Application of tomato slavt6b gene in regulating amino acid transport to affect tomato resistance to tetranychus cinnabarinus

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a tomato SlAVT6B gene in regulating amino acid transport to affect the ability of tomatoes to resist Tetranychus cinnabarinus. Through forward genetics, a method of whole genome association analysis (mGWAS) is used to locate the tomato SlAVT6B gene and find that it is located on the vacuole membrane. Through in vitro verification, it is found that SlAVT6B has the function of transporting primary metabolites, amino acids. Overexpression and knockout are carried out in tomato plants, and it is found that overexpression and knockout of the SlAVT6B gene can change the content of primary metabolites, amino acids in the tomato, and further affect the trichome development of the tomato and the resistance to Tetranychus cinnabarinus, so as to fully verify the biological function and application approach of the gene.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering. SlAVT6B The application of genes in transporting primary metabolite amino acids, thereby affecting tomato glandular hair development and insect resistance. Background Art

[0002] tomato( Solanum lycopersicum L.) is an annual herbaceous plant in the Solanaceae family, native to South America. Tomato fruits are brightly colored, delicious, and highly nutritious. They can be eaten directly or processed into foods such as tomato sauce, making them a favorite worldwide. However, in actual tomato production, growth is often severely affected by pests, diseases, drought, and cold weather. Tomato metabolites play an important role in resisting adverse environmental conditions. Tomato metabolites are mainly divided into two categories: primary metabolites and secondary metabolites. They maintain the vital activities and growth and development of tomatoes and participate in the tomato's response to biotic and abiotic stresses, such as pests, drought, flooding, salinity, and ultraviolet stress. Tomato primary metabolites are products obtained from primary metabolic processes that participate in the synthesis of substances essential for life activities in the tomato body. They mainly include organic substances such as proteins, amino acids, fats, carbohydrates, and nucleic acids. Tomato secondary metabolites are substances generated by further reactions of primary metabolites. They are mainly produced by the interaction between the plant and the environment and mainly include phenolic compounds, terpenes, and alkaloids. For tomatoes, secondary metabolites such as alkaloids, phenolic derivatives, and terpenes not only participate in the defense process but also determine the quality and flavor of the fruit.

[0003] Amino acids are essential substances in plants and play a vital role in their growth and development. As essential and active molecules in plants, their changes in the body are not only involved in numerous physiological regulatory activities but are also closely related to plant growth, development, and stress resistance. The large number of free amino acids present in plants not only provides raw materials for protein synthesis but also participates in various biological functions, such as regulating internal osmotic pressure and maintaining acid-base balance. Amino acids account for a significant proportion of soil organic nitrogen, and plants can absorb and utilize amino acids as one of their nitrogen sources. Furthermore, amino acids have other essential biological functions in plants. For example, amino acids serve as precursors for plant hormone synthesis, transport nitrogen from source to sink, participate in resistance to external abiotic stresses, and regulate root morphology and pollen tube development. During their growth and development, plants are inevitably affected by various stresses in their environment. Generally, these stresses can be divided into two categories: biotic and abiotic. Amino acids can improve a plant's adaptability to external abiotic stresses. When plants encounter external stress conditions, amino acids primarily enhance their adaptive response to various adversities by altering certain physiological metabolisms within the plant, or by regulating related gene expression and key enzyme activities. Therefore, various studies on plant amino acids have become increasingly important, and research on amino acid transporters is clearly an essential part of research related to plant amino acid synthesis and metabolism.

[0004] Plants are frequently infected by various pathogens and pests in their natural environments. Following infection, invaders obtain nutrients from their hosts, with amino acids serving as a crucial nitrogen source provided by the host plant. Modulating amino acid homeostasis by altering the expression of transporters may influence plant defense responses. AtLHT1 has previously been reported to be involved in amino acid uptake into root and mesophyll cells, and its expression is induced by pathogen infection. Its knockout mutants have been shown to confer increased resistance to a broad spectrum of pathogens in a SA-dependent manner. In mutants defective in the SA pathway, the induction of resistance conferred by pathogen infection and AtLHT1 is reduced, demonstrating that the enhanced disease resistance may result from altered cellular redox homeostasis and a lack of intracellular glutamine. Altered amino acid transporter expression also influences plant resistance to parasitic pests such as root-knot and cyst nematodes. Knockout of AtAAP3 and AtAAP6 significantly reduced root-knot nematode infestation in Arabidopsis. Compared to wild-type plants, AtAAP3 and AtAAP6 mutants produced fewer female nematodes but more male nematodes. Furthermore, nematodes isolated from ATAAP3A and ATAAP6 mutants exhibited reduced egg hatching, infectivity, and lipid energy reserves. Similarly, loss of function of AtAAP1, AtAAP2, and AtAAP8 significantly reduced the number of female cyst nematodes that reproduced on these mutant plants. Therefore, amino acid homeostasis and levels in plants can, to some extent, influence plant resistance to pathogens and pests in nature. Summary of the Invention

[0005] The purpose of the present invention is to separate a tomato SlAVT6B Gene, SlAVT6B has a broad spectrum amino acid transport function verified by in vitro yeast mutants, SlAVT6B transgenic materials were constructed, and knockout or overexpression of SlAVT6B was found SlAVT6B The gene changes the homeostasis of primary metabolite amino acids in the plant body, thereby affecting the development and disease resistance of tomato glandular hairs, confirming the function and application of the gene.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention uses forward genetics and genome-wide association analysis (mGWAS) to locate the tomato SlAVT6B The gene is located in the vacuole membrane and is used in regulating the resistance of tomato to spider mites. SlAVT6B The nucleotide sequence of the gene is shown in SEQ ID No. 1; the application approach is to knock out SlAVT6B Gene, which increases the density of type VI glandular trichomes in tomatoes, making tomatoes more resistant to spider mites.

[0008] Furthermore, the application method is SlWRKY57Gene expression products binding SlAVT6B Gene promoter regulation SlAVT6B The gene expression level affects the development of tomato glandular hairs to regulate the resistance of tomato to spider mites; SlWRKY57 The nucleotide sequence of the gene is shown in SEQ ID No.2.

[0009] Furthermore, the knockout SlAVT6B Gene, increasing the density of type VI glandular trichomes in tomatoes, and improving the resistance of tomatoes to spider mites, including the following steps:

[0010] (1) Design SlAVT6B The double target sites sg1 and sg2 of the gene were used to construct a gene knockout vector, wherein the base sequence of sg1 was AATTTAGACTTTACCAGCTGCCG, and the base sequence of sg2 was TGTAGTTAGCATTGTTGGAG;

[0011] (2) constructing an Agrobacterium genetically engineered bacterium containing the knockout vector described in step (1);

[0012] (3) Transforming tomato plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and is stably inherited.

[0013] Furthermore, in step (1), the gene knockout vector is constructed as follows:

[0014] a1 Design SlAVT6B The target dimers were prepared by PCR amplification using primers SlAVT6B-CF and SlAVT6B-CR for the dual target sites sg1 and sg2 of the gene;

[0015] The base sequence of SlAVT6B-CF is GACCTTGGAATTCGTTTCAGCA; the base sequence of SlAVT6B-CR is AATTTAGACTTTACCAGCTGCCG;

[0016] a2 connects the target dimer obtained in a1 to the plasmid to obtain a recombinant vector for gene knockout.

[0017] In the second aspect, the present invention provides an application of a recombinant knockout vector in regulating the resistance of tomato to spider mites, wherein the recombinant knockout vector is used to knock out the tomato SlAVT6B Gene.

[0018] Furthermore, the application approach is to transfer the recombinant knockout vector into tomato plants to increase the density of tomato type VI glandular trichomes, thereby improving the resistance of tomatoes to Tetranychus cinnabarinus.

[0019] Compared with the prior art, the present invention has the following effects:

[0020] Further verification was made through genetically modified material testing. SlAVT6B Its role in coordinating amino acid homeostasis and regulating glandular hair development and disease resistance can provide an important reference for improving the disease resistance of tomatoes during tomato breeding, and will have important guiding significance for cultivating new tomato varieties with high quality and high resistance.

[0021] The present invention will be further described below with reference to the accompanying drawings and examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 :Through mGWAS screening, we located SlAVT6B Gene, Figure 1 Figure A shows the results of genome-wide association analysis of phenylalanine content; Figure 1 Figures B and C are the tissue expression analysis and phylogenetic analysis of the located genes.

[0023] Figure 2 :Functional validation of SlAVT6B as a vacuolar amino acid efflux protein, Figure 2 Figure A in the middle shows the subcellular localization of SlAVT6B; Figure 2 Panel B shows the validation of SlAVT6B's efflux function and efflux activity in the yeast mutant 22Δ10α. The results are based on three replicates. Error bars represent standard deviations (SD). ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, and **** indicates a P value less than 0.0001. All three values ​​indicate extremely significant differences.

[0024] Figure 3 : SlAVT6B Construction and identification of transgenic materials, A in the figure is SlAVT6VB Expression level detection of overexpression plants and knockout plants; Figure B is SlAVT6B Identification of knockout materials; the results are based on three replicates, the error bars represent the standard deviation (SD), ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, and **** indicates a P value less than 0.0001, all of which indicate extremely significant differences.

[0025] Figure 4 : SlAVT6B Glandular hair development phenotype in transgenic plants, Figure A SlAVT6B Observation of glandular hair phenotype in transgenic plants; Figure B is SlAVT6BDetection of glandular trichome types and density in transgenic plants. Results are based on three replicates. Error bars represent standard deviation (SD). ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, and **** indicates a P value less than 0.0001. All three indicate extremely significant differences.

[0026] Figure 5 :SlAVT6B affects the resistance of tomato plants to Tetranychus cinnabarinus. SlAVT6B The phenotype of transgenic plants inoculated with insects; Figure B is SlAVT6B Detection of lesion area in transgenic plants after inoculation. Results are based on three replicates. Error bars represent standard deviations (SD). ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, and **** indicates a P value less than 0.0001. All three indicate extremely significant differences.

[0027] Figure 6 : SlAVT6B Regulated by SlWRKY57. SlAVT6B Yeast one-hybrid results regulated by SlWRKY57; Figure B is SlAVT6B EMSA results regulated by SlWRKY57; Figure C is SlAVT6B Results of LUC regulated by SlWRKY57; the results are based on three replicates, error bars represent standard deviation (SD), ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, and **** indicates a P value less than 0.0001, all of which indicate extremely significant differences.

[0028] Figure 7 : SlAVT6B nucleotide sequence.

[0029] Figure 8 : Plasmid map of entry vector pDonr207-SlAVT6B.

[0030] Figure 9 : Overexpression editing vector PBI121-SlAVT6B. DETAILED DESCRIPTION

[0031] The following examples define the present invention and describe methods for isolating and cloning a DNA fragment containing the complete coding region of the SlAVT6B gene, as well as for verifying the function of the SlAVT6B gene. The experimental methods used in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from commercial sources unless otherwise specified.

[0032] Preparation of reagents and culture medium used:

[0033] (1) Abbreviations of reagents and solutions: The amino acid solutions used in the present invention are all prepared in aqueous solution with a concentration of 100 μM; the abbreviations of plant hormones used in the culture medium are as follows: KN (Kanamycin); KT (Kinetin); IAA (Indole-3-acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid); AS (Acetosringone); DMSO (Dimethylsulfoxide); Tim (Timentin); ZR (trans-Zeatin-riboside); IBA (3-Indolebutyric acid); KH2PO4 (Potassium dihydrogen phosphate); MS (Murashige & Skoog); GA3 (gibberellins).

[0034] (2) Main solution formula:

[0035] 1) Yeast nitrogen-deficient medium

[0036] YNB (for mutant strains) 6.7g

[0037] 20g glucose

[0038] Dissolve at room temperature and dilute to 1000 mL with distilled water.

[0039] 2) Preparation of MS liquid culture medium

[0040] MS Base salt 4.33 g;

[0041] MS Vitamin 0.1031 g;

[0042] 30 g sucrose;

[0043] Dissolve at room temperature and dilute to 1000 mL with distilled water.

[0044] 3) ZR stock solution, IBA stock solution: 2 g / L; IAA stock solution, KH2PO4, 2,4-D stock solution, KT stock solution: 1 g / L; Tim stock solution: 320 g / L; KN stock solution: 50 g / L; AS stock solution: 200 mM / L. All solutions must be sterilized by filtration.

[0045] (3) Culture medium formulation for tomato genetic transformation

[0046] 1) Pre- / co-culture medium

[0047] MS liquid medium 1 L;

[0048] Agar powder (Agar) 6g;

[0049] ZR 0.5mL;

[0050] IAA 0.1 mL;

[0051] Adjust the pH to 5.8, make up to 1000 mL, seal and sterilize.

[0052] 2) Screening culture medium

[0053] MS liquid medium 1 L;

[0054] Agar powder (Agar) 6g;

[0055] ZR 0.5mL;

[0056] IAA 0.1 mL;

[0057] Tim 0.6mL;

[0058] KN 0.5mL;

[0059] Adjust the pH to 5.8, make up to 1000 mL, seal and sterilize.

[0060] 3) Rooting medium

[0061] MS liquid medium 1 L;

[0062] Gum powder 2.5g;

[0063] IBA 0.5 mL;

[0064] Tim 0.5mL;

[0065] KN 0.5mL;

[0066] Adjust the pH to 5.8, make up to 1000 mL, seal and sterilize.

[0067] (4) YEB culture medium

[0068] Yeast extract 1g;

[0069] Tryptone 5g;

[0070] Beef extract 5g;

[0071] Sucrose 5g;

[0072] MgSO4•7H2O 0.5g;

[0073] Agar powder (added to solid) 15g;

[0074] Adjust the pH to 7.4, make up to 1000 mL, seal and sterilize.

[0075] (5) 1.5×CTAB extraction solution

[0076] CTAB 15 g

[0077] 1 M Tris·HCl (pH 8.0) 75 mL

[0078] 0.5 M EDTA (pH 8.0) 30 mL

[0079] NaCl 61.4 g

[0080] Add ddH2O to make the volume up to 1000 mL.

[0081] Example 1: SlAVT6B Gene discovery and mapping

[0082] The applicant measured metabolites in tomato materials from around the world, conducted statistical analysis on the measurement data, and selected varieties with significant differences in amino acid synthesis for genome-wide association analysis. The results showed that there was a significant association between the amino acid phenylalanine and a loci on chromosome 3. There was an amino acid transporter (Solyc03g117350) 205 kb away from the major locus on chromosome 3, which was strongly correlated with phenylalanine content. p =6.54E -08 ). Therefore we named it SlAVT6B , speculated SlAVT6B Genes may affect the biosynthesis of amino acids.

[0083] Example 2: Isolation of clones SlAVT6B Gene identification and subcellular localization

[0084] In order to obtain SlAVT6BTo determine the coding sequence of the gene, the applicant planted the sequenced tomato variety MicroTom for one month and extracted total RNA from tomato leaves using TRIZOL reagent (Invitrogen) (the extraction method followed the TRIZOL reagent instructions). The RNA was then reverse-transcribed into cDNA using the Script All-in-one RT EasyMix for qPCR kit from Tolo. Using this cDNA as a template, PCR amplification was performed using primers SlAVT6B-F: 5'- aaaaagcaggcttaATGGATAGCAATTATTCGGCTG -3' and SlAVT6B-R: 5'- agaaagctgggtaTCAATCACTCTCAGTACTCATACT -3' to obtain the cDNA. SlAVT6B The full-length coding sequence (CDS) of the gene (1419 bp, as shown in SEQ ID No. 1) was obtained. PCR reaction conditions: 94°C pre-denaturation for 2 min; 98°C for 10 sec, 58°C for 30 sec, 68°C for 2 min, 35 cycles; and 68°C extension for 5 min. The amplified PCR product was ligated into the pDonr207 entry vector via the BP reaction of the GATEWAY cloning technology. Positive clones were screened and confirmed by sequencing to obtain the SlAVT6B Full-length cDNA of the gene.

[0085] The LR reaction of GATEWAY cloning technology SlAVT6B The pH7WGF vector containing the GFP tag was connected to the tobacco for transient injection. The injected tobacco was first cultured in the dark for 24 hours, then cultured in the light for 24 hours, and then observed.

[0086] Observation: As shown in the figure, compared with the empty vector, SlAVT6B and Arabidopsis vacuolar water channel protein AtTIP3 showed specific fluorescence on the tonoplast, indicating that SlAVT6B is localized on the tonoplast.

[0087] Example 3: SlAVT6B is a vacuolar amino acid transporter

[0088] The LR reaction of GATEWAY cloning technology SlAVT6BThe mutant strain 22Δ10α was ligated into the yeast expression vector ADH1, and the applicant named the correctly sequenced clone ADH1-SlAVT6B. The mutant strain 22Δ10α was unable to grow on medium containing arginine and γ-aminobutyric acid as the sole nitrogen sources. To determine the amino acid transport activity of SlAVT6B, we heterologously expressed SlAVT6B in the yeast amino acid transporter mutant 22Δ10α and cultured the transformed yeast on YNB solid medium containing a mixture of (NH4)2SO4 and 2 mM amino acids as the sole nitrogen source. The experimental results showed that the SlAVT6B-22Δ10α yeast transformants could grow normally on medium containing (NH4)2SO4, but 2 mM amino acids did not restore the growth of SlAVT6B-22Δ10α, indicating that SlAVT6B cannot transport amino acids into yeast cells.

[0089] Therefore, we used yeast mutants to conduct amino acid efflux experiments. The mutant yeast containing ADH1-AtAAP3 and ADH1-SlAVT6B was cultured in SD / -Ura liquid medium to an OD600 of 1, collected, and washed three times with sterile water. The yeast samples were then transferred to a new medium containing 3 mM NH4 + The culture medium was used as the sole nitrogen source and cultured for 24 hours. The bacterial solution was then collected and centrifuged to separate the yeast sample and yeast culture medium sample. The amino acid content of each sample was determined. The experimental results are shown in Figure 2 B. The experimental results show that after 3 mM NH4 + After 12 h of liquid culture, the amino acid concentration in SlAVT6B-22Δ10α decreased by 35% compared with AtAAP3-22Δ10α, while the amino acid content in the yeast culture medium of SlAVT6B-22Δ10α increased by 2.6 times.

[0090] In addition, 3 mM NH4 + After 12 hours of cultivation in liquid medium as the sole nitrogen source, ADH1-SlAVT6B was washed three times with sterile water and then transferred to nitrogen-free medium. 2 mL of culture fluid was collected at 0, 2, 4, 6, and 8 hours. The collected fluids were centrifuged and separated into yeast samples and yeast medium samples, respectively, for amino acid content measurement. Amino acid efflux activity was calculated as the amino acid content in yeast medium divided by (amino acid content in yeast sample + amino acid content in yeast medium). The results showed that after 12 hours of cultivation in nitrogen-free medium, SlAVT6B exhibited higher efflux activity than the control.

[0091] Example 4: SlAVT6B Identification of genetically modified material

[0092] The overexpression vector was constructed as follows: the overexpression vector pBI121 was connected through LR reaction using GATEWAY cloning technology. The applicant named the clone with correct sequencing as PBI121-SlAVT6B.

[0093] The CRISPR vector construction method is as follows: the target sites sg1 (base sequence: AATTTAGACTTTACCAGCTGCCG) and sg2 (base sequence: TGTAGTTAGCATTGTTGGAG) were screened on the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the primers SlAVT6B-CF (base sequence: GACCTTGGAATTCGTTTCAGCA) and SlAVT6B-CR (base sequence: AATTTAGACTTTACCAGCTGCCG) were designed for the two screened target sites (the forward primer is the first 19 bases of the target site, and the reverse primer is the reverse complement of the first 19 bases of the target site, and then the corresponding linkers are added before and after the two sequences). PCR amplification was performed using the pTX41-CRISPR plasmid as a template, and a 568-bp band was recovered. PCR reaction conditions included pre-denaturation at 94°C for 2 min, 30 cycles of 98°C for 10 sec, 58°C for 30 sec, and 68°C for 2 min, followed by extension at 68°C for 5 min. The gel-recovered product was then Golden Gate-ligated with pTX41. The reaction system consisted of 50-100 ng of vector, 100-300 ng of recovered product, 5 units of BsaⅠ-HFv2 (0.25 μL), 200 units of T4 Ligase (0.5 μL), and 1.5 μL of 10X Ligase buffer (filled to 15 μL with ddH2O). The reaction was performed at 37°C for 20 sec, followed by 25 cycles of 37°C for 3 min, 16°C for 4 min, and 50°C for 5 min, followed by 80°C for 5 min. The applicant named the correctly sequenced clone CRISPR-SlAVT6B.

[0094] PBI-SlAVT6B and CRISPR-SlAVT6B were used for transformation. Specifically, they were introduced into the tomato variety MicroTom via an Agrobacterium-mediated tomato genetic transformation system. Transgenic plants were obtained after pre-cultivation, infection, co-cultivation, selection of calli with kanamycin resistance, differentiation, rooting, transplanting, and identification.

[0095] Specific steps: (1) Point seed: the seeds of tomato variety MicroTom are counted and put in water for 3-4h, then the water is poured out and 75% alcohol is added for disinfection for 45s, the seeds are washed with sterile water for five times, 20% NaClO is added for disinfection for 18min (avoiding light), and the seeds are washed with sterile water for five times after disinfection, each time for about two minutes, then the sterile water is poured out, the seeds are slightly absorbed, and then transferred to 1 / 2MS germination medium for dark culture; (2) Cutting seedlings for pre-culture: when the seeds germinate and grow to two mature cotyledons, the leaf tip and leaf base are cut off with scissors, and the cotyledons are placed on the pre-culture medium with the back of the leaf facing up, and pre-cultured in the dark for 1-2 days; (3) Agrobacterium transformation and culture: the constructed PBI121-SlAVT6B and CRISPR-SlAVT6B vectors are added to 20ul EHA105 competent cells (from Shanghai Weidi Biology, commercial strain), placed on ice for 5min, transferred to liquid nitrogen for 5min, then 37℃ water bath for 5min, finally placed on ice for 5min, then 100ul YEB liquid medium (ingredients see below) is added, and cultured at 28℃ for 1h, then the bacterial liquid is coated on the resistant YEB solid plate, and cultured at 28℃ for 1-2 days. After single colonies appear, the colonies are transferred to YEB liquid medium, and cultured at 28℃ for 12 hours; (4) Agrobacterium infection and co-culture: the suspension of Agrobacterium is adjusted to OD 600 =0.2-0.3 using liquid MS medium, the cotyledons are gently shaken in the Agrobacterium suspension for 12-15min, then transferred to sterile filter paper to absorb, and placed in the dark for 2 days; (5) Screening culture: the cotyledons on the co-culture medium are transferred to the screening culture medium, and the medium is replaced every two weeks until callus and adventitious buds grow; (6) Rooting: the grown adventitious buds are cut off, all the surrounding callus is removed, and the buds are transferred to the rooting medium (inserted into the medium) for rooting culture; (7) Transplanting: the healthy plants with roots are transplanted into nutrient soil, and water loss is avoided 5 days after transplanting, and the plants are identified after normal growth.

[0096] The specific identification steps are as follows: (1) Vector transfer identification: In order to verify whether the pBI121 overexpression vector has been transformed into the plant, PCR amplification identification was performed using the vector-specific primers OJX487: 5'-CGCAAGACCCTTCCTCTATATAAG-3' and OJX488: 5'-TAAAACGACGGCCAGTGAATTCC C-3'. The PCR reaction conditions were: 94°C pre-denaturation for 5 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min, 35 cycles; 72°C extension for 5 min. Then, agarose gel electrophoresis was performed, and the presence of a 1317 bp band indicated that the vector had been transferred; (2) RNA extraction and reverse transcription: The RNA extraction, reverse transcription method and real-time fluorescence quantitative detection in the transgenic plants were used in Example 2. SlAVT6B The relative expression level.

[0097] DNA was extracted from the SlAVT6B knockout material according to the above steps, and the CRISPR-SlAVT6B vector insertion was identified. Vector-specific primers CAS9-F: TTGACAAGCTGTTCATCCAG and CAS9-R: CCTTCGTAATCTCGGTGTTC were used. The PCR reaction conditions were the same as above. Gel electrophoresis showed a 500bp band, which was the CRISPR-SlAVT6B vector insertion. The gene editing results were then identified. Primers were designed 100bp upstream and downstream of the gene knockout target site: SlAVT6B-CF: GACCTTGGAATTCGTTTCAGCA and SlAVT6B-CR: AATTTAGACTTTACCAGCTGCCG. PCR amplification was performed using the DNA sample as a template, and the sequencing results of the PCR products were analyzed. The results are shown in Figure 2. Figure 3 As shown in A, SlAVT6B Overexpression and knockout expression plants were successfully constructed.

[0098] Example 5: SlAVT6B Changes in leaf epidermal hair morphology in transgenic materials

[0099] Tomato glandular trichomes were observed using a stereo microscope (DFC550 LEICA). The density of glandular trichomes was measured in leaves (third leaf position), stems (third internode), and flowers (unopened buds) of six-week-old tomato plants, with 10 replicates per tissue. Additionally, the morphology of glandular trichomes in leaf tissue was observed, and the number of type II, V, and VI glandular trichomes was counted.

[0100] Through SlAVT6B The phenotypes of the transgenic lines were analyzed and it was found that SlAVT6B-ko The density of glandular hairs on leaves, stems and flowers of the strain was significantly higher than that of the wild type. SlAVT6B-OETo further determine the role of SlAVT6B in the development of glandular trichomes, we observed the leaf surfaces of 6-week-old wild-type and SlAVT6B transgenic lines under a microscope. SlAVT6B-ko The number of type VI glandular trichomes on the leaf surface of the strain was significantly greater than that of the wild type. Further microscopic counting of type II, V and VI glandular trichomes on the leaf surface of all materials revealed that SlAVT6B- no The number of type II and type V glandular trichomes in the strain was similar to that of the wild type, but the number of type VI glandular trichomes was 3-4 times that of the WT. SlAVT6B-OE The number of type VI glandular hairs in the strain was less than that in the wild type.

[0101] Example 6: SlAVT6B improves tomato resistance to Tetranychus cinnabarinus by affecting glandular trichome development

[0102] Previous studies have found that the level of type VI glandular trichomes in tomatoes affects their resistance to spider mites. Considering the changes in glandular trichome density in SlAVT6B transgenic materials, it is speculated that the insect resistance of SlAVT6B transgenic materials may change. To determine whether SlAVT6B affects the insect resistance of tomatoes, we first conducted a feeding preference experiment using spider mites. After feeding spider mites with wild-type and SlAVT6B transgenic materials for 2 hours, we found that the mites moved to SlAVT6B-OE The number of spider mites on the leaves was higher than that of the wild type, and the SlAVT6B-ko The number of spider mites on the leaves was lower than that of the wild type. These results indicate that the feeding preference of spider mites on tomato leaves is as follows: SlAVT6B-OE >Wild type> SlAVT6B-ko In addition, we also conducted the preference experiment of Tetranychus cinnabarinus, the egg-laying experiment of Tetranychus cinnabarinus, and the whole-plant infestation experiment of Tetranychus cinnabarinus.

[0103] For the preference experiment of spider mites, we used 6-week-old SlAVT6B Transgenic and wild-type leaves were placed on either side of a petri dish. A line was drawn in the center bottom of the dish as a mark. Ten healthy spider mites were transferred to the marked line. The dish was covered and left at room temperature for 1 hour. The number of spider mites transferred to the transgenic and wild-type leaves was then counted. Mites located around the marked line were considered unselected and were also counted.

[0104] For the egg-laying experiment of spider mites, we placed the normally grown 6-week-old transgenic materials and wild-type leaves at the same leaf position on a culture dish with moistened filter paper, transferred 5 healthy female spider mites to the leaves, covered the culture dish lid and cultured them, and counted the number of eggs on the leaves every 24 hours.

[0105] For the whole plant infection experiment of Tetranychus cinnabarinus, we selected 6-week-old plants with normal growth and basically the same size. SlAVT6B Transgenic materials and wild-type plants were tested. 15 healthy female spider mites were transferred to the third leaf of the plant, and then the plant was placed in a culture system for cultivation. The results showed that 45 days after inoculation, the transgenic plants showed a significant difference compared to the wild-type plants. SlAVT6B- no The leaves of the material basically remained green, and only local collapse and chlorosis occurred on the leaves. The chlorosis damage area of ​​the leaves was calculated by scanning, and the quantitative results showed that SlAVT6B-ko The lesion area of ​​the SlAVT6B-OE transgenic material was 60% of that of the wild type. In contrast, the lesion size of the leaves of the SlAVT6B-OE transgenic material was 1.35 times larger than that of the wild type. In summary, SlAVT6B may enhance tomato resistance to T. cinnabarinus by regulating the development of type VI glandular trichomes.

[0106] Example 7: SlAVT6B Regulated by SlWRKY57

[0107] SlWRKY57 Genes and SlAVT6B Promoter binding was tested by yeast one-hybrid, LUC and EMSA.

[0108] Specific steps: Yeast one-hybrid: Use the LR reaction of the Gateway system to SlWRKY57 The gene was transferred from pDONR207 vector to yeast single hybrid vector pGADT7. SlAVT6B The promoter sequence was transferred from the pDONR207 vector to the yeast one-hybrid vector pHis2. The correctly sequenced pGADT7-SlWRKY57 and pHis2-SlAVT6B were then co-transformed into the yeast one-hybrid competent Y187 culture. After a single colony emerged, it was transferred to SD / -Leu / -Trp / -His medium (containing 0-50mM 3AT) and monitored for growth.

[0109] LUC: SlWRKY57 The gene (shown as SEQ ID No. 2) was ligated to the pEAQ tobacco expression vector via the Gateway system's LR reaction. The SlAVT6B promoter sequence was linked to a modified pH2GW7 vector as a reporter, which contained the Firefly Luciferase and Renilla luciferase genes, with the Ren gene serving as an internal reference. The successfully constructed vector was transformed into tobacco transient transformants mediated by Agrobacterium tumefaciens in different combinations (negative control: pEAQ+LUC-SlAVT6B, experimental group: pEAQ-SlWRKY57+LUC-SlAVT6B) and then co-transfected intoN. benthamiana Tobacco leaves were sampled after 48 hours of incubation at 25°C in a greenhouse. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System kit (Promega) according to the instructions. Luminescence (LUC) and luciferase activity (REN) were measured using a Thermo Scientific™ Varioskan™ LUX Multi-Mode Microplate Reader. Relative reporter gene expression levels are expressed as LUC / REN. This experiment was repeated three times, with six biological replicates per group on different leaves.

[0110] EMSA: SlWRKY57 The coding sequence of the gene was connected to the pMAL-2X protein expression vector through the Gateway system and transformed into BL21 (DE3) colon competent cells. It was expressed at low temperature under 1M IPTG induction. The expressed protein was purified by MBP tag protein cross-linking purification resin. SlAVT6B Fluorescently labeled probes were designed to identify the binding motifs of the promoter, and unlabeled probes were used as competing probes. Purified proteins were incubated with the different probes for 30 minutes in the dark, followed by electrophoresis on a 3% native polyacrylamide gel at 90V for 50 minutes. Finally, images were developed using an infrared laser imaging system (ODYSSEY-FC, Gene Company Limited).

[0111] The experimental results showed that the combination of pGADT7-SlWRKY57 and pHIS2-SlAVT6B can grow in SD / -Leu / -Trp / -His (5mM 3AT) medium, that is, SlWRKY57 can bind SlAVT6B The promoter ( Figure 6 Middle A). LUC assay results showed that SlWRKY57 can activate SlAVT6B The expression ( Figure 6 Middle C). EMSA results showed that SlWRKY57 could bind to SlAVT6B The migration band increased with the increase of SlWRKY57 amount, and the band weakened after adding the competitive probe ( Figure 6 The above experiments demonstrated that SlWRKY57 binds to SlAVT6B The promoter of the gene regulates its expression level and thus affects the development of glandular trichomes and insect resistance in tomatoes.

[0112] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0113] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0114] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0115] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0116] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Tomato SlAVT6B The application of the gene in regulating the resistance of tomato to spider mites is characterized in that: The tomato SlAVT6B The nucleotide sequence of the gene is shown in SEQ ID No. 1; the application approach is to knock out SlAVT6B Gene, which increases the density of type VI glandular trichomes in tomatoes, making tomatoes more resistant to spider mites.

2. The use according to claim 1, characterized in that The knockout SlAVT6B Gene, increasing the density of type VI glandular trichomes in tomatoes, and improving the resistance of tomatoes to spider mites, including the following steps: (1) Design SlAVT6B The double target sites sg1 and sg2 of the gene were used to construct a gene knockout vector, wherein the base sequence of sg1 was AATTTAGACTTTACCAGCTGCCG, and the base sequence of sg2 was TGTAGTTAGCATTGTTGGAG; (2) constructing an Agrobacterium genetically engineered bacterium containing the knockout vector described in step (1); (3) Transforming tomato plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and is stably inherited.

3. The use according to claim 2, characterized in that In step (1), the gene knockout vector is constructed as follows: a1 Design SlAVT6B The target dimers were prepared by PCR amplification using primers SlAVT6B-CF and SlAVT6B-CR for the dual target sites sg1 and sg2 of the gene; The base sequence of SlAVT6B-CF is GACCTTGGAATTCGTTTCAGCA; the base sequence of SlAVT6B-CR is AATTTAGACTTTACCAGCTGCCG; a2 connects the target dimer obtained in a1 to the plasmid to obtain a recombinant vector for gene knockout.

4. Application of a recombinant knockout vector in regulating resistance of tomato to Tetranychus cinnabarinus, characterized in that: The tomato of claim 1 is knocked out by using the recombinant knockout vector SlAVT6B Gene.

5. The use according to claim 4, characterized in that The application approach is to transfer the recombinant knockout vector into tomato plants, thereby increasing the density of tomato type VI glandular trichomes and improving the resistance of tomatoes to spider mites.

Images