A method for regulating the resistance of a plant to verticillium wilt by using gene silencing technology

Abstract

The application provides a method for regulating the resistance of plants to verticillium wilt by using a gene silencing technology, and belongs to the technical field of biological genetic engineering. The application provides a gene silencing vector for silencing a RAB5 homologous gene in plants, and uses the gene silencing vector to silence the gene based on a TRV-mediated VIGS technology. The method for silencing the RAB5 homologous gene is found to be closely related to the disease resistance of plants, thereby providing a new gene for studying the genetic breeding of cotton germplasm resources. In the embodiment of the application, after obtaining cotton plants with low expression of GhARA6 and GhARA7, the cotton plants are inoculated with verticillium dahliae, and the results show that the plants with silenced genes GhARA6 / GhARA7 exhibit stronger disease resistance to verticillium wilt.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for regulating plant resistance to Verticillium wilt using gene silencing technology. Background Technology

[0002] ARA6 (RABF1) / ARA7 (RABF2b) are homologous genes of RAB5 in plants. Both belong to the Rab protein family, which consists of small GTPases. As "commanders" of the intracellular transport system, Rab proteins regulate vesicle formation, transport, anchoring, and vesicle fusion with the plasma membrane, and act as molecular switches in endocytosis and secretion pathways. Rab5 knockout significantly reduces the number of early endocytosomes, late endocytosomes, and lysosomes, and also inhibits endocytosis.

[0003] TRV-mediated VIGS silencing (Virus-induced gene silencing) is an important method for studying plant gene function, characterized by its simplicity, speed, efficiency, lack of need for complex genetic transformation of plants, and ability to study the function of lethal genes. However, there are currently no studies on the silencing of ARA6 / ARA7 gene expression and the resulting phenotypic changes. Summary of the Invention

[0004] This invention provides a method for regulating plant resistance to Verticillium wilt using gene silencing technology. After silencing the homologous gene of RAB5, the plant exhibits stronger disease resistance.

[0005] This invention provides a gene silencing vector for silencing the RAB5 homologous gene in plants, comprising a virus-induced gene silencing vector as the base vector, and a VIGS silencing fragment designed for the RAB5 homologous gene linked to it.

[0006] The VIGS silencing fragments include nucleotide sequences as shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0007] In a preferred embodiment of the present invention, the base carrier includes a TRV carrier.

[0008] In a preferred embodiment of the present invention, the primer pair for amplifying the fragment shown in SEQ ID No. 1 includes an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4.

[0009] In a preferred embodiment of the present invention, the primer pair for amplifying the fragment shown in SEQ ID No. 2 includes an upstream primer with nucleotide sequences as shown in SEQ ID No. 5 and a downstream primer as shown in SEQ ID No. 6.

[0010] This invention also provides the application of the above-mentioned gene silencing vector in improving plant disease resistance.

[0011] In a preferred embodiment of the present invention, the plant comprises cotton.

[0012] In a preferred embodiment of the present invention, the disease includes Verticillium wilt.

[0013] The present invention also provides a method for improving plant resistance to diseases, including using the above-mentioned gene silencing vector to suppress the expression of the RAB5 homologous gene in the plant genome.

[0014] In a preferred embodiment of the present invention, when the plant is cotton, the RAB5 homologous gene includes GhARA6 and / or GhARA7.

[0015] This invention also provides the application of the above-mentioned gene silencing vector or the above-mentioned method in the creation of plant germplasm.

[0016] Beneficial effects: This invention provides a gene silencing vector for silencing the RAB5 homologous gene in plants, and utilizes the gene silencing vector to silence the gene based on TRV-mediated VIGS technology. In embodiments of this invention, according to Figure 1 The procedure shown involves constructing VIGS vectors for the target genes ARA6 (RABF1) and ARA7 (RABF2b) in cotton, respectively. DNA fragments encoding the sequences are ligated into vectors carrying TRV2. Cotton plants are then transformed with the constructed gene silencing vectors to achieve gene silencing of GhARA6 and GhARA7, thereby obtaining two cotton plants with reduced expression levels of GhARA6 and GhARA7, respectively.

[0017] This invention, through silencing the RAB5 homologous gene, reveals its close relationship with plant disease resistance, thus providing a new gene for the genetic breeding of cotton germplasm resources. In the embodiments of this invention, after obtaining cotton plants with low expression levels of GhARA6 and GhARA7, they were inoculated with Verticillium dahliae. The results showed that plants with silenced GhARA6 / GhARA7 genes exhibited stronger resistance to Verticillium wilt. Attached Figure Description

[0018] Figure 1 This is a flowchart of the experimental process of the present invention;

[0019] Figure 2 The image shows the amplification results of the cDNA sequences of genes GhARA6 and GhARA7.

[0020] Figure 3 The image shows the enzyme digestion results of the TRV2 vector.

[0021] Figure 4 TRV-VIGS vector maps of GhARA6 and GhARA7;

[0022] Figure 5 This is a diagram showing the results of colony PCR identification.

[0023] Figure 6 The results show the relative expression levels of the target genes. In (a), TRV:GhCLA1 is the positive control, and TRV:00 is the blank vector control. The positive control plants turned white 10 days after VIGS injection. Compared with the control group, no significant developmental phenotypes were found in other experimental groups. (b) shows the relative expression level of the Gh-ARA6 gene in plants. (c) shows the relative expression level of the Gh-ARA7 gene in plants.

[0024] Figure 7 A graph showing the biomass of Verticillium dahliae in diseased cotton.

[0025] Figure 8 Disease phenotype of upland cotton TM-1 after inoculation with Verticillium dahliae. Detailed Implementation

[0026] This invention provides a gene silencing vector for silencing the RAB5 homologous gene in plants, comprising a virus-induced gene silencing vector as the base vector, and a VIGS silencing fragment designed for the RAB5 homologous gene linked to it.

[0027] The VIGS silencing fragments include nucleotide sequences as shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0028] The present invention does not specifically limit the types of plants used; any conventional plants in the field can be used. For example, cotton was used as an example in one embodiment, but it cannot be considered as the entire scope of protection of the present invention.

[0029] This invention utilizes TRV-mediated VIGS technology to silence genes ARA6 and / or ARA7, wherein ARA6:>XM_041078078.1, LOC121207708. In one embodiment of this invention, a VIGS silencing fragment is designed targeting the cDNA sequence of ARA6, as shown in SEQ ID No. 1:

[0030] AGTGATGGCCTTGGTTGGTAATAAAGCCGACCTTCAGGAAAAGCGCGAAGTACCAGTCCAAGATGGCATTGACTATGCAGAGAAGAATGGGATGTTCTTTATTGAGACATCTGCCAAGACTGCGGACAATATAAATCAGTTGTTTGAGGAAATTGCCAAGCGGCTGCCACGTCCATCACCTTCATG.

[0031] The gene ARA7 described in this invention is: >XM_016897970.2, LOC107961815. In one embodiment, a VIGS silencing fragment was designed targeting the cDNA sequence of ARA7 as shown in SEQ ID No. 2:

[0032] GGAAGGTGGCAACAGAGGAAGCACAAACTTATGCTCAGGAGAATGGTCTTTTCTTCATGGAAACTTCTGCAAAGACCGCATCCAATGTCAATGAACTTTTCTATGAAATAGCTAAAAGATTACCTCGAGTGCAGCCAGCACAAAATCCTGCTGGAATGGTTCTCATGGATAGACCTTCAGAAC.

[0033] This invention uses the cDNA of the plant as a template and employs primers with homologous arms to amplify the VIGS silencing fragment of the gene to be silenced. In one embodiment, the primer pairs shown in SEQ ID No. 3 and SEQ ID No. 4 are used to amplify the VIGS silencing fragment of GhARA6, and the primer pairs shown in SEQ ID No. 5 and SEQ ID No. 6 are used to amplify the VIGS silencing fragment of GhARA7. The primer sequences are shown below in sequence:

[0034] M-ARA6-F:aaggttaccgaattctctagaAGTGATGGCCTTGGTTGGTAAT;

[0035] M-ARA6-R:tgtcttcgggacatgcccgggCATGAAGGTGATGGACGTGGC;

[0036] M-ARA7-F:aaggttaccgaattctctagaGGAAGGTGGCAACAGAGGAAG;

[0037] M-ARA7-R:tgtcttcgggacatgcccgggGTTCTGAAGGTCTATCCATGAGAACC.

[0038] When performing the amplification in this invention, the amplification system, in 50 μL increments, includes: 25 μL of 2×PhantaMax Master Mix, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2 μL of cDNA template, and the remainder RNase-free ddH2O; the reagents used to prepare the amplification system were purchased from Nanjing Novizan Biotechnology Co., Ltd.; the amplification program includes: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 sec, annealing at 58℃ for 15 sec, extension at 72℃ for 45 s, 30 cycles; and final extension at 72℃ for 5 min.

[0039] This invention utilizes a double enzyme digestion method to insert the amplified VIGS silencing fragment into a basic vector. In one embodiment, the enzymes used are XbaI and SmaI. If homologous recombination is used to ligate it into the TRV2 vector, the TRV-VIGS vectors of GhARA6 and GhARA7 are constructed.

[0040] This invention also provides the application of the above-mentioned gene silencing vector in improving plant disease resistance.

[0041] In a preferred embodiment of the present invention, the plant includes cotton, and the disease includes Verticillium wilt. In one embodiment, cotton plants with silenced GhARA6 and GhARA7 genes were used for verification. It was found that silencing either GhARA6 or GhARA7 gene significantly improved resistance to Verticillium dahliae, thereby enhancing resistance to Verticillium wilt.

[0042] The present invention also provides a method for improving plant resistance to diseases, including using the above-mentioned gene silencing vector to suppress the expression of the RAB5 homologous gene in the plant genome.

[0043] In a preferred embodiment of the present invention, when the plant is cotton, the RAB5 homologous gene includes GhARA6 and / or GhARA7. In one embodiment, during gene silencing, the constructed GhARA6 and GhARA7 TRV-VIGS vectors are respectively transformed into Agrobacterium GV3101 competent cells, and then Agrobacterium containing the TRV-VIGS vectors of GhARA6 and / or GhARA7 is used to infect cotton plants, thereby obtaining cotton plants with silenced GhARA6 and / or GhARA7.

[0044] This invention also provides the application of the above-mentioned gene silencing vector or the above-mentioned method in the creation of plant germplasm.

[0045] After silencing GhARA6 and / or GhARA7 using the method described in this invention, cotton plants exhibited higher disease resistance, such as against Verticillium wilt of cotton caused by Verticillium dahliae.

[0046] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a method for regulating plant resistance to Verticillium wilt using gene silencing technology, should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] Silencing genes ARA6 / ARA7 using TRV-mediated VIGS technology:

[0049] 1. Design a TRV-VIGS gene fragment as shown in SEQ ID No. 1 and SEQ ID No. 2 targeting the cDNA sequences of genes GhARA6 and GhARA7, and design primers M-ARA6-F and M-ARA6-R, as well as M-ARA7-F and M-ARA7-R, with homologous arms based on the fragment.

[0050] 2. Using cDNA from cotton leaves of Upland Cotton TM-1 as a template, PCR amplification was performed using the primers described above as upstream and downstream primers to obtain gene fragments with homologous arms. The PCR amplification kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. The amplification results are shown below. Figure 2 As shown, this indicates that cDNA fragments of GhARA6 and GhARA7 were successfully amplified.

[0051] 3. Enzyme digestion of TRV2 vector

[0052] A 20 μL reaction mixture consisted of 1 μL of empty vector TRV, 2 μL of 10× buffer, 2 μL of 0.1% BSA, 1 μL of Xbal, 1 μL of SmaI, and 12 μL of ddH2O. The mixture was digested at 37°C for 4 h. The digestion results are as follows: Figure 3 As shown, two segments, one long and one short, can be cut out.

[0053] 4. Link it to the vector carrying TRV2 using homologous recombination.

[0054] A 20 μL reaction mixture consisted of 1 μL of double-digested vector, 3 μL of target gene, 5 μL of 2×CE Mix, and 1 μL of ddH2O. The PCR reaction was performed at 50°C for 10 min, followed by incubation at 4°C to construct the desired results. Figure 4 The TRV-VIGS vectors for GhARA6 and GhARA7 are shown.

[0055] 5. Transfer to agricultural pole GV3101

[0056] (1) Take out GV3101 competent cells from the -80℃ freezer, thaw them on ice for 5 minutes, add 1 μL of the vector plasmid, and let stand on ice for 30 minutes.

[0057] (2) Quickly place it into pre-cooled liquid nitrogen for quick freezing treatment. After 5 minutes, immediately transfer the EP tube to a 37°C water bath for 5 minutes of heat shock treatment.

[0058] (3) After the heat shock treatment, add 600 μL of antibiotic-free liquid LB medium. Place it in a shaker, set the temperature to 28℃ and the rotation speed to 200 rpm, and shake for 2 to 3 hours.

[0059] (4) Centrifuge the EP tube at 5000 rpm for 1 minute, aspirate 500 μL of culture medium, pipette the remaining 200 μL of bacterial cells evenly, and spread it on solid LB medium containing kanamycin (Kan) and rifampin (Rif).

[0060] (5) Incubate at 28℃ for approximately 2 days. Select single colonies for colony PCR identification and verify by gel electrophoresis, such as... Figure 5 As shown.

[0061] 6. Infect cotton with Agrobacterium tumefaciens containing TRV-VIGS vectors containing GhARA6 and GhARA7, respectively:

[0062] (1) Planting cotton seedlings

[0063] Upland Cotton™-1 cotton seeds are soaked in tap water for more than 8 hours and then cultivated as cotton seedlings in an artificial climate chamber until about 8 days after emergence, when the cotyledons are fully unfolded and the cotton plant has two leaves and one bud.

[0064] (2) Preparation of the infiltration solution

[0065] Agrobacterium containing TRV-VIGS vectors containing GhARA6 and GhARA7 were placed in 100 ml of LB liquid culture medium containing Kan and Rif, respectively, and placed on a shaker at 28°C for about 24 h at 200 rpm. The colonies were then collected by centrifugation.

[0066] Prepare a 100ml resuspension: 1ml MgCl2, 1ml MES, 100μL LAS, and add sterile water to 100ml. Mix the TRV2 resuspension containing TRV1 and the target gene fragment at a 1:1 volume ratio to prepare a solution for cotton cotyledon injection.

[0067] (3) Cotton injection

[0068] The prepared infection solution was injected into the cotyledons of cotton plants. Three leaves were injected into each cotton plant, and the injection area of ​​each leaf was at least 2 / 3 of the leaf area. Each gene was injected into 12 plants.

[0069] (4) Verify the efficiency of silence

[0070] RNA was extracted from infected plant leaves. RNA was extracted from infected cotton leaves using a kit and stored at -20°C. Reverse transcription was performed to convert the extracted RNA from the injected cotton leaves into cDNA, which was then stored at -20°C for later use.

[0071] Using cotton EIF4α as an internal reference gene and non-VIGS fragments from GhARA6 and GhARA7 as qPCR fragments, a 25 μL system was prepared: 12.5 μL of 2×SuperRealPreMix Plus, 0.75 μL of forward primer (10 μM), 0.75 μL of reverse primer (10 μM), 1 μL of cDNA template, and 10 μL of RNase-free ddH2O.

[0072] qEIF4α-F (SEQ ID No. 7):ACATGGACCAGAACACTCGT;

[0073] qEIF4α-R (SEQ ID No. 8):AACCTTCCACTTCGTCCGAT;

[0074] qARA6-F (SEQ ID No. 9): GCTTTGCAGGAACACTTCTCTC;

[0075] qARA6-R (SEQ ID No. 10):TGGGGTCAAACCTGAAATTATTAAA;

[0076] qARA7-F(SEQ ID No.11):GGCCACCACTGGAAACAAGAAC;

[0077] qARA7-R (SEQ ID No. 12): CGGCCAATGTCTGGGAAAAGA;

[0078] The relative expression level of the target gene was calculated using the comparative CT method. The relative expression level of the target gene = Where △△Ct=(Ct) 目的基因 -Ct 内参基因 ) 实验组 -(Ct 目的基因 -Ct 内参基因 ) 对照 The experimental results were replicated in triplicate, and the average value was used for graphical analysis.

[0079] The results are as follows Figure 6 As shown, TRV:GhCLA1 was used as a positive control and TRV:00 was used as a blank vector control. The positive control plants turned white 10 days after VIGS injection. Compared with the control group, no significant developmental phenotypes were found in other experimental groups. Moreover, compared with the control group, the relative expression levels of Gh-ARA6 and Gh-ARA7 genes in the experimental groups were reduced.

[0080] The cotton plants that successfully underwent gene silencing were then screened for subsequent Verticillium dahliae inoculation experiments.

[0081] (5) Activation and culture of Verticillium dahliae

[0082] Take Verticillium dahliae at -80℃ and spread it on PDA solid medium. Activate it in an incubator at 20℃ for 5 days. Cut it into small pieces of about 1cm in a clean bench and add it to the pre-prepared Czapek's medium. Add about 5 pieces of bacteria per 100mL of medium. Place it on a shaker at 25℃ and shake at 200rpm for about 7 days.

[0083] (6) Preparation of inoculation solution for pathogens

[0084] OD of bacterial culture measured using a spectrophotometer 600 After reaching approximately 1.0, dilute with tap water 5 to 8 times to prepare a pathogen infection solution.

[0085] (7). Inoculation method

[0086] Using the root drenching method, 50 mL of Verticillium dahliae infection solution was applied to the roots of each cotton plant, and the disease incidence of the cotton plants inoculated with Verticillium dahliae was observed and recorded after about 25 days.

[0087] Disease severity description: Level 0 - Healthy cotton plants with no diseased leaves and normal growth; Level 1 - Less than one-quarter of the cotton plant's leaves are affected, turning yellow and wilting; Level 2 - More than one-quarter but less than one-half of the cotton plant's leaves are affected, turning yellow and wilting; Level 3 - More than one-half but less than three-quarters of the cotton plant's leaves are affected, turning yellow and wilting; Level 4 - More than three-quarters of the cotton plant's leaves are affected, or the cotton plant dies.

[0088] Disease index = ∑(number of plants at each disease level × disease level index) ÷ (total number of plants surveyed × highest level index) × 100%.

[0089] (8) Statistical analysis of Verticillium dahliae biomass in diseased cotton.

[0090] The biomass of *Verticillium dahliae* in diseased cotton was determined using qRT-PCR, with cotton EIF4α as an internal reference gene. *Verticillium dahliae*-specific primers are as follows:

[0091] VdEF-α-F (SEQ ID No. 13): 5′-TGAGTTCGAGGCTGGTATCT-3′;

[0092] VdEF-α-R (SEQ ID No. 14): 5′-CACTTGGTGGTGTCCATCTT-3′.

[0093] 25 μL system: 12.5 μL of 2×SuperReal PreMix Plus, 0.75 μL of forward primer (10 μM), 0.75 μL of reverse primer (10 μM), 1 μL of cDNA template and 10 μL of RNase-free ddH2O.

[0094] Calculate relative expression levels: the method is the same as above. Results are as follows... Figure 7 As shown, TRV:GhARA6 and TRV:GhARA7 showed significantly lower biomass of Verticillium dahliae compared to TRV:00.

[0095] Disease phenotypes of upland cotton TM-1 after inoculation with Verticillium dahliae, such as Figure 8 As shown, 30 days after inoculation with Verticillium dahliae, the incidence of Verticillium wilt in each experimental group, from most severe to healthiest, was: TRV:00 > TRV:GhARA6, TRV:GhARA7. No Verticillium wilt was observed in the control group (uninoculated with Verticillium dahliae).

[0096] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. In a silent plant RAB5 Gene silencing vectors for homologous genes, characterized in that, This includes a virus-induced gene silencing vector as the base vector, linked to the aforementioned... RAB5 Homologous gene-designed VIGS silencing fragments; The VIGS silencing fragment is a nucleotide sequence as shown in SEQ ID No. 1 and / or SEQ ID No. 2; The underlying carrier is a TRV carrier.

2. The application of the gene silencing vector according to claim 1 in improving plant disease resistance, characterized in that, The plant in question is cotton, and the disease in question is Verticillium wilt.

3. A method for improving plant resistance to diseases, characterized in that, This includes using the gene silencing vector of claim 1 to silence genes in the plant genome. GhARA6 and / or GhARA7 Suppress expression; The plant in question is cotton, and the disease in question is Verticillium wilt.

Images