Application of tomato virus resistance related gene AGO2a in regulating plant virus resistance

Abstract

The application discloses application of a tomato anti-virus related gene AGO2a in anti-virus, and relates to the technical field of genetic engineering. The AGO2a nucleotide sequence provided by the application is shown as SEQ ID NO. 3. The application discloses for the first time that overexpression of the tomato AGO2a gene can effectively inhibit virus infection, can inhibit accumulation of virus DNA in a plant body, and can improve the resistance of tomatoes to tomato yellow leaf curl virus. Meanwhile, the application also provides a preparation method of a tomato transgenic strain with tomato yellow leaf curl virus resistance. The prepared transgenic strain has significant application value in the field of tomato planting.

Description

TECHNICAL FIELD

[0001] The application relates to the field of genetic engineering, and particularly relates to application of a tomato virus resistance related gene AGO2a in regulation of plant resistance to viruses. BACKGROUND

[0002] Tomato yellow leaf curl virus (TYLCV) is the third most harmful plant virus in the world. After TYLCV infects tomatoes, the top leaves of the plants are slightly yellow and curled at the edges, the leaves are small and shriveled, the plants grow slowly, the internodes are shortened and the plants are significantly dwarfed, the flower setting rate is reduced, the flowering period is delayed, the fruit setting rate is reduced, the fruits are small and rigid, the color turning is uneven, and finally the yield is sharply reduced and the quality is poor. The virus is mainly transmitted by whiteflies and is the virus with the most extensive host range in the genus, which can infect 49 species of plants in 16 families, including important economic crops such as vegetables, fruit trees and flowers.

[0003] On the production, the disease caused by TYLCV is mainly prevented and treated by cultivating disease-resistant varieties, strengthening seedling detection, taking agricultural and chemical control measures and transgenic breeding. Among them, cultivating disease-resistant varieties has achieved remarkable prevention effect, but at present, the TY disease-resistant genes mined from wild tomatoes are limited, and with the continuous emergence of new isolates of TYLCV, compound infection is also more frequent, and the disease resistance of many disease-resistant varieties has also been broken. In addition, TYLCV relies on whiteflies for transmission, so using pesticides to eliminate whiteflies is an effective measure to curb the outbreak of tomato leaf curl disease, but the large-scale use of pesticides not only leads to the development of pesticide resistance in whiteflies, but also pollutes the environment and affects human health. Therefore, scientists have begun to seek safer and more effective prevention and control measures. Genetic engineering breeding is the combination of genetic engineering technology and conventional breeding technology, which can transfer virus sequences, miRNAs, siRNAs and the like into cultivated varieties, and then inhibit the replication and transcription of viruses through RNA interference (RNAi); or edit the virus genome and host genes involved in virus replication by transferring CRISPR-Cas 9 gene editing vectors. Genetic engineering breeding has a short cycle, is friendly to the environment and has stable resistance, and has broad application prospects.

[0004] RNAi is a major virus invasion prevention mechanism in plants, and AGOs protein is crucial in the RNAi antiviral immune pathway and has antiviral function against various viruses. Previous studies have found that tomato AGO2a gene can significantly inhibit the accumulation of CMV RNA, thereby improving the plant's resistance to viruses. However, there is no report on the function of tomato AGO2a gene against DNA viruses and the application of AGO2a in plant to create TYLCV-resistant germplasm. SUMMARY

[0005] The application discloses a tomato anti-virus related gene AGO2a and a new use of the tomato anti-virus related gene AGO2a in resisting tomato yellow leaf curl virus, and provides a method for improving the anti-virus of tomatoes.

[0006] In order to achieve the above-mentioned purpose, the application provides a tomato anti-virus related gene AGO2a, wherein the nucleotide sequence of the AGO2a is shown in SEQ ID NO. 3.

[0007] The tomato anti-virus related gene AGO2a provided by the application can be applied to the regulation of plant anti-virus.

[0008] Preferably, the plant is Micro-Tom tomato, and the anti-virus is resistance to tomato yellow leaf curl virus.

[0009] The tomato anti-virus related gene AGO2a provided by the application can be applied to the preparation of a transgenic tomato strain with resistance to tomato yellow leaf curl virus.

[0010] The application further provides a preparation method of the transgenic tomato strain with resistance to tomato yellow leaf curl virus.

[0011] (1) inserting a gene sequence with the nucleotide sequence shown in SEQ ID NO. 3 into a vector to obtain an overexpression recombinant plasmid;

[0012] (2) transferring the obtained overexpression recombinant plasmid into agrobacterium to obtain overexpression agrobacterium with the recombinant plasmid;

[0013] (3) transfecting the overexpression agrobacterium into tomatoes to obtain a tomato strain with high expression of the tomato anti-virus related gene, and obtaining a tomato strain with stable high expression of the tomato anti-virus related gene through self-crossing, that is, a transgenic tomato strain with resistance to tomato yellow leaf curl virus.

[0014] Preferably, the overexpression recombinant plasmid is selected from p1300 plasmids, and the overexpression agrobacterium is selected from agrobacterium GV3101.

[0015] The application has the following advantages:

[0016] The application discloses the use of the tomato AGO2a gene in resisting tomato yellow leaf curl virus TYLCV for the first time.

[0017] The application further provides a preparation method of transgenic tomato with resistance to tomato yellow leaf curl virus (TYLCV), which comprises the following steps: constructing an overexpression vector by using a gene fragment with the nucleotide sequence shown in SEQ ID NO. 3, and transferring the vector into tomato through Agrobacterium mediation to obtain the transgenic tomato with high resistance to tomato yellow leaf curl virus (TYLCV), which has application value in screening of resistant tomato strains and tomato breeding. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Figure 1 shows the expression of AGO2a genome gene in T1 generation plants of transgenic line 1 and line 2; A is a schematic diagram of Myc-AGO2a vector construction, Hyg (Hygromycin) is a hygromycin resistance gene, 35Sp is a cauliflower mosaic virus 35S promoter, and E9t is an E9 termination site; B is the electrophoresis result of PCR detection of p1300-Myc-AGO2a recombinant plasmid in transgenic line 1 and line 2; C is the expression of Myc-AGO2a fusion protein in transgenic line 1 and line 2 detected by Western-blot, the size of the fusion protein is about 123 kDa, and Ponceau is Rubisco large subunit dyed with ponceau as a loading control.

[0019] Figure 2 Figure 2 shows the influence of AGO2a overexpression on the growth and development of tomato; A shows the growth and development of tomato leaves, flowers, fruits and plants after AGO2a overexpression; B shows the expression of Myc-AGO2a fusion protein in T3 generation plants of transgenic line 1 and line 2 detected by Western-blot, and Ponceau is Rubisco large subunit dyed with ponceau as a loading control; C shows the expression of AGO2a in transgenic line 1 and line 2 analyzed by qRT-PCR, the error bar represents the standard deviation of three biological repeated experiments, and the asterisk indicates that the difference is statistically significant (*p<0.05, **<0.01).

[0020] Figure 3 Figure 3 shows the accumulation amount of TYLCV in susceptible tomato after AGO2a overexpression; Figure 3A is the symptom of Micro-Tom tomato inoculated with TYLCV of different genotypes after 21 days, in which MOCK is the healthy control of Micro-Tom tomato treated with infiltration Buffer; B is the expression of Myc-AGO2a fusion protein in plants detected by Western-blot, and the accumulation amount of TYLCV in Micro-Tom of different genotypes after 21 days of inoculation with TYLCV is analyzed by Southern-blot, in which Ponceau is the Rubisco large subunit dyed with ponceau as the loading amount control, Total DNA is the DNA loading control, SC is the supercoiled DNA configuration of TYLCV, SS is the single-stranded DNA configuration of TYLCV, loading is the loading control, and the viral DNA content value is the gray value ratio of ponceau and Total DNA; C is the gray value analysis result of the accumulation amount of viral DNA in tomato, the error line indicates the standard deviation of three biological repeated experiments, and the asterisk indicates that the difference is statistically significant (**<0.01, ***<0.001). DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present application will be described below in a clear and complete manner. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0022] Description: In the following examples, the experimental methods are all conventional methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0023] Example 1 A method for cultivating an AGO2a transgenic tomato resistant to TYLCV

[0024] The present embodiment provides a method for cultivating a transgenic tomato resistant to TYLCV, which is as follows:

[0025] (1) The leaf samples of Micro-Tom tomato (MT tomato) are taken, and the CTAB method is used to extract genomic DNA;

[0026] (2) The primers AGO2a-F and AGO2a-R are used, and the nucleotide sequences thereof are shown in SEQ ID NO. 1 and 2, respectively, and the specific sequences are as follows. The extracted genomic DNA is used as a template for PCR amplification, and the cloned product is sequenced to obtain a tomato AGO2a genomic gene of 6395 bp in size, and the nucleotide sequence thereof is shown in SEQ ID NO. 3;

[0027] AGO2a-F (SEQ ID NO. 1): atggatcgtgggaactaccg;

[0028] AGO2a-R (SEQ ID NO. 2): tcagacgaaaaacattacgt;

[0029] (3) The AG02a genomic gene with nucleotide sequence as shown in SEQ ID NO. 3 was constructed into p1300 vector with Myc tag by homologous recombination method to obtain p1300-Myc-AGO2a recombinant plasmid, and the schematic diagram of construction of the recombinant plasmid is shown as A in Figure 1 ;

[0030] (4) The obtained p1300-Myc-AGO2a recombinant plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the bacterial liquid was coated on the resistant medium. A primer pair Myc-colony-F and AG02a-detect-R for detecting Myc-AGO2a recombinant gene was designed, and the nucleotide sequences thereof are shown in SEQ ID NO. 4 and 5, respectively, for screening single colony Agrobacterium with p1300-Myc-AGO2a recombinant plasmid,

[0031] Myc-colony-F (SEQ ID NO. 4): gacccttcctctatataagg;

[0032] AG02a-detect-R (SEQ ID NO. 5): cgttgaaccggttggtttac;

[0033] (5) The correct single colony Agrobacterium obtained by screening was transferred into YEP liquid medium containing antibiotics, and cultured at 28°C, 220 rpm overnight until OD 600 600-1.0. The bacterial liquid was centrifuged, and the OD 600 600 was adjusted to 0.6 with suspension buffer. Nicotiana benthamiana leaves were injected, and the injected leaves were collected after 36 hours and total protein was extracted. Western blot analysis was used to analyze the expression of Myc-AGO2a fusion protein, and the results showed that a specific band of about 123 kDa size could be detected in the injected Nicotiana benthamiana, which was consistent with the size of Myc-AGO2a fusion protein, indicating that the p1300-Myc-AGO2a recombinant plasmid could be correctly expressed.

[0034] (6) The single colony Agrobacterium with Myc-AGO2a recombinant plasmid was expanded and cultured, and the OD 600Adjust to 0.6, resuspend for 3h after infection of sterile culture of MT tomato AGO2a gene knockout mutant ago2a-453 (recorded as MT-ago2a-354) cotyledon leaf (the knockout mutant ago2a-453 is a tomato AGO2a gene mutant constructed by CRISPR-Cas9, for details, see article Zhao L, Chen Y, Xiao X, et al. AGO2a but not AGO2b mediates antiviral defense against infection of wild-type cucumber mosaic virus in tomato. Hortic Res. 2023; 10(5): uhad043. Published 2023 Mar 13. doi: 10.1093 / hr / uhad043), obtain callus by co-cultivation, induce sprouts by differentiation culture, and finally obtain 2 lines (recorded as MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2, respectively) of tissue culture seedlings by rooting culture, and transfer to the greenhouse for further culture;

[0035] (7) After the tissue culture seedlings grow stably, the DNA of the two lines of tissue culture seedlings is extracted by CTAB method, and the extracted DNA is subjected to PCR amplification by using Myc-colony-F and AGO2a-detect-R primers. The results show that a band of about 550bp is amplified from the two lines of tissue culture seedlings, and the amplified product is sequenced again to confirm that the obtained product is the sequence of Myc-AGO2a recombinant gene, and the electrophoresis result is shown in B of Figure 1 , wherein the three lanes represent the amplification products of the templates used. Therefore, it is determined that the p1300-Myc-AGO2a recombinant plasmid is introduced into the two lines of tissue culture seedlings;

[0036] (8) The total protein of the above two lines of tissue culture seedlings is extracted, and subjected to SDS-PAGE gel electrophoresis, and Western-blot detection is performed by using Myc antibody to determine the expression of Myc-AGO2a fusion protein in the tissue culture seedlings, and the SDS gel electrophoresis result is shown in C of Figure 1 , and the specific band of about 123kDa is detected in the two lines of tissue culture seedlings, which is consistent with the size of Myc-AGO2a fusion protein, indicating that Myc-AGO2a fusion protein is normally expressed in ago2a-453 mutant tomato;

[0037] (9) The tissue culture seedlings of the above two lines were further cultured and seeds were collected from single plant. The segregation ratio of T2 generation was calculated and it was found that both MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 were in accordance with the segregation ratio of 1:3. The two lines were further bred and the growth and development phenotypes of leaves, flowers and fruits were observed. It was found that the growth and development phenotypes of T3 generation of MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 were consistent with those of wild type. The results are shown in Fig. A of Figure 2 . Four plants (ago2a-453-AGO2a-1-1, 2, 3, 4 and ago2a-453-AGO2a-2-1, 2, 3, 4, see Fig. B of Figure 2 ) were randomly selected from T3 generation of MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 and Western-blot detection was performed. The specific band of about 123 kDa was detected. The results are shown in Fig. B of Figure 2 . The Myc in the figure indicates that Myc-AGO2a fusion protein was obtained by hybrid fusion of Myc tag protein, which was used to prove that the introduced AGO2a was normally expressed in the transgenic plants. The size of the specific band was consistent with that of Myc-AGO2a fusion protein, indicating that Myc-AGO2a fusion protein was normally expressed in ago2a-453 mutant tomato. qRT-PCR detection of mRNA expression of AGO2a in T3 generation of the two lines showed that the mRNA expression of AGO2a in the two lines was significantly increased and stably expressed. The quantitative results are shown in Fig. C of Figure 2 .

[0038] (10) T3 generation of MT-ago2a-453-AGO2a-2 was used for virus TYLCV inoculation and the disease symptoms were observed and the virus accumulation was analyzed by Southern-blot. The results of disease symptom observation showed that TYLCV infection caused leaf crinkling, curling and severe dwarfing of tomato plants in three different genotypes of tomato, but the symptoms of crinkling, curling and dwarfing of ago2a-453 were more obvious than those on WT and ago2a-453-AGO2a-2 plants, and there was no obvious difference between WT and ago2a-453-AGO2a-2 plants. The tomato phenotypes are shown in Fig. A of Figure 3 . MOCK in the figure is the healthy control of MT tomato treated with infiltration Buffer. Further analysis of the difference in TYLCV virus accumulation in the virus infected plants showed that the virus accumulation in ago2a-453 was significantly higher than that in WT and ago2a-453-AGO2a-2 plants. The results are shown in Fig. B of Figure 3As shown in B and C, Repeat1, 2, and 3 represent technical replicates of three detections. It can be seen that the viral DNA accumulation in TYLCV-infected ago2a-453 plants was significantly higher than that in WT and ago2a-453-AGO2a-2 plants, while the accumulation in ago2a-453-AGO2a-2 plants was significantly lower than that in WT. These results indicate that AGO2a overexpression transgenic plants can significantly inhibit the accumulation of TYLCV virus in plants.

[0039] In summary, this invention discloses a novel use of the tomato AGO2a gene, specifically, overexpression of this gene can inhibit the accumulation of viral DNA in plants and improve the resistance of tomatoes to tomato yellow leaf curl virus. Furthermore, this invention provides a method for preparing transgenic tomato lines resistant to tomato yellow leaf curl virus, and the prepared transgenic lines have significant application value in the field of tomato cultivation.

[0040] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

[0041]

[0042]

[0043]

[0044]

Claims

1. The application of the tomato antiviral-related gene AGO2a in enhancing the antiviral resistance of Micro-Tom tomatoes, characterized by, The nucleotide sequence of AGO2a is shown in SEQ ID NO.3, and the antiviral agent is an anti-tomato yellow leaf curl virus.

2. The application of the tomato virus resistance-related gene AGO2a in the preparation of transgenic tomato lines resistant to tomato yellow leaf curl virus, characterized in that, The nucleotide sequence of AGO2a is shown in SEQ ID NO.

3.

3. A method for preparing a transgenic tomato line resistant to tomato yellow leaf curl virus, characterized in that, It includes the following steps: (1) Insert the gene sequence with the nucleotide sequence shown in SEQ ID NO.3 into the vector to obtain an overexpression recombinant plasmid; (2) The overexpression recombinant plasmid is transferred into Agrobacterium to obtain overexpression Agrobacterium carrying the recombinant plasmid; (3) Transfect tomatoes with the overexpressing Agrobacterium to obtain tomato lines with high expression of the tomato antiviral related genes, and obtain tomato lines with stable high expression of the tomato antiviral related genes through self-pollination, which are the transgenic tomato lines.

4. The preparation method according to claim 3, characterized in that, The overexpression recombinant plasmid is the p1300 plasmid.

5. The preparation method according to claim 3, characterized in that, The overexpressing Agrobacterium is GV3101.

Images