Application of rice OsGLK1 gene in regulating rice heading date

Abstract

The application discloses application of a rice OsGLK1 gene in regulating rice heading time, and relates to the technical field of plant genetic engineering. By overexpressing the OsGLK1 gene or the protein OsGLK1 coded by the gene in rice, the heading time of the rice under long-day and short-day conditions can be greatly delayed. The application provides a new method for regulating the heading time of rice, and has important significance for optimizing the growth cycle of rice and cultivating new varieties with environmental adaptability.

Description

Technical Field

[0001] This application relates to the field of plant genetic engineering technology, specifically to the application of the rice OsGLK1 gene in regulating the heading stage of rice. Background Technology

[0002] Rice is a crucial food crop in my country, and its yield directly impacts food security. The heading stage of rice is a key agronomical trait determining its growth cycle and environmental adaptability, closely related to yield, quality, and the choice of planting area. The regulation of rice heading stage is subject to complex control by photoperiod, temperature, endogenous hormones, and gene networks, with genes and signal transduction pathways related to flowering time being a research hotspot. In recent years, the role of transcription factors in flowering regulation has received widespread attention. Transcription factor GLK1 (Golden2-like 1) is a plant-specific member of the GARP family, traditionally considered primarily involved in the regulation of chloroplast development and photosynthetic genes. However, recent studies indicate that the role of GLK family members in plant development extends far beyond chloroplast regulation, potentially involving other complex biological processes, such as responses to environmental signals and the coordination of developmental processes. In rice, the functional diversification of GLK1 has become a research focus. Summary of the Invention

[0003] This invention aims to reveal the key role of the rice OsGLK1 gene in regulating the heading period of rice. Transgenic rice obtained by overexpressing the OsGLK1 gene can significantly delay the heading period under both long-day and short-day conditions.

[0004] Therefore, the present invention provides an application of the rice OsGLK1 gene in regulating the heading stage of rice, wherein the nucleotide sequence of the OsGLK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsGLK1 gene is shown in SEQ ID NO.2.

[0005] Furthermore, the OsGLK1 gene is expressed in the stems, leaf sheaths, leaves, and panicles of rice, but is mainly expressed in the leaves and is hardly expressed in the roots.

[0006] Furthermore, the OsGLK1 gene is expressed rhythmically in rice, being activated after the transition from darkness to light and then decreasing.

[0007] Furthermore, by overexpressing the OsGLK1 gene, rice with OsGLK1 gene overexpression was obtained, and the OsGLK1 gene overexpression rice had a delayed heading period under both long-day and short-day conditions.

[0008] Furthermore, compared with wild-type rice, the OsGLK1 gene overexpressing rice showed a significantly delayed heading period under both long-day and short-day conditions, with a significant delay of 25-35 days.

[0009] Furthermore, compared to wild-type rice, the OsGLK1 gene overexpressing rice exhibits greater plant height, longer panicle length, and more grains per panicle.

[0010] Furthermore, the method for obtaining the OsGLK1 gene overexpressing rice includes:

[0011] The OsGLK1 gene was constructed into the vector pCAMBIA1300 to obtain a recombinant vector of the OsGLK1 gene. The recombinant vector was then transformed into rice varieties using Agrobacterium-mediated transformation to obtain rice varieties that overexpress the OsGLK1 gene.

[0012] Furthermore, the recombinant vector of the OsGLK1 gene is constructed using the following method:

[0013] Using wild-type rice Kitaake RNA as a template, cDNA was obtained by reverse transcription. Primers OsGLK1-cds-F and OsGLK1-cds-R were designed and PCR amplified to obtain the target fragment.

[0014] The vector pCAMBIA1300 was digested with enzymes and ligated with the target fragment. It was then transformed into E. coli, and the recombinant vector pCAMBIA1300-OsGLK1 was obtained after screening and verification.

[0015] The sequence of primer OsGLK1-cds-F is shown in SEQ ID NO.3, and the sequence of primer OsGLK1-cds-R is shown in SEQ ID NO.4; the rice variety is Kitaake.

[0016] Compared with the prior art, the present invention has at least the following beneficial effects:

[0017] The application of the rice OsGLK1 gene in regulating rice heading time, as provided in this invention, significantly delays the heading time of rice under both long-day and short-day conditions by overexpressing the OsGLK1 gene or its encoded protein OsGLK1. This invention provides a novel method for regulating rice heading time and is of great significance for optimizing the rice growth cycle and breeding new environmentally adaptable varieties. Attached Figure Description

[0018] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the scope of this application.

[0019] Figure 1 This is a structural diagram of the rice OsGLK1 gene provided in Example 1 of the present invention.

[0020] Figure 2 The image of the pCAMBIA1300 circular plasmid provided in Example 1 of this invention.

[0021] Figure 3 This shows the expression of OsGLK1 in the OsGLK1 overexpressing transgenic rice provided in Example 3 of the present invention.

[0022] Figure 4 This invention provides an expression pattern of the rice OsGLK1 gene; wherein the material is wild-type (Kitaake) 25-day-old rice seedlings. Figure 4 A) Real-time quantitative PCR experiments were conducted using roots, stems, leaf sheaths, the first leaf, the second leaf, the third leaf, and the spike as materials. Figure 4 The white vertical line in the lower right corner of A is a scale bar (representing 20mm). Figure 4 The bar chart in section B represents the relative expression levels of OsGLK1 in different tissues. Figure 4 C represents the expression characteristics of OsGLK1 under long-day and short-day conditions.

[0023] Figure 5 This is an investigation of the heading stage phenotype of OsGLK1 overexpressing transgenic rice provided in Example 5 of the present invention.

[0024] Figure 6 This is an investigation of the agronomic traits of OsGLK1 overexpressing transgenic rice provided in Example 5 of the present invention. Detailed Implementation

[0025] To better understand the above technical solutions, the technical solutions of the embodiments of this application will be described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the embodiments of this application and the specific features in the embodiments are detailed descriptions of the technical solutions of the embodiments of this application, rather than limitations on the technical solutions of this application. In the absence of conflict, the embodiments of this application and the technical features in the embodiments can be combined with each other.

[0026] Unless otherwise specified, the experimental methods in the following examples were performed according to standard procedures, and the materials used were all commercially available products.

[0027] This invention discloses the application of the rice OsGLK1 gene in regulating the heading date of rice. Transgenic rice obtained by overexpressing the OsGLK1 gene exhibits delayed heading under both long-day and short-day conditions.

[0028] Specifically, this invention provides the application of the rice OsGLK1 gene in regulating the heading period of rice. The nucleotide sequence of the rice OsGLK1 gene is shown in SEQ ID NO.1. Introducing this gene into rice and overexpressing it significantly delays the heading period under both long-day and short-day conditions. This invention also provides a polypeptide encoded by the rice OsGLK1 gene, namely the protein OsGLK1, whose amino acid sequence is shown in SEQ ID NO.2. Introducing the gene encoding this protein into rice and overexpressing it significantly delays the heading period under both long-day and short-day conditions.

[0029] Furthermore, the present invention provides a method for delaying the heading date of rice, comprising the following steps:

[0030] (1) Using the RNA of wild-type rice Kitaake as a template, cDNA was obtained by reverse transcription. The nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 were used as primers for PCR amplification to obtain the amplification product.

[0031] (2) The amplification product is ligated into the BamHI restriction site of the pCAMBIA1300 vector via homologous recombination to obtain the recombinant vector.

[0032] (3) The recombinant vector was transferred into the rice variety Kitaake by Agrobacterium-mediated transformation to obtain rice with delayed heading.

[0033] Example 1: Construction of OsGLK1 overexpression vector pCAMBIA1300-OsGLK1

[0034] like Figure 1 As shown, the gene structure of rice OsGLK1 is located on the sixth chromosome of the rice genome, with accession numbers LOC_Os06g24070 or Os06g0348800. The gene sequence is located between 14078258 and 14082303, with 6 exons, encoding a GARP-type transcription factor.

[0035] 1. Obtaining the OsGLK1 gene:

[0036] Total RNA was extracted from leaves of wild-type rice Kitaake, and cDNA was obtained by reverse transcription. Using the crop template, cDNA was amplified by PCR with primers OsGLK1-cds-F and OsGLK1-cds-R to obtain a PCR product of 1368 bp, which is the target fragment.

[0037] The primer sequences are as follows:

[0038] OsGLK1-cds-F 5'-tgtgtgtgcagcccgggatccATGCTTGCCGTGTCGCCGGC-3' SEQ ID NO.3 OsGLK1-cds-R 5'-tccatggtacctgcaggatccTCCACACGCTGGAGGAACGTTT-3' SEQ ID NO.4

[0039] 2. Construction of recombinant vectors:

[0040] The vector pCAMBIA1300 was digested with the restriction endonuclease BamHI, and a DNA fragment of approximately 11145 bp was recovered to obtain the vector fragment. The circular plasmid map of the vector is shown below. Figure 2 As shown. Using Novizan's homologous recombinase (… https: / / bio.vazyme.com / (Catalog number: C112-01), the above vector fragment and the target fragment obtained in step 1 were ligated according to the instructions. The ligation product was then transformed into E. coli DH5α, and after screening with kanamycin selection medium, single clones were selected for sequencing. Correct sequencing indicates successful construction. The recombinant plasmid was named pCAMBIA1300-OsGLK1.

[0041] The recombinant vector pCAMBIA1300-OsGLK1 was transformed into Agrobacterium EHA105 strain by heat shock. After screening with rifampicin and kanamycin selection medium, single clones were selected to obtain recombinant Agrobacterium EHA105 / pCAMBIA1300-OsGLK1.

[0042] Example 2: Obtaining OsGLK1 overexpression transgenic rice

[0043] 1. Rice callus induction:

[0044] Sterilized rice (Kitaake) seeds were sown on callus induction medium (pH 5.8, Sucrose 30 g / L, MS Media 4.4 g / L, Agar 0.8%, 2,4-D 2 mg / L), and rice callus tissue was obtained after about 20 days.

[0045] 2. Agrobacterium infection:

[0046] Recombinant Agrobacterium EHA105 / pCAMBIA1300-OsGLK1 was cultured at 28℃. The overnight culture was mixed with the infection solution (Yeast Extra 3g / L, Tryptone 5g / L, Acetos-yringone 0.2M, pH 5.5) at a ratio of 1:30 and cultured at 25℃, 200rpm in the dark for 3 hours. The rice callus obtained in step 1 was mixed with the infection solution containing recombinant Agrobacterium and infected. After about 30 minutes, the rice callus was transferred to sterile filter paper until the surface was free of infection solution. Then it was transferred to MSD2 medium (Sucrose 30g / L, MS Media 4.4g / L, Sorbitol 50g / L, Agar 1.4%, 2,4-D 2mg / L, Acetosyringone 0.2M, pH 5.8) and cultured in the dark for 2-3 days.

[0047] Healthy rice callus tissue was selected and placed in MSD (MS Media 4.4 g / L, Sucrose 30 g / L, Carbenicillin 400 mg / L, Plant Preservative Mixture 1 ml / L, pH 5.8) liquid medium. The medium was inverted for 10 minutes, and the MSD liquid medium was discarded. This process was repeated at least three times. The callus was then transferred to selection medium MSD3 (MS Media 4.4 g / L, Sucrose 30 g / L, Agar 0.8%, 2,4-D 2 mg / L, Carbenicillin 250 mg / L, Plant Preservative Mixture 1 ml / L, Hygromycin B 50 mg / L, pH 5.8) and incubated at 28°C under continuous light for 30-50 days. Subculture was performed every 15 years.

[0048] 3. Inducing callus differentiation:

[0049] After the infected callus has grown into fresh callus, it is transferred to MSD4 medium (MS Media 4.4 g / L, Sucrose 30 g / L, Sorbitol 50 g / L, Agar 1.4%, N-(Phenylmethyl)-9H-purin-6-amine 3 mg / L, NAA 0.5 mg / L, Carbenicillin 50 mg / L, Hygromycin B 50 mg / L, pH 5.8) and incubated at 28°C under continuous light for 30-50 days. Subculture is performed every 15 days.

[0050] 4. Acquisition of positive transgenes:

[0051] The green callus was transferred to a new MSD4 medium (MS Media 4.4 g / L, Sucrose 30 g / L, Agar 1.4%, Carbenicillin 50 mg / L, Hygromycin B 50 mg / L, pH 5.8) and placed in a constant temperature and continuous light incubator at 28°C for 30 days. Once the seedlings reached 15 cm in length, they were removed from the sterile environment, and residual medium and callus were washed away. After a 3-day acclimatization period in the incubator, they were transferred to a greenhouse carrier to obtain the T0 generation plants.

[0052] Example 3: Identification of OsGLK1 overexpression transgenic rice

[0053] 1. DNA identification of OsGLK1 overexpressing transgenic rice:

[0054] Genomic DNA was extracted from a single OsGLK1 overexpressing transgenic rice plant as a template, and PCR amplification was performed using Hyg-F and Hyg-R primers. Hyg-F corresponds to the vector 63-82 bp, and Hyg-R corresponds to the vector 10640-10659 bp. If a 588 bp fragment can be amplified, it proves that the single plant is a positive seedling.

[0055] The primer sequences are as follows:

[0056] Hyg-F: 5'-TAAATAGCTGCGCCGATGGT-3',

[0057] Hyg-R: 5'-TCTGCTGCTCCATACAAGCC-3'.

[0058] 2. Identification of OsGLK1 overexpressing transgenic rice mRNA:

[0059] To detect OsGLK1 expression in transgenic rice, real-time quantitative PCR was performed using wild-type and two independent transgenic lines, GLK1-OX1 and GLK1-OX2. The PCR reaction was performed using a Novizan kit. https: / / bio.vazyme.com / (Product No.: Q711-02), the reaction system and procedure were set up according to the instruction manual, and the reaction was performed on a BIO-RAD instrument CFX Connect Real-Time System. The internal control gene was rice OsUBQ. The primers for real-time quantitative PCR identification are as follows:

[0060] OsGLK-qrt-F:GCAAGAATCAGCAGGACGCACA,

[0061] OsGLK1-qrt-R: AGGCAACCACGGTTTCGATAAAA.

[0062] The results are as follows Figure 3 As shown, compared with the wild type (Kitaake), the relative expression level of OsGLK1 was significantly increased in both transgenic rice varieties.

[0063] Example 4: OsGLK1 tissue expression characteristics and rhythmic expression

[0064] To detect the expression of OsGLK1 in different rice tissues, roots, stems, leaf sheaths, first leaves, second leaves, third leaves, and panicles at heading stage were collected from rice plants that had grown for 25 days for real-time quantitative PCR analysis. Sampling sites are shown below. Figure 4 As shown in Figure A, the scale bar represents 20 mm. The results are as follows: Figure 4 As shown in B, OsGLK1 is expressed in different tissues, but mainly in leaves and almost not in rice roots.

[0065] Rice seedlings grown for 20 days in long-day (14 hours light / 10 hours dark) and short-day (10 hours light / 14 hours dark) incubators were analyzed by real-time quantitative PCR to detect the expression characteristics of OsGLK1. Figure 4 As shown in C, OsGLK1 expression exhibits rhythmic expression, being activated after the transition from darkness to light and then decreasing.

[0066] Example 5: Phenotypic and agronomical trait survey of OsGLK1 overexpression transgenic rice

[0067] 1. Phenotypic examination at the heading stage:

[0068] Wild-type (Kitaake) and OsGLK1 overexpressing transgenic rice were planted in Yangzhou (long-day) and Hainan (short-day), respectively, and the heading period was recorded and photographed. The heading period refers to the time from sowing to the emergence of the first panicle from the leaf sheath. Figure 5 As shown, WT represents wild type, and GLK1-OX1 and GLK1-OX2 represent two independent OsGLK1 overexpression lines. Figure 5 Figure A shows the rice plant type. Figure 5 Figure B shows the heading time in Yangzhou and Hainan. Compared with the wild type, the heading period of the two overexpressing rice varieties was significantly delayed by about 30 days under both long-day and short-day conditions, indicating that OsGLK1 overexpression delays heading.

[0069] 2. Investigation of agronomic traits:

[0070] After the rice matured, agronomic traits of wild-type (Kitaake) and OsGLK1 overexpressing transgenic rice were investigated. At least four individual plants were selected from each line, and at least ten panicles were selected from each individual plant. Plant height, panicle length, and number of grains per panicle were measured. Figure 6As shown in A, B, and C, WT represents the wild type, and GLK1-OX1 and GLK1-OX2 represent OsGLK1 overexpression lines, respectively. Compared with the wild type, the transgenic rice plants are significantly taller, have significantly longer panicles, and have significantly more grains per panicle. This demonstrates that OsGLK1 overexpression can effectively increase the number of grains per panicle.

[0071] It will be readily understood by those skilled in the art that the above-described advantageous methods can be freely combined and superimposed without conflict. The above are merely preferred embodiments of this application and are not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application. The above are merely preferred embodiments of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of this application, and these improvements and modifications should also be considered within the protection scope of this application.

Claims

1. Application of overexpression of rice OsGLK1 gene in delaying the heading stage of rice, wherein the nucleotide sequence of the OsGLK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsGLK1 gene is shown in SEQ ID NO.2; By overexpressing the OsGLK1 gene, rice with OsGLK1 gene overexpression was obtained. The OsGLK1 gene overexpression rice delayed the heading period under both long-day and short-day conditions. Compared to wild-type rice, the OsGLK1 gene overexpressing rice plants are taller, have longer panicles, and have more grains per panicle.

2. The application according to claim 1, characterized in that, The OsGLK1 gene is expressed in the stems, leaf sheaths, leaves, and panicles of rice, but is mainly expressed in the leaves and is hardly expressed in the roots.

3. The application according to claim 1, characterized in that, The OsGLK1 gene is expressed rhythmically in rice, being activated after the transition from darkness to light and then decreasing.

4. The application according to claim 1, characterized in that, Compared with wild-type rice, the OsGLK1 gene overexpressing rice showed a 25-35 day delay in heading under both long-day and short-day conditions.

5. The application according to claim 1, characterized in that, The method for obtaining rice with OsGLK1 gene overexpression includes: The OsGLK1 gene was constructed into the vector pCAMBIA1300 to obtain a recombinant vector of the OsGLK1 gene. The recombinant vector was then transformed into rice varieties using Agrobacterium-mediated transformation to obtain rice varieties that overexpress the OsGLK1 gene.

6. The application according to claim 5, characterized in that, The recombinant vector of the OsGLK1 gene is constructed using the following methods: Using total RNA from wild-type rice Kitaake as a template, cDNA was obtained by reverse transcription. Primers OsGLK1-cds-F and OsGLK1-cds-R were designed and PCR amplification was performed to obtain the target fragment. The sequence of primer OsGLK1-cds-F is shown in SEQ ID NO.3, and the sequence of primer OsGLK1-cds-R is shown in SEQ ID NO.

4. The vector pCAMBIA1300 was digested with enzymes and ligated with the target fragment. It was then transformed into E. coli, and the recombinant vector pCAMBIA1300-OsGLK1 was obtained after screening and verification.

7. The application according to claim 5, characterized in that, The rice variety mentioned is Kitaake.

Images