Method for improving tomato plant type

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a method for improving tomato plant types. The technical problem to be solved by the invention is to provide a new choice for creating tomatoes in short sections. According to the technical scheme, the method for improving the plant type of the tomato is realized by reducing the expression quantity of a g201 gene in the tomato. The nucleotide sequence of the g201 gene is as shown in SEQ ID No.1 or SEQ ID No.4, and finally, breeding is carried out on the progeny of a gene editing plant, so that a homozygous inter-short-section tomato material which does not contain CAS9 is obtained. The method for creating the short-section tomatoes can also be applied to other tomato strains, and has good biological breeding application prospects and production value.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for improving tomato plant type. Background Art

[0002] Tomato (Solanum lycopersicum) is one of the most commonly cultivated fruits and vegetables in the world, and is the main horticultural crop cultivated in greenhouses in northern and southern my country. It has high yield and rich nutrition, and has good processing properties and economic value. As a global crop, the cultivation area of ​​tomatoes continues to expand and labor costs continue to rise. Semi-dwarf and compact plant types have become one of the important agronomic traits considered in the selection and breeding of new tomato varieties. With the continuous expansion of the planting area, problems such as shortage of arable land and high labor costs are becoming increasingly apparent. Intensive seedling cultivation methods increase the density of tomato seedlings, causing mutual shading between plants and insufficient light, resulting in leggy growth and yellowing of seedlings. Shortening the internode length can not only effectively reduce plant height, improve photosynthetic efficiency, inhibit crop growth, increase land utilization, reduce the consumption of nutrients in the soil, but also reduce the labor costs of seedling management and fruit harvesting. Therefore, in-depth elucidation of the internal mechanism of short internodes of tomatoes can not only enrich the regulatory mechanism of plant internode development, but also cultivate tomato varieties with short internodes through biotechnology. It will also greatly save manpower and financial resources in tomato production, which has very important innovative significance for tomato production and the shaping of new plant types of short internode tomatoes.

[0003] At present, some key genes related to tomato plant height have been cloned in tomato. For example, the SP (self-pruning) gene that regulates the limited growth habit of tomato was located on the short arm of chromosome 6 and cloned. This gene is homologous to Antirrhinum majus CEN and Arabidopsis TFL1, encoding a CES family protein (Pnueli et al., 1998). This gene has been widely used in tomato plant type breeding. The D (Dwarf) gene in the dwarf tomato variety Micro-Tom was isolated by transposon tagging and is located on chromosome 2 (Bishop et al., 1996). The D (Dwarf) gene encodes a cytochrome P450 monooxygenase. Mutations in this gene show obvious brassinolide-deficient mutant phenotypes, that is, short and sturdy stems and wrinkled and dark green leaves. Currently, the ornamental dwarf varieties Tiny Tim, Tom Thumb and Dwarf Stone have been bred using the D allele (Stevens & Rick, 1986).

[0004] Plant height is a quantitative trait controlled by multiple genes and is controlled by multiple hormones such as auxin, lactone, gibberellin, and cytokinin. Among them, the hormone that controls plant stem elongation is mainly gibberellin (GA). GA regulates cell elongation through the GA signaling pathway, causing changes in internode length or plant height of crops. GA-GID1-DELLA is a widely accepted signaling module that can be used to regulate plant growth and development. Rice dwarf 1 is a gibberellin-insensitive mutant that causes the mutant to have reduced plant height due to the inactivation of the gibberellin receptor (GID1); however, the proline in the rapeseed semi-dwarf mutant DS-3 (encoding DELLA protein) is replaced by leucine, resulting in semi-dwarfing of rapeseed plants, and the DELLA protein is not controlled by GA. The functional loss of the rice "Green Revolution" gene SD1 shows a typical dwarf plant type. By activating its endogenous gibberellin signal transduction and increasing gibberellin synthesis through exogenous spraying of plant hormones, the internodes of dwarf plants can be elongated and the plant height can be increased. The tomato elongation mutant pro is caused by a point mutation in the GRAS region of the DELLA protein in the GA signaling pathway (Carrera et al., 2012). The SlDREB protein can specifically bind to the DRE / CRT element in the SlCPS promoter region to regulate the expression of SlCPS. Overexpression of SlDREB can change the expression of genes in the GA synthesis pathway, thereby reducing endogenous GA levels and dwarfing the plant (Li et al., 2012).

[0005] In recent years, gene editing technology has made breakthrough progress. Methods such as CRISPR / Cas9, TALEN and ZFN have become the means of gene editing technology in the world. Gene editing technology is a genetic manipulation technology that can modify DNA sequences at the genome level. Gene editing technology will be widely used in all agricultural product production fields. It will break the limitation that existing transgenic technology is mainly used in corn, soybeans, cotton and rapeseed that are not directly consumed by humans. It has higher breeding efficiency and accuracy, and can significantly shorten the time for research and development and breeding of varieties, and prolong the time for the degradation of excellent varieties. More importantly, food produced by gene editing technology can better meet the diverse needs of consumers for quality. Therefore, gene editing technology has a more comprehensive and long-term impact on food security. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a new option for transforming tomato plant type.

[0007] The technical solution of the present invention is a method for improving tomato plant type, which is achieved by reducing the expression level of the g201 gene in tomatoes; the nucleotide sequence of the g201 gene is shown in SEQ ID No.1 or SEQ ID No.6.

[0008] Specifically, the improved tomato plant type is to create a tomato with short internodes.

[0009] Furthermore, the method of reducing the expression level of the g201 gene in tomatoes is to knock out the g201 gene or interfere with the expression of the g201 gene.

[0010] Particularly, the method for knocking out the g201 gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

[0011] Specifically, the genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

[0012] Wherein, the CRISPR-Cas method comprises the following steps: a. Design sgRNA targeting the g201 gene target site; b. Construction of Cas editing expression vector expressing sgRNA; c. Transform tomatoes with the Cas editing expression vector.

[0013] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

[0014] Wherein, in step a, the target site sequence is shown in positions 180 to 199 and / or positions 252 to 271 of SEQ ID No.1.

[0015] In particular, in step a, the sequences of sgRNA are shown in SEQ ID No.4 and SEQ ID No.5.

[0016] Specifically, in step c, the tomato is transformed using an Agrobacterium-mediated transformation method.

[0017] Preferably, in step b, the nucleotide sequence of the Cas editing expression vector expressing sgRNA is shown as SEQ ID No.7 and SEQ ID No.8.

[0018] Beneficial effects of the present invention: The present invention uses CRISPR / Cas9 genome editing technology to quickly create short internode tomato materials. The method for creating short internode tomato materials and the method for detecting short internode tomatoes described in the present invention can be applied to other tomato lines. Compared with traditional hybrid breeding, the backbone parent is transformed from an ordinary long internode tomato material to a short internode tomato material within 1 to 2 years, and there are no adverse effects such as linkage drag, which has great breeding application prospects and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1, phenotypic identification diagram of gene-edited pure strain T2; A is the short internode phenotype of inflorescence of WT and mutants g201-1 and g201-2; B is the statistical analysis of the internode length of inflorescence of wild-type plants WT and mutants g201-1 and g201-2.

[0020] Figure 2 , PCR detection of transformed and regenerated plants; M is a marker; the digital numbers are the plant numbers of the T0 generation transformed and regenerated plants.

[0021] Figure 3 , diagram of mutation types in the T0 generation of gene-edited tomato plants.

[0022] Figure 4 , g201-1# homozygous mutant sequencing peak diagram.

[0023] Figure 5 , g201-2# homozygous mutant sequencing peak diagram.

[0024] Figure 6 、Structure diagram of recombinant vector; ori: origin of replication; bom: base of migration region from pBR322; pVS1oriV: origin of replication of pVS1 plasmid; pVS1 RepA: pVS1 plasmid replication protein; pVS1 StaA: pVS1 plasmid stabilization protein; LB T-DNA repeat: T-DNA left border repeat sequence; RB T-DNA repeat: T-DNA right border repeat sequence; M13fwd: M13 forward sequencing primer; gRNA scaffold: gRNA backbone; 3xFLAG: triple tandem FLAG protein tag; SV40NLS: nuclear localization signal of SV40 (simian virus 40) large T antigen; nucleoplasmin NLS: binary nuclear localization signal from nucleoplasmin; P2A: 2A peptide from porcine Tay-Smith virus-1 polypeptide; CaMV 35s promoter: 35S promoter of cauliflower mosaic virus (CaMV); Cas9: Cas9 endonuclease; lac promoter: lactose promoter; lac operator: lactose operator; CAP binding site: CAP binding site; CaMV poly(A) signal: eukaryotic mRNA 3' tailing signal; Shine-Dalgarno sequence: the complete consensus sequence of the ribosome binding site upstream of the start codon of Escherichia coli; complementary to the 3' end region of 16S rRNA; Hygr: hygromycin resistance screening tag; NeoR / KanR: neomycin / KanR resistance screening tag; KanR: KanR resistance screening tag. DETAILED DESCRIPTION

[0025] In view of the current continuous expansion of tomato planting area, the reduction of rural labor, the increase in labor costs and the expansion of planting scale, designing and cultivating new varieties suitable for light and simplified cultivation is an important way to break the industry. The present invention found in the study of the identified tomato mutant strain g201 (GA20ox, Solyc01g093980) that compared with the wild type, the gene knockout mutant g201 showed a phenotype of significantly shortened internodes and shorter plant type, and determined that g201 positively regulates the internode length and overall plant height of tomato plants. CRISPR / Cas9-mediated gene editing technology was used to knock out the g201 gene, in order to create a new tomato germplasm with short internodes and compact plant type in the backbone inbred line, provide material accumulation for tomato plant type breeding, and provide new strategies and directions for tomato agricultural production.

[0026] Example 1 CRISPR vector construction The CRISPR / Cas9 system was used to construct a vector to knock out the G201 gene. Based on the mRNA sequence and the corresponding genomic sequence information, a specific target site sgRNA was designed according to the target sequence through computing software. Two CRISPR target sites were designed here to improve the targeting efficiency. The target PCR amplification primer sequence was designed, and the fragment containing the target was amplified by PCR after the primers were synthesized. This PCR fragment was cloned into the final CRISPR vector. After the vector was constructed, it was transferred into Escherichia coli DH5α, and a single colony was selected for shaking, and then colony PCR was performed to screen positive clones. The specific steps are as follows: (1) Design of CRISPR target site and target site adapter primers PCR primers for vector construction were designed based on the mRNA sequence of G201 and the corresponding genome sequence (SEQ ID No. 1) (SEQ ID No. 2 G201-F2: ATGCATGATGAAAGACAAAATGATGA; SEQ ID No. 3 G201-R2: GGTTTTGTGTAGAAGCCAATGGACA). PCR system: template DNA 1 μL, 10×Buffer 2 μL, dNTP Mixture (2 mM) 0.4 μL, PrimerF (10 μM) 0.4 μL, PrimerR (10 μM) 0.4 μL, Taq (5U / μL) 0.1 μL, ddH 2 O to 20 μL. PCR program: 95℃ 3min; 95℃ 30 sec, 56℃ 30 sec, 72℃ 30 sec, 35 cycles; 72℃ 10 min; 25℃ 2min.

[0027] SEQ ID No.1 G201 mRNA sequence and corresponding genomic sequence, positions 180-199 and 252-271 indicate target sites; positions 1-28 and 1068-1092 indicate PCR primer sequences; lowercase letters indicate PAM sequences;

[0028] (2) Target linker preparation According to the mRNA sequence and the corresponding genome sequence information, specific target site sgRNA is designed according to the target sequence through computing software. Here, two CRISPR target sites (shown in SEQ ID No. 1, positions 180-199 and 252-271) are designed to improve the targeting efficiency.

[0029] The sequences of sgRNA1 and sgRNA2 for the two CRISPR target sites are as follows: sgRNA1 (SEQ ID No. 4): 5'- CGCGGTATCCAATGCCACTC -3' (target sequence is 180-199 of SEQ ID No. 1); sgRNA2 (SEQ ID No.5): 5'-TGGTATCGATACGAAGCTCA -3' (the target sequence is positions 252 to 271 of SEQID No.1).

[0030] Acquisition of target fragment: According to the location of the two target sites, the sequence SEQ ID No.1 between the two target sites, position 180 to 271, was synthesized by BGI.

[0031] Linearized vector (pv58-k) system (all used are Takara fast cutting enzymes) 50μL: KpnI 1μL; 10× buffer 5μL; plasmid DNA 2μg; ddH 2 Add 18 bp homology arms to each side of the target gene to skip the KpnI restriction site recognition sequence during homologous recombination, thus achieving the purpose of deleting the restriction site. (3) Homologous recombination The recombinant vector ligation system (20 μL system) is as follows: the added volume of the target fragment = fragment size × 0.04 / concentration (1 μL ≈ 10 / 11.6) (Note: the amount of the inserted fragment amplification product should be between 10 and 200 ng. Since 200 × 0.04 = 8.00 < 10, the lowest amount should be selected directly); the added volume of the linearized vector = vector size × 0.02 / concentration (6 μL ≈ 200 / 32.2) (Note: the amount of the linearized cloning vector should be between 50 and 200 ng. Since 16384 × 0.02 = 327.68 > 200, the highest amount should be selected directly); 5 × CE II Buffer 4 μL; Exnase II 2 μL; ddH 2Add 20 μL of 4% HO to the tube. Mix well by pipetting, incubate at 37℃ for 30 min, and place on ice immediately.

[0032] (4) Positive clone verification The target site fragment was recombined with the expression vector pv58-k (the structure of the recombinant vector is shown in Figure 6 , SEQ ID No.7) and then transformed into Escherichia coli DH5α. The specific steps are as follows: Place the reaction in an ice bath for 30 minutes, then gently take it out, heat shock at 42℃ for 60 seconds, and place it on ice for 2 minutes. Then add 600 µL LB liquid culture medium, and resuscitate and culture at 37℃ and 150 rpm for 1 hour before plating. Take an appropriate amount of bacterial liquid and spread it on an LB plate containing kanamycin and culture it overnight at 37℃. Select positive clones for sequencing, and sequence the CRISPR vector with primers G201-F2 / R2. Sequencing is successful for Agrobacterium transformation and tomato genetic transformation. PCR system: 1 μL bacterial culture, 2 μL 10× Buffer, 0.4 μL dNTP Mixture (2mM), 0.4 μL PrimerF (10 μM), 0.4 μL PrimerR (10 μM), 0.1 μL Taq (5U / μL), ddH 2 O to 20 μL. PCR program: 95℃ 3min; 95℃ 30 sec, 56℃ 30 sec, 72℃ 30 sec, 32 cycles; 72℃ 10 min; 25℃ 2min.

[0033] SEQ ID No.7 Recombinant vector nucleotide sequence from position 1 to position 7405:

[0034] Positions 7406 to 16740 of the nucleotide sequence of the recombinant vector of SEQ ID No.8:

[0035] Example 2 Tomato genetic transformation Use leaf disc transformation method to obtain gene-edited plants. The disinfected tomato variety AC (Ailsa Craig) was sown on 1 / 2ms culture medium; the two fully extended cotyledons of tomato seeds were cultured in a constant temperature box to obtain sterile seedlings; the sterile leaves were taken, the ends of the cotyledons were removed, and the rest was cut into multiple small squares, inoculated on the culture medium for a pre-incubation period of 2-3 days, and used as explant inoculation. Agrobacterium infected the pre-cultured explants and cultured them around the explants on the differentiation culture medium. After a few days, colonies grew out, and the explants were transferred to the callus induction culture medium for screening. Antibacterial agents and antibiotics were added, and the explant transformed cells differentiated into resistant adventitious buds after 2-3 weeks; when the adventitious buds grew to more than 1 cm, they were cut off and inserted into the culture medium to make them root; the plants were transplanted after taking root in the seedling medium. Cut the leaves of the regenerated plants, extract DNA using the CTAB method, and perform PCR detection using the selection marker gene specific primers.

[0036] PCR system: DNA sample 1.5 μL, Qingke T3Mix 27 μL, F Primer (10 μmol / L) 0.5 μL, RPrimer (10 μmol / L) 0.5 μL, ddH 2 0. Make up to 30 μL. PCR program: 98℃ 3min; 98℃ 10sec, 56℃ 10sec, 72℃ 10sec, 32 cycles; 72℃ 5min; 25℃ 2min.

[0037] The transformed regenerated plants T0 generation were obtained through seed germination, pre-culture, Agrobacterium-mediated genetic transformation, screening culture and differentiation, and resistance bud rooting. The transformed plants T0 generation were tested by PCR using primers G201-F2 / R2, such as Figure 2 As shown, PCR products of 21 T0 plants were selected for sequencing ( Figure 2 ). The sequencing peak graph file shows that the two strains have homozygous mutations, and the sequencing peak graph is a single peak ( Figure 4 and Figure 5 ).

[0038] The gene sequence of the homozygous mutant g201-1 was edited as follows based on SEQ ID No. 6: a base T at position 313 in the g201-1 gene was deleted. The gene sequence of the homozygous mutant g201-2 was edited as follows based on SEQ ID No. 6: nine bases ATCGATACG at positions 314 to 322 in the g201-2 gene were deleted.

[0039] The T0 transgenic plants were tested by PCR and positive mutants were screened (see Figure 3 ), and then these T0 generation positive mutants are self-pollinated for seed preservation. The T1 generation plants obtained by self-pollination are then tested by PCR, and finally tomato plants that do have the G201 gene mutation and do not contain the CAS9 transgenic insertion fragment are self-pollinated for seed preservation to continue to obtain the T2 generation.

[0040] The T2 generation of gene-edited homozygous strains without transgenic insertion fragments were screened for tomato short internode phenotype identification; then, the harvested tomato materials were further evaluated and identified for short internode phenotype in the greenhouse. The phenotypic observation of short internodes between inflorescences of mutants g201-1, g201-2 and wild-type WT ( Figure 1 A), the results showed that the wild type WT inflorescence internodes were longer, while the mutants g201-1 and g201-2 had shorter inflorescence internodes; Figure 1 As shown in B, compared with the wild type WT, the inflorescence internodes of mutants g201-1 and g201-2 were significantly shorter in inflorescences 1-2 and 3-4. Therefore, the results showed that the g201 gene positively regulated the length of the internodes.

[0041] SEQ ID No.6 G201 wild type sequence

[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A method for improving tomato plant type, characterized by: This is achieved by reducing the expression level of the g201 gene in tomatoes; the nucleotide sequence of the g201 gene is shown in SEQ ID No.1 or SEQ ID No.

6.

2. The method according to claim 1, characterized in that: The improved tomato plant type is a tomato with short internodes.

3. The method according to claim 1, characterized in that: The method of reducing the expression level of the g201 gene in tomatoes is to knock out the g201 gene or interfere with the expression of the g201 gene.

4. The method according to claim 3, characterized in that: The method for knocking out the g201 gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

5. The method according to claim 4, characterized in that: The genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

6. The method according to claim 5, characterized in that: The CRISPR-Cas method comprises the following steps: a. Design sgRNA targeting g201 gene; b. Construction of Cas editing expression vector expressing sgRNA; c. Transform tomatoes with the Cas editing expression vector.

7. The method according to claim 6, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

8. The method according to claim 6, characterized in that: In step a, the target site sequence is shown in positions 180 to 199 and / or positions 252 to 271 of SEQ ID No.

1.

9. The method according to claim 8, characterized in that: In step a, the sequences of sgRNA are shown in SEQ ID No.4 and SEQ ID No.

5.

10. The method according to claim 6, characterized in that: In step c, the tomato is transformed using an Agrobacterium-mediated transformation method.

Images