drought treatment, normal water supply) LbMYB88 OELr8 and LbMYB88- OELr14 was used as a control (CK).

[0093] The results are as follows Figure 4 As shown, on the 10th day of drought treatment, the leaves of the wild-type wolfberry plant WTLr showed significant wilting, while those of the transgenic wolfberry plant... LbMYB88 OELr8 and LbMYB88- OELr14 showed milder wilting; on day 13 of drought treatment, wild-type wolfberry plants (WTLr) wilted completely, while transgenic wolfberry plants... LbMYB88 OELr8 and LbMYB88- The leaves of OELr14 showed less wilting than those of the wild-type wolfberry plant WTLr; after two days of rehydration, the wild-type wolfberry plant WTLr failed to survive, while the transgenic wolfberry plant... LbMYB88 OELr8 and LbMYB88- OELr14 survived normally.

[0094] 2. Test the WTLr of wild-type wolfberry plants and transgenic wolfberry plants after 13 days of drought treatment. LbMYB88 OELr8 and LbMYB88- The relative electrical conductivity, malondialdehyde (MDA) content, and activities of superoxide dismutase (SOD) and peroxidase (POD) in OELr14 leaves were measured. The specific procedures are as follows:

[0095] (1) Determination of relative conductivity: Add 10 mL of ultrapure water to a 15 mL centrifuge tube, and then add 6 blades with a diameter of 0.5 cm to the centrifuge tube. Place the centrifuge tube in a shaker at 28 °C and shake for 2 hours to measure the initial conductivity (EC1). Subsequently, boil the sample in water for 30 minutes, and after naturally cooling to room temperature, measure the final conductivity (EC2). The formula for calculating relative conductivity (REL) is REL = EC1 / EC2 × 100%.

[0096] (2) Determination of malondialdehyde content and SOD and POD enzyme activities:

[0097] 1) Enzyme extraction:

[0098] Weigh 0.1-0.2g of wolfberry leaves using a 0.01g balance and place them in a pre-cooled mortar. Transfer the homogenate to a centrifuge tube, bring the volume to 1mL with phosphate buffer, and then place the centrifuge tube in an ice box. Centrifuge at 12000rpm for 20min at 4℃. The supernatant is the enzyme solution. After centrifugation, keep the solution in an ice box and immediately measure the activity of antioxidant and other enzymes.

[0099] 2) Determination of malondialdehyde content

[0100] 0.5% TBA (volume percentage): Weigh 5g of trichloroacetic acid and dissolve it in 100mL of water. Then weigh 0.5g of TBA, dissolve it in 10mL of 1M NaOH, and finally dilute to 100mL with the freshly prepared 5% trichloroacetic acid solution.

[0101] The method for preparing NaOH is to dissolve 4g in 100mL of water.

[0102] This reagent should be prepared and used immediately, stored at room temperature and protected from light. Add 300 μL of 0.5% TBA and 150 μL of enzyme solution sequentially to a 1.5 mL centrifuge tube, mix well, and incubate in a boiling water bath at 100°C for 20 min. After 20 min, immediately place the tube in an ice-water bath to cool to room temperature. After cooling, centrifuge at 3000 rpm for 10 min, collect the supernatant, and measure the absorbance at 532 nm, 600 nm, and 450 nm using a UV spectrophotometer.

[0103] The calculation formula is:

[0104] MDA concentration (μmol / L) = 6.45 (OD) 532nm -OD 600nm -0.56×OD 450nm .

[0105] MDA content (μmol / g Fw) = MDA concentration (μmol / L) × extraction liquid volume (mL) / fresh weight of plant tissue (g).

[0106] 3) Determination of POD activity

[0107] Prepare 50 mM (pH 7.0) phosphate buffer; add 1021 μL of 100 mM H2O2 (30% v / v) to a final volume of 100 mL, store at 4°C protected from light, and use immediately; add 0.4 mL of 100 mM guaiacol to a final volume of 100 mL, and store at 4°C. Initiate the reaction by adding 230 μL of 50 mM (pH 7.0) phosphate buffer, 30 μL of 100 mM guaiacol, 15 μL of enzyme solution, and 30 μL of 100 mM H2O2 sequentially. Measure the reaction at 470 nm using kinetic curves.

[0108] The calculation formula is:

[0109] POD activity (μmol g) -1 s -1 =(ΔA470nm×1) / (0.015×FW×26.8×60×3)=(absorbance value×extraction volume) / (enzyme solution volume used in the determination×sample fresh weight×extinction coefficient×time).

[0110] 4) Determination of SOD activity

[0111] The sample tubes were sequentially supplemented with 160 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium (NBT) solution, 30 μL of 100 μmol / L EDTA-Na2 solution, 20 μL of enzyme solution, and 30 μL of 20 μmol / L riboflavin solution. The control tubes, without enzyme solution, were sequentially supplemented with 180 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium (NBT) solution, 30 μL of 100 μmol / L EDTA-Na2 solution, and 30 μL of 20 μmol / L riboflavin solution. The absorbance was measured at 560 nm.

[0112] The formula for calculating SOD activity is:

[0113] SOD activity (U / g Fw) = ((absorbance of control tube - absorbance of sample tube) × volume of extract) / (absorbance of control tube × 0.5 × fresh weight of sample × amount of enzyme solution used in the determination).

[0114] The results showed that the transgenic wolfberry plants after drought treatment LbMYB88 OELr8 and LbMYB88- The relative electrical conductivity and MDA content of OELr14 leaves were significantly lower than those of the wild type. Figure 5 The activities of SOD and POD in the A and B groups were significantly higher than those in the wild type. Figure 5 (C and D); the above results indicate that... LbMYB88 Gene overexpression can reduce drought damage to wolfberry plants by increasing SOD and POD activity, inhibiting MDA accumulation, reducing ion release rate, and decreasing MDA accumulation. LbMYB88 Overexpression of the gene can enhance the resistance of wolfberry to drought stress.

[0115] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0116] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Overexpression LbMYB88 The application of genes in improving plant resistance to drought stress is characterized by, The LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

2. The application according to claim 1, characterized in that, The overexpression LbMTB88 Genes are obtained by saying LbMTB88 This is achieved by introducing gene overexpression vectors into plants.

3. The application according to claim 2, characterized in that, The overexpression vector is composed of the LbMYB88 The gene was obtained by ligating it with the overexpression vector pHellsgate2.

4. The application according to claim 3, characterized in that, The overexpression vector was constructed according to the following steps: Using wolfberry cDNA as a template, primers were designed for PCR amplification to obtain PCR amplification products; endonuclease Xba I and Xho I. The overexpression vector pHellsgate2 was double-digested to obtain the linearized overexpression vector pHellsgate2. The PCR amplification product is ligated to the linearized overexpression vector pHellsgate2, and the resulting recombinant product is transformed into tool cells to obtain the overexpression vector.

5. The application according to claim 4, characterized in that, The primer sequences for PCR amplification are shown in SEQ ID NO.2 and SEQ ID NO.

3.

6. The application according to claim 5, characterized in that, The PCR amplification reaction system consisted of 1 μL of each primer, 7.5 μL of ddH2O, and 2 μL of cDNA. The PCR amplification reaction program was as follows: 95℃ for 3 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 90 s, for 35 cycles; 72℃ for 5 min.

7. Overexpression LbMYB88 The application of genes in breeding drought-resistant plants is characterized by, The LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

8. The application according to claim 7, characterized in that, Cultivating drought-resistant plants includes... LbMYB88 Gene overexpression vectors are introduced into plants.

9. The application according to claim 8, characterized in that, Cultivating drought-resistant plants involves the following steps: The overexpression vector was transferred into competent GV3101 cells, cultured, and the infection solution was obtained. The plant cotyledons were infected with the aforementioned infection solution and cultured to obtain drought-resistant plants.

Images