Application of rice OsZOS1-18 gene in regulation and control of salt tolerance

Abstract

The invention aims to disclose a rice salt tolerance related gene ZOS1-18 as well as a coding protein and application thereof. The gene ZOS1-18 is a DNA (Deoxyribose Nucleic Acid) molecule as shown in 1), 2) or 3): 1) a DNA molecule with a genomic sequence as shown in SEQ ID NO.1; 2) a DNA molecule with a CDS sequence as shown in SEQ ID NO.2; and 3) a DNA molecule which is hybridized with the DNA sequence limited by 1) or 2) under strict conditions and is used for coding the protein. According to the gene engineering application of the gene ZOS1-18 in regulating and controlling the salt tolerance of the rice, specifically, the gene ZOS1-18 is knocked out, and the salt sensitivity of the rice is improved; through overexpression of the gene ZOS1-18, the salt tolerance of the rice is improved.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a rice salt tolerance related gene ZOS1-18 and its encoded protein and application. Background Art

[0002] Soil salinization is one of the important factors restricting the development of agricultural production in the world. About 1 billion hectares of land in the world are affected by salt damage. Soil salinization not only makes it difficult for crop roots to absorb water and reduces the efficiency of crop absorption of nutrients, but also leads to poor soil tillage and a decrease in beneficial microorganisms in the soil, which seriously affects the growth and development of crops and their yields. Generally speaking, when the soil salt content exceeds 0.1%, the growth of common crop varieties begins to be affected; when the soil salt content exceeds 0.3%, the yield of most crop varieties decreases significantly. my country has more than 500 million mu of various types of usable saline-alkali land resources, making it the third largest country in the world in terms of saline-alkali land distribution. Saline-alkali land is an extremely important reserve arable land resource and "potential granary" in my country. The improvement of saline-alkali land is of great significance to increasing the amount of arable land and improving the quality of arable land. Rice is one of the most important food crops in the world, providing staple food for nearly half of the population. The water environment during rice growth can leach soluble salt and alkali in the soil, making it the preferred food crop for developing coastal tidal flats. However, rice has poor salt tolerance. Breeding salt-alkali tolerant rice varieties is an effective way to further increase the planting area and yield of this crop in saline-alkali areas.

[0003] High salt environment mainly produces two kinds of stress on rice, namely osmotic stress and ion stress. Osmotic stress makes it difficult for rice roots to absorb water from the outside; while ion stress causes a large amount of Na to accumulate in root cells. + , destroying the root system's ability to resist K + , Ca 2+ The absorption of other ions affects the ion homeostasis in the cell. In order to survive under high-salt conditions, rice has gradually developed physiological regulatory mechanisms to cope with osmotic stress and ionic stress during the long-term evolution process, including osmotic regulation and ion balance regulation. Osmotic regulation ability is one of the most basic characteristics of rice salt tolerance. The strength of rice salt tolerance depends to a large extent on the strength of the rice cell's own osmotic regulation ability. Under high-salt stress, rice plants can accumulate a large amount of osmotic regulating substances through their own synthesis or absorption from the outside world, including proline, soluble sugars, fructose, sucrose, polyamines and other organic osmotic regulating substances and Na + , K + , Ca 2+ and Cl -The accumulation of these hydrophilic osmotic regulating substances helps to increase the concentration of rice cell fluid, reduce osmotic potential, improve the cell's ability to retain or absorb water, enable the cell to perform normal physiological functions, adapt to the external high-salt environment, and thus improve the salt tolerance of rice. Ion balance regulation is to regulate the intracellular turgor pressure, pH value and ion content by adjusting the relative concentration of inorganic ions inside and outside the cell, thereby maintaining the stability of the intracellular microenvironment. Among them, the most important inorganic ion for ion balance regulation is Na + and K + Rice mainly regulates Na + and K + The absorption, transport, and efflux of these molecules control their concentration. These processes are mainly controlled by high-affinity K + Transporters (HKT), non-selective cation channels (NSCCs), Na + / K + Antiporter (NHX), high affinity K + Proteins from multiple families, including the HAK transporter (HAK), are involved.

[0004] Rice salt tolerance is a quantitative trait controlled by micro-effect multiple genes. Currently, more than 100 rice salt tolerance-related genes have been cloned, among which the more important salt tolerance genes include SKC1, qSE3, DST, STH1, RST1, etc. SKC1 encodes a sodium ion transporter HKT of the HKT family 1；5 , responsible for the aboveground Na + Content regulation, under salt stress, it can transfer excess Na + Transported to the roots, reducing Na + Toxicity, improve rice salt tolerance. + The transporter OsHAK21 promotes K transport during rice seed germination under salt stress + and Na +absorption, activating the ABA signaling pathway, thereby improving the salt tolerance of rice seeds during germination. The DST gene encodes a novel transcription factor containing a C2H2 type zinc finger domain, which directly binds to the DBS element in the promoter of reactive oxygen-related genes, regulates the expression of these genes, affects the accumulation of reactive oxygen, and thus regulates the opening of the stomata, ultimately affecting the drought and salt tolerance of rice. STH1 encodes an α / β folded domain hydrolase, which is derived from the variant form of African rice. Due to a mutation in a SNP, its translation is terminated prematurely and its enzyme activity is lost; the introduction of the STH1 gene locus in the allele form of African rice not only delays the heading time of rice, but also significantly increases the yield of rice under normal field environment and salt stress conditions. RST1 encodes the auxin response factor OsARF18, which has transcriptional repression activity and can directly bind to the promoter of the asparagine synthase gene OsAS1 and inhibit its expression; the loss of RST1 function leads to the upregulation of OsAS1 expression, which improves nitrogen utilization by promoting the synthesis of asparagine and reduces Na + / K + Ratio, reduce NH4 + Excessive accumulation can improve the salt tolerance and yield of plants.

[0005] Due to the complex genetic basis of rice salt tolerance, it is difficult to improve salt tolerance using traditional breeding methods. The use of molecular design breeding technology can accelerate the breeding process of new salt-tolerant rice varieties, which depends on the mining and functional analysis of key salt-tolerant genes. Although some salt-tolerant genes have been reported, few have been successfully applied in breeding practice. Therefore, it is necessary to further strengthen the research on the mining of new salt-tolerant genes in rice to lay a theoretical and material foundation for the breeding of new salt-tolerant varieties. Summary of the invention

[0006] In order to overcome the above technical problems existing in the prior art, the present invention provides the genetic engineering application of rice ZOS1-18 in regulating rice salt tolerance.

[0007] Genetic engineering application of rice gene ZOS1-18, or protein encoded by gene ZOS1-18, or recombinant expression vector or expression cassette containing gene ZOS1-18, or recombinant bacteria containing gene ZOS1-18, or knockout vector of gene ZOS1-18, or primers for amplifying gene ZOS1-18 in regulating rice salt tolerance,

[0008] The gene ZOS1-18 is a DNA molecule as described in 1) or 2) or 3) below:

[0009] 1) A DNA molecule having a genome sequence as shown in SEQ ID NO.1;

[0010] 2) a DNA molecule having a CDS sequence as shown in SEQ ID NO.2;

[0011] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein.

[0012] Furthermore, knocking out the aforementioned gene ZOS1-18, or reducing the expression of the protein encoded by the gene ZOS1-18 in rice, or introducing a knockout vector of the gene ZOS1-18 into rice can improve the salt sensitivity of rice.

[0013] Specifically, the knockout vector of gene ZOS1-18 utilizes CRISPR-Cas9 technology to edit the gene in rice, thereby knocking out the aforementioned gene ZOS1-18 in the rice plant and rendering the gene inoperable.

[0014] Furthermore, overexpression of the aforementioned gene ZOS1-18, or transfer of a recombinant expression vector or expression cassette containing the gene ZOS1-18 into rice, or transfer of a recombinant bacterium containing the gene ZOS1-18 into rice can improve the salt tolerance of rice.

[0015] Overexpression of the aforementioned gene ZOS1-18 is achieved by transforming plant cells or tissues using an expression vector carrying the gene ZOS1-18 by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and cultivating the transformed plant tissues into plants. By using any vector that can be used for gene editing in plants, the gene encoding the protein is knocked out to obtain transgenic cell lines and transgenic plants.

[0016] Furthermore, the amino acid sequence of the protein encoded by the gene ZOS1-18 is shown in SEQ ID NO.3.

[0017] Furthermore, the recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into a plant expression vector.

[0018] The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the carmine synthase Nos gene) and the 3' non-translated region of the plant gene (such as the soybean storage protein gene) transcription, which have similar functions.

[0019] When the gene is used to construct a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter and the ubiquitin promoter of corn, which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene.

[0020] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0021] Furthermore, the recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into the recombination site of the vector pCAMBIA1301 double-digested with restriction endonucleases HindⅢ and BstEII.

[0022] Furthermore, the recombinant bacteria containing gene ZOS1-18 are obtained by transferring the recombinant expression vector or expression cassette into an engineering bacterium.

[0023] Furthermore, the primers for amplifying gene ZOS1-18 are selected from primer 1 shown in SEQ ID NO.4, primer 2 shown in SEQ ID NO.5, or primer 5 shown in SEQ ID NO.11, primer 6 shown in SEQ ID NO.12.

[0024] primer1: 5'-ATGGACAGTGGCTTGGGAA-3' (SEQ ID NO.4);

[0025] Primer2: 5'-TCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 5).

[0026] Primer5: 5'-GCAGGTGGCTTCTTTCCAAC-3' (SEQ ID NO. 11);

[0027] Primer6: 5'-GCCCCTCATGTGCATCCTAA-3' (SEQ ID NO. 12).

[0028] Furthermore, the knockout vector of the gene ZOS1-18 is a CRISPR / Cas9 vector capable of knocking out one or more of the target sequences such as target 1, target 2 and target 3 shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8.

[0029] Beneficial effects:

[0030] The present invention is the first to discover a new gene ZOS1-18 of a plant salt tolerance-related protein. The plant salt tolerance-related protein of the present invention affects the salt tolerance of plants. Introducing the coding gene of the protein into plants can improve the salt tolerance of plants, thereby cultivating salt-tolerant transgenic plants. Inhibiting the expression of the protein coding gene can lead to a decrease in plant salt tolerance, thereby cultivating salt-sensitive transgenic plants. The protein and its coding gene can be used for plant genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The mutation site of the ZOS1-18 gene and its flanking sequences in the ZOS1-18 gene mutants (zos1-18-1 and zos1-18-2).

[0032] Figure 2 The expression levels of the ZOS1-18 gene in the wild-type Nipponbare and the ZOS1-18 overexpression strains (ZOS1-18-OE1 and ZOS1-18-OE2).

[0033] Figure 3 The phenotypes of wild-type Nipponbare and ZOS1-18 gene mutants (zos1-18-1 and zos1-18-2) under salt stress.

[0034] Figure 4 The survival rate of seedlings of wild-type Nipponbare and ZOS1-18 gene mutants (zos1-18-1 and zos1-18-2) under salt stress.

[0035] Figure 5 The phenotypes of wild-type Nipponbare and ZOS1-18 overexpression strains (ZOS1-18-OE1 and ZOS1-18-OE2) under salt stress.

[0036] Figure 6The survival rate of seedlings of wild-type Nipponbare and ZOS1-18 overexpression lines (ZOS1-18-OE1 and ZOS1-18-OE2) under salt stress. DETAILED DESCRIPTION

[0037] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0038] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The reagents and kits used in the following examples are purchased from conventional biological reagent companies unless otherwise specified.

[0039] Example 1: Cloning of the coding region sequence (CDS) of rice ZOS1-18 gene

[0040] Design the following primers:

[0041] primer1: 5'-ATGGACAGTGGCTTGGGAA-3' (SEQ ID NO.4);

[0042] Primer2: 5'-TCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 5).

[0043] The cDNA of rice variety Nipponbare leaves was used as template, and the primer pair consisting of primer1 and primer2 was used for PCR amplification to obtain the CDS fragment of the target gene ZOS1-18. The PCR reaction system (50μl) was: template cDNA (50ng / μl) 2μl, primer1 (10uM) 1.5μl, primer2 (10uM) 1.5μl, dNTP Mix (10mM) 1μl, 2×Phanta MaxBuffer 25μl, Phanta Max Super-Fidelity DNA Polymerase 1μl, ddH2O 18μl. The PCR amplification reaction was carried out in a Bio-rad T100 PCR instrument, and the program was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 1min, 35 cycles; 72℃ extension for 5min; 4℃ storage.

[0044] The PCR product was recovered and purified using a DNA purification kit (Nanjing Novogene Biotech Co., Ltd.), ligated to the expression vector pEASY-Blunt (Beijing Quanshijin Biotechnology Co., Ltd.), transformed into Escherichia coli DH5α competent cells (Beijing Tiangen Company), and the positive clones were selected and sent to GenScript Biotech Co., Ltd. for sequencing.

[0045] The sequencing results showed that the CDS fragment of the ZOS1-18 gene obtained by PCR amplification had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein composed of 522 amino acid residues (SEQ ID NO.3).

[0046] Example 2: Construction and identification of rice ZOS1-18 gene mutant transgenic plants

[0047] 1. Construction of transgenic plants of ZOS1-18 gene mutant

[0048] The genome sequence (SEQ ID NO.1) and CDS sequence (SEQ ID NO.2) of ZOS1-18 were provided to Wuhan Boyuan Biotechnology Co., Ltd., which designed the target. The specific method is as follows: the genome sequence (SEQ ID NO.1) of ZOS1-18 was input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the CRISPR-Cas9 sgRNA target was designed by the website, and one or more of target 1, target 2 and target 3 were selected for gene editing vector construction.

[0049] The sequence of target 1 is: GAAGACTGAACCCCAAAGAGTGG (SEQ ID NO.6),

[0050] The sequence of target 2 is: TGAGGGTCCCAATCCATTGTAGG (SEQ ID NO.7),

[0051] The sequence of target 3 is: CTGCTTTGCTTGTGCCTCGCTGG (SEQ ID NO.8)

[0052] The above three sgRNA units were synthesized into the intermediate vector PUC57 by full gene synthesis. Then, Primer3 and Primer4 primers were synthesized, and PCR amplification was performed using the PUC57 plasmid with three sgRNAs inserted as a template to obtain a double-stranded DNA molecule with sticky ends.

[0053] Primer3:5'-CAGTGGTCTCATGCAACCACAACCATCCATAGAGCGTTTTAGAG-3' (SEQ IDNO.9);

[0054] Primer4:5'-CAGTGGTCTCAAAACCCTTGCAAACAAACTGCCGGTGC-3'(SEQ ID NO.10)

[0055] The double-stranded DNA molecule was connected to the pHK1-Cas9-U3 linearized vector cut by Bsa I using T4 DNA ligase (the vector is contained in the "Monocotyledon Gene Editing Vector Kit (Hyg)" of Wuhan Boyuan Biotechnology Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α, and the positive clones were identified by colony PCR, and the plasmid was extracted for sequencing. The sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 was obtained. Then, the Nipponbare callus was transformed by Agrobacterium-mediated genetic transformation to obtain T0 transgenic plants.

[0056] 2. Molecular identification of ZOS1-18 gene mutant plants

[0057] Take the leaves of the T0 generation plants of the ZOS1-18 gene mutant obtained in step 1, extract genomic DNA, use the genomic DNA as a template, and use the primer pair consisting of Primer5 and Primer6 to perform PCR amplification on the editing target sites shown in SEQ ID NO.6, SEQ ID NO.7 and SEQID NO.8 and the DNA fragments on both sides thereof.

[0058] Primer5: 5'-GCAGGTGGCTTCTTTCCAAC-3' (SEQ ID NO. 11);

[0059] Primer6: 5'-GCCCCTCATGTGCATCCTAA-3' (SEQ ID NO. 12).

[0060] The PCR products were detected by 1% agarose gel electrophoresis and sent to GenScript Biotech Co., Ltd. for sequencing. Based on the sequencing results, two strains with mutations in the ZOS1-18 gene were screened and identified, and they were named zos1-18-1 and zos1-18-2. The DNA sequences of the editing target sites and their flanking sites in these two strains are shown in Figure 2. Figure 1 shown.

[0061] In the zos1-18-1 strain, there was one insertion of 1 nucleotide and two deletions of 2 nucleotides in the exon of the ZOS1-18 gene;

[0062] In the zos1-18-2 strain, there were two deletions of 2 nucleotides and one insertion of 1 nucleotide in the exon of the ZOS1-18 gene;

[0063] In both strains, mutations in the ZOS1-18 gene resulted in frameshift and premature termination of protein translation.

[0064] Example 3: Construction and identification of rice gene ZOS1-18 overexpressing transgenic plants

[0065] 1. Construction of ZOS1-18 gene overexpression vector

[0066] Using cDNA from Nipponbare seedling leaves as a template, PCR amplification was performed using a primer pair consisting of primer7 and primer8 including a linker to obtain a full-length CDS fragment of the ZOS1-18 gene (SEQ ID NO. 2).

[0067] primer7: 5'-ACCTGCAGGCATGCAAGCTTATGGACAGTGGCTTGGGAA-3' (SEQ ID NO. 13);

[0068] Primer8: 5'-GGAAATTCGAGCTGGTCACCTCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 14).

[0069] The PCR product was connected to the expression vector pCAMBIA1301 through the HindⅢ and BstEII double restriction sites, transformed into Escherichia coli DH5α competent cells (Beijing Tiangen Company), and the positive clones were selected and sent to GenScript Biotech Co., Ltd. for sequencing.

[0070] The sequencing results showed that a recombinant expression vector containing the sequence shown in SEQ ID NO.2 was successfully constructed and named pCAMBIA1301-ZOS1-18.

[0071] 2. Obtaining recombinant Agrobacterium

[0072] pCAMBIA1301-ZOS1-18 was transformed into Agrobacterium tumefaciens EHA105 strain by electroporation to obtain recombinant Agrobacterium. The plasmid was extracted, and PCR amplification and enzyme digestion were performed for identification. The correctly identified recombinant Agrobacterium was named EH-pCAMBIA1301-ZOS1-18.

[0073] 3. Obtaining transgenic rice plants

[0074] The EH-pCAMBIA1301-ZOS1-18 strain was transformed into rice variety Nipponbare callus tissue by the following method:

[0075] (1) Induction of rice callus: Take mature seeds of Nipponbare, peel off the seed coat, sterilize in 75% ethanol for 2.5 min, sterilize with 40 mL 2% sodium hypochlorite solution (containing a small amount of Tween 20) for 20 min, wash with sterile water for more than 3 times, transfer to sterile filter paper to absorb residual water; the sterilized seeds are evenly spread on N6D solid culture medium, and cultured in a light incubator at 28°C for 28 days, with the culture medium replaced once in the middle.

[0076] (2) The EH-pCAMBIA1301-ZOS1-18 strain was inoculated into 5 mL YEP liquid medium and cultured overnight at 28°C and 200 rpm; the strain was transferred into a new 50 mL YEP liquid medium at a ratio of 1:50 and cultured at 28°C and 200 rpm until the OD 600 =0.6-0.8; centrifuge at 4°C, 3000g for 10 min to collect the cells; resuspend the cells in AAM liquid medium (containing 10 mg / LAS) to make OD 600 =0.05-0.1.

[0077] (3) Mix the callus tissue in step (1) with the bacterial solution in step (2) and infect for 90 seconds, inverting and mixing continuously during the process; discard the bacterial solution, transfer the callus tissue to sterile filter paper to drain, and then transfer to 2N6-AS solid culture medium and culture in the dark at 28°C for 48-60 hours.

[0078] (4) Place the callus tissue in step (3) into a 50 ml centrifuge tube, wash with sterile water for more than 6 times, and then soak in sterile water containing 500 mg / L Car for 15 minutes; discard the sterile water, transfer the callus tissue to sterile filter paper, and drain for 1-2 hours.

[0079] (5) The callus tissue in step (4) was transferred to N6D-S solid medium containing 50 mg / L hygromycin for screening and cultured in a 28°C light incubator for 28 days, with the medium replaced once in the middle.

[0080] (6) The resistant callus obtained by screening in step (5) was transferred to MS-NK solid culture medium and cultured in a light incubator at 28° C. for 3-4 weeks; when the adventitious buds grew to 3-4 cm, the callus was transferred to MS-HF rooting medium and cultured for 1 week.

[0081] (7) After hardening the seedlings differentiated in step (6), the seedlings are transferred to the field for growth to obtain T0 generation transgenic rice plants.

[0082] 4. Identification of transgenic rice plants

[0083] 1. PCR molecular identification

[0084] The genomic DNA of the T0 transgenic rice plant obtained in step 3 was extracted and used as a template for PCR amplification using a primer pair consisting of primer9 and primer10. The primer sequences are as follows:

[0085] primer9: 5'-CTTCGTCAACATGGTGGAGCAC-3' (SEQ ID NO. 15);

[0086] Primer10: 5'-GATCATAGGAGCACAAAGTG-3' (SEQ ID NO. 16).

[0087] Among them, primer9 is located in the pCAMBIA1301 vector sequence, and primer10 is located in the CDS sequence of the ZOS1-18 gene shown in SEQ ID NO.2.

[0088] The PCR products were detected by 1% agarose gel electrophoresis, and the plants with the target band detected were positive.

[0089] 2. Detection of ZOS1-18 gene expression

[0090] The positive transgenic T0 plants screened by PCR molecular identification in step 1 were self-pollinated for two generations to obtain homozygous lines for the detection of ZOS1-18 gene expression. The roots of three-leaf seedlings were taken and the total RNA of the tissue was extracted by Trizol method. The total RNA was reverse transcribed into cDNA using a reverse transcription kit. Rice OsUBQ5 was used as the internal reference gene and the expression of ZOS1-18 gene was detected by Takara TB Premix Ex Taq TM II (Tli RNaseH Plus) kit was used to detect the transcription level of ZOS1-18 genes. The sequences of the primers (primer11 and primer12) for quantitative detection of ZOS1-18 genes and primers (primer13 and primer14) for quantitative detection of OsUBQ5 genes used are as follows:

[0091] primer11: 5'-TCAACAGCTGGTTCCTTGCT-3' (SEQ ID NO. 17);

[0092] primer12: 5'-AGGAATTGTGGCTTCGTCGT-3' (SEQ ID NO. 18).

[0093] primer13: 5'-ACCACTTCGACCGCCACTACT-3' (SEQ ID NO. 19);

[0094] primer14: 5'-ACGCCTAAGCCTGCTGGTT-3' (SEQ ID NO. 20).

[0095] The relative expression of ZOS1-18 genes was calculated using 2 -△△CT The calculation results are as follows Figure 2 As shown, the relative expression level of ZOS1-18 to OsUBQ5 in the Nipponbare wild type (WT) was taken as 1, and the relative expression levels of the ZOS1-18 genes in the two overexpression strains (ZOS1-18-OE1 and ZOS1-18-OE2) increased by about 40 times.

[0096] Example 4: Identification of salt tolerance of ZOS1-18 gene mutants and overexpression strains

[0097] The two ZOS1-18 gene T0 transgenic mutant plants constructed in Example 2 were selfed for two generations to obtain homozygous mutant strains (zos1-18-1 and zos1-18-2). These two homozygous mutant strains and the two homozygous ZOS1-18 gene overexpression strains (ZOS1-18-OE1 and ZOS1-18-OE2) constructed in Example 3 were cultured as seedlings and identified for salt tolerance together with the Nipponbare wild type.

[0098] The specific methods for rice seedling cultivation and salt tolerance identification are:

[0099] 1. Soak the rice seeds that have broken dormancy at 30℃ for 48 hours and germinate at 33℃ for about 24 hours until the seeds germinate.

[0100] 2. Select seeds with consistent germination, sow them on a 96-well PCR plate with the bottom cut off, place them in a black plexiglass culture box, and culture them in an artificial climate chamber. After culturing in pure water for 1 week, switch to Kimura B nutrient solution, which is changed every 3 days. Seedling culture conditions are: 14h light (28℃) / 10h dark (24℃), light intensity 1000μmol·m -2 ·s -1 , relative humidity 70%.

[0101] 3. When the seedlings grew to the two-leaf and one-heart stage, salt stress treatment was carried out and the nutrient solution was replaced with Kimura B nutrient solution containing 120 mM NaCl, which was replaced every 3 days.

[0102] 4. After 5-7 days of NaCl treatment, the seedlings were rehydrated and cultured with Kimura B nutrient solution without NaCl. The survival rate of the seedlings was calculated after 5 days. Survival rate = number of surviving seedlings / total number of treated seedlings × 100%.

[0103] The results of salt tolerance identification of ZOS1-18 gene mutant strains are shown in Figure 3 and Figure 4 The results showed that compared with the wild type (WT) of Nipponbare, the two ZOS1-18 gene mutant strains showed more severe salt damage symptoms such as leaf wilting and death under salt stress ( Figure 3 ), the survival rate of seedlings after rehydration was significantly lower than that of the wild type ( Figure 4 ).

[0104] The results of salt tolerance identification of ZOS1-18 gene overexpression strains are shown in Figure 5 and Figure 6 The results showed that compared with the wild type (WT) of Nipponbare, the two ZOS1-18 gene overexpression lines showed milder salt damage symptoms such as leaf wilting and death under salt stress ( Figure 5 ), the survival rate of seedlings after rehydration was significantly higher than that of the wild type ( Figure 6 ).

[0105] The above experimental results show that the ZOS1-18 gene has the function of positively regulating the salt tolerance of rice seedlings. Knocking out this gene can lead to a decrease in rice salt tolerance, and overexpressing this gene can improve rice salt tolerance.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for genetically engineering the rice gene ZOS1-18, or a protein encoded by the gene ZOS1-18, or a recombinant expression vector or expression cassette containing the gene ZOS1-18, or a recombinant bacterium containing the gene ZOS1-18, or a knockout vector of the gene ZOS1-18, or a primer for amplifying the gene ZOS1-18 in regulating the salt tolerance of rice, characterized in that: The gene ZOS1-18 is a DNA molecule as described in 1) or 2) or 3) below: 1) A DNA molecule having a genome sequence as shown in SEQ ID NO.1; 2) a DNA molecule having a CDS sequence as shown in SEQ ID NO.2; 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein.

2. The use according to claim 1, characterized in that: Knocking out the gene ZOS1-18 described in claim 1, or reducing the expression level of the protein encoded by the gene ZOS1-18 in rice, or introducing a knockout vector of the gene ZOS1-18 into rice can improve the salt sensitivity of rice.

3. The use according to claim 1, characterized in that: Overexpression of the gene ZOS1-18 described in claim 1, or transfer of a recombinant expression vector or expression cassette containing the gene ZOS1-18 into rice, or transfer of a recombinant bacterium containing the gene ZOS1-18 into rice can improve the salt tolerance of rice.

4. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the gene ZOS1-18 is shown in SEQ ID NO.

3.

5. The use according to claim 1, characterized in that: The recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into a plant expression vector.

6. The use according to claim 5, characterized in that: The recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into the recombination site of the vector pCAMBIA1301 double-digested with restriction endonucleases HindIII and BstEII.

7. The use according to claim 1, characterized in that: The recombinant bacteria containing gene ZOS1-18 are obtained by transferring the recombinant expression vector or expression cassette into engineering bacteria.

8. The use according to claim 1, characterized in that: The primers for amplifying gene ZOS1-18 are selected from primer 1 shown in SEQ ID NO.4, primer 2 shown in SEQ ID NO.5, or primer 5 shown in SEQ ID NO.11, primer 6 shown in SEQ ID NO.

12.

9. The use according to claim 1, characterized in that: The knockout vector of the gene ZOS1-18 is a CRISPR / Cas9 vector capable of knocking out one or more of the target sequences such as target 1, target 2 and target 3 shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8.

Images