Construction method of Kdm2a gene systemic knockout mouse model and systemic knockout mouse model

Abstract

The invention provides a construction method of a Kdm2a gene systemic knockout mouse model and a systemic knockout mouse model.The construction method comprises the steps that targeting vector plasmids are constructed and then transferred into mouse embryonic stem cells, and the obtained positive embryonic stem cells are injected into a wild type mouse blastocyst stage embryo to cultivate a chimera mouse; carrying out selfing on the chimera mouse to obtain a Kdm < 2 > afl / -mouse, and carrying out selfing on the obtained Kdm < 2 > afl / fl mouse again to obtain a Kdm < 2 > afl / fl mouse; hybridizing the male Kdm2afl / fl mouse with a female Zp3-Cre mouse, so as to obtain a Kdm2a cKO mouse of which the oocyte is specifically knocked out; the method comprises the following steps: hybridizing a female Kdm2a cKO mouse with a wild type mouse, and screening to obtain a maternal Kdm2a deleted mouse; the maternal Kdm2a deleted mouse is subjected to selfing, and the Kdm2a gene systemic knockout mouse Kdm2a gKO is obtained. According to the method, the problem that the mouse embryo is lethal after Kdm2a systemic knockout is solved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for constructing a Kdm2a gene systemic knockout mouse model and a systemic knockout mouse model. Background Art

[0002] KDM2A (Lysine-specific demethylase 2A) is an important member of the KDMs family and is widely expressed in various mammalian tissues. As an important histone demethylase, Kdm2a, together with histone methyltransferases (HMTs) and histone methyltransferases (KMTs), regulates the level of histone H3K36 methylation, which is crucial for early embryonic development. Studies have shown that Kdm2a can mediate the cell life cycle and individual development by regulating the expression activity of target genes, plays an important role in the proliferation and differentiation of various organs in mouse embryos, affects cell and embryo proliferation and development, and plays an important role in regulating the reproductive performance of mice.

[0003] The Cre / LoxP system is widely used in mammalian gene editing and provides an effective means for genetics and cell biology research. This technology constructs a vector, introduces the vector into embryonic stem cells (ESCs), and injects the exogenous vector into blastocysts, and hybridizes with Cre transgenic mice mediated by a specific promoter to obtain conditional knockout mice (Conditiona lknockout, cKO). Zp3 is specifically expressed in oocytes before the completion of the first meiotic division of mice. Therefore, oocyte-specific knockout mice can be successfully constructed through Zp3-Cre.

[0004] Currently, mouse oocyte-specific Kdm2a cKO (Conditional Knockout) mice have been successfully constructed using the Cre / LoxP system, and it was found that these mice with oocyte-specific Kdm2a deficiency are fertile, but their reproductive performance is significantly reduced.

[0005] Conventional systemic knockout mice (G loba l Knockout, gKO) are designed by target genes and constructed by gRNA and Cas expression plasmids to knock out the functional region of the target gene in mice, resulting in systemic loss of the target gene function. The existing methods for obtaining systemic knockout mice are usually: constructing a targeting vector and transfecting embryonic stem cells through gene targeting technology, and obtaining positive cell clones through positive and negative screening; positive cells are injected into wild-type embryos through microinjection, and these embryos are transplanted into the body of the recipient to obtain chimeric mice; mating of male and female chimeric mice can obtain systemic knockout mice.

[0006] Many systemic knockout mice have been obtained through conventional gene targeting technology, providing important materials for analyzing the functions of specific genes in biological organisms. However, the loss of some functional genes leads to embryonic lethality, and the corresponding individuals cannot be obtained. At present, conditional knockout is the main means of genetic research, and this method effectively avoids the problem of embryonic lethality caused by systemic knockout. In recent years, it has been reported that the Kdm2a systemic knockout mice constructed by conventional gene targeting technology have delayed embryonic development at E8.5-E10.5, and embryonic lethality occurs at E10.5-12.5 (Eri Kawakami, et al. The histonedemethylase Fbxl11 / Kdm2a plays an essential role in embryonic development by repressing cell-cycle regulators. Mechanisms of Development, 2015, 135: 31-42). In addition, this traditional systemic knockout mouse may also induce compensation of other genes, resulting in no phenotypic changes. Therefore, constructing a new Kdm2a systemic knockout model is of great significance for studying the role of Kdm2a in mouse reproductive performance. Summary of the invention

[0007] In order to solve the problems of low reproductive performance of Kdm2a cKO mice and embryonic lethality of Kdm2a gKO mice constructed by existing methods, the present invention provides a method for constructing a Kdm2a gene systemic knockout mouse model, which can overcome the problem of embryonic lethality of mice after systemic knockout of Kdm2a in the prior art, enrich the models for Kdm2a research, and provide a new model of Kdm2a systemic knockout mouse model for studying the effect of Kdm2a on the reproductive performance of mice.

[0008] The present invention also provides a Kdm2a gene systemic knockout mouse model and application thereof.

[0009] The present invention is achieved through the following technical solutions:

[0010] The present invention provides a method for constructing a Kdm2a gene systemic knockout mouse model, the method comprising:

[0011] Designing a targeting site of the Kdm2a gene, constructing a targeting vector plasmid, and transferring the targeting vector plasmid into mouse embryonic stem cells to insert LoxP sites at both ends of the sixth exon of the Kdm2a gene, respectively, and screen to obtain positive embryonic stem cells;

[0012] injecting the positive embryonic stem cells into wild-type mouse blastocyst stage embryos to form chimeric embryos, and culturing chimeric mice with the chimeric embryos;

[0013] The female and male chimeric mice were self-crossed to obtain F 0 Kdm2a fl / - Mice;

[0014] F 0 Kdm2a fl / - Mice were self-crossed and Kdm2a was obtained by screening fl / fl Mice;

[0015] The Kdm2a fl / fl The mice were crossed with female Zp3-Cre transgenic tool mice and screened for Kdm2a fl / - , Zp3-Cre mice, Kdm2a fl / - , Zp3-Cre mice were self-bred to screen for oocyte-specific knockout of Kdm2a fl / fl , Zp3-Cre mice, i.e., Kdm2a cKO mice;

[0016] The female Kdm2a cKO mice were crossed with male wild-type mice, and the offspring genotype was Kdm2a △ / - mice, and obtained mice with maternal Kdm2a deficiency;

[0017] The male and female maternal Kdm2a-deficient mice were mated to obtain mice with the genotype of Kdm2a △ / △ The mice are Kdm2a gene systemic knockout mice, Kdm2a gKO.

[0018] In the present invention, Kdm2a fl / - The fl in the figure represents the carrying of LoxP sites, - represents the carrying of no LoxP sites, and △ represents the carrying of LoxP sites and the knockout of the sixth exon sequence of Kdm2a.

[0019] Furthermore, the design of the targeting site of the Kdm2a gene, the construction of a targeting vector plasmid, and the transfer of the targeting vector plasmid into mouse embryonic stem cells to insert LoxP sites at both ends of the sixth exon of the Kdm2a gene, respectively, and screen to obtain positive embryonic stem cells specifically include:

[0020] The targeting site of the Kdm2a gene was designed, and the sixth exon of the Kdm2a gene was selected as the targeting site. Targeting vectors were designed for both ends of the targeting site and a targeting vector plasmid was constructed. The constructed targeting vector plasmid was transferred into mouse embryonic stem cells, and two LoxP sites were added to both ends of the targeting site by homologous recombination, and positive embryonic stem cells were obtained by screening.

[0021] Furthermore, the linearized plasmid map of the targeting vector plasmid is as follows: Figure 8 shown.

[0022] The targeting vector plasmid contains a mouse genomic fragment of homology arms (5arm and 3arm) and conditional knockout (cKO) region, which is amplified using high-fidelity Taq enzyme and sequentially integrated into the targeting vector by ligase. The integration site and selection marker site are as follows: Figure 8 shown.

[0023] Based on the same inventive concept, the present invention provides a Kdm2a gene systemic knockout mouse model, and the systemic knockout mouse model is constructed by the above-mentioned method for constructing a Kdm2a gene systemic knockout mouse model.

[0024] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0025] The invention discloses a method for constructing a Kdm2a gene systemic knockout mouse model. The method first constructs a mouse oocyte Kdm2a conditional knockout system by using a Cre / LoxP system to obtain Kdm2a cKO mice, then breeds the mice with wild-type mice to obtain maternal Kdm2a knockout mice, and finally establishes a systemic Kdm2a knockout mouse model by self-fertilizing the maternal Kdm2a knockout mice. The technical route avoids embryonic death caused by direct systemic knockout of Kdm2a. Since Kdm2a is directly involved in the regulation of early embryonic development and determines the developmental fate of the embryo, direct knockout will cause embryonic deformity and death. The method of the invention first constructs a maternally deleted Kdm2a The cKO model, based on which systemic knockout was performed, alleviated the impact of Kdm2a deficiency on the embryo to a certain extent, and obtained offspring mice with systemic knockout of Kdm2a, enriching the model for Kdm2a research and providing a new model of Kdm2a systemic knockout mice for the study of the effect of Kdm2a on mouse reproductive performance. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 The figure is a flow chart for the preparation of Kdm2a gKO mice of the present invention.

[0028] Figure 2The reproduction diagrams of female mice at different stages of the present invention are shown below: fl / fl Reproduction of female mice; the middle picture shows the reproduction of Kdm2acKO female mice; the right picture shows the reproduction of Kdm2a gKO female mice.

[0029] Figure 3 This is an identification diagram of the gene editing LoxP site of the present invention.

[0030] Figure 4 This is the identification result of the conditional knockout of the present invention.

[0031] Figure 5 This is the identification result of the maternal Kdm2a knockout of the present invention.

[0032] Figure 6 This is the identification result of Kdm2a cKO and Kdm2a gKO mice of the present invention.

[0033] Figure 7 For the construction of targeting vector plasmid.

[0034] Figure 8 To construct a linearized targeting vector plasmid. DETAILED DESCRIPTION

[0035] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0036] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0037] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0039] The following will describe in detail a method for constructing a Kdm2a gene systemic knockout mouse model and a systemic knockout mouse model of the present invention in combination with examples and experimental data.

[0040] Example 1

[0041] The method for constructing a Kdm2a gene systemic knockout mouse model in this embodiment is as follows:

[0042] 1. Primer design: Design corresponding primers for Kdm2a and Zp3 genes. The primer sequences are as follows:

[0043] Kdm2a F1: 5'-TCACCCTTGCAACTTCCTTCTTCCTT-3';

[0044] Kdm2a R1: 5'-TGCACACTGACAAACTCAGCTACCA-3';

[0045] Kdm2a F2: 5'-CTGCTACCTGATGTGCTTATAGT-3';

[0046] Zp3-Cre F3: 5'-CATATTGGCAGAACGAAACGC-3';

[0047] Zp3-Cre R3: 5'-CCTGTTTCACTATCCAGGTTACGG-3'.

[0048] Kdm2a F1 and Kdm2a R1 were used to identify the insertion of LoxP sites; Kdm2a F2 and Kdm2a R1 were used to identify the knockout of exon 6 of the Kdm2a gene; Zp3-Cre F3 and Zp3-Cre R3 were used to identify the Zp3-Cre genotype of mice.

[0049] 2. Construction of a novel Kdm2a systemic knockout mouse model, the flow chart is as follows Figure 1 As shown:

[0050] (1)Kdm2a fl / - Mice acquisition: Figure 7 As shown, NCBI retrieved the sequence of Kdm2a gene (NM_001001984.2), analyzed the exons, selected the 6th exon as the target site, and designed targeting vectors at both ends of the 6th exon so that two LoxP sites could be added to both ends of the 6th exon by homologous recombination (the Kdm2a targeting vector was constructed by the Cre-LoxP system, and the 6th exon of the Kdm2a gene was cut after Cre-LoxP homologous recombination); the constructed Kdm2a targeting vector was introduced into mouse embryonic stem cells (ESCs) using liposome transfection reagent, and positive and negative screening was performed using resistance drugs, and the surviving cells were positive embryonic stem cells; a microinjection instrument was used to fix the wild-type mouse blastocyst with a fixing needle, and the selected positive ESCs cells were injected into the blastocyst cavity with an injection needle to form a chimeric embryo; the above embryos were surgically transplanted into the uterine horns of pseudo-pregnant female mice, and chimeric mice could be obtained after one gestation cycle; the chimeric mice were self-fertilized, and F0 Kdm2a fl / - Mice, the genotype was identified by cutting the mouse tail tissue, the results are as follows Figure 3 , Figure 3 In the analysis, 510 bp was a positive band edited by Kdm2a (two LoxP sites were successfully inserted into exon 6), 397 bp was a wild-type band (no LoxP site was inserted), and the primer sequences used were Kdm2a F1 and Kdm2a R1.

[0051] from Figure 3 It can be seen that in the DNA double strands of each mouse, LoxP sites (510 bp) were successfully inserted at both ends of exon 6 of one strand, while no LoxP sites were inserted in the other strand (397 bp), indicating that the genotype of these mice is Kdm2a fl / - .

[0052] (2) Obtaining Kdm2a cKO mice: fl / - Female mice and Kdm2a fl / - Kdm2a can be obtained by mating and breeding male mice fl / fl Mouse; Zp3-Cre female mice (purchased from Saiye Biotechnology Co., Ltd., with a genotype of Kdm2a - / - , Zp3-Cre (mouse Zp3-Cre is heterozygous, homozygous lethal)) and Kdm2a fl / fl Male mice were mated and Kdm2a was obtained after screening fl / - , Zp3-Cre mice; the obtained mice were self-crossed and screened for Kdm2a fl / fl , Zp3-Cre mice, namely Kdm2acKO mice, were genotyped by cutting the tail tissue of the mice. Figure 4 , Figure 4 In the figure, 510 bp is the positive band edited by Kdm2a, and 413 bp is the positive band edited by Zp3-Cre (the identification primers used are Zp3-Cre F3 and Zp3-Cre R3).

[0053] from Figure 4 It can be seen that LoxP sites (510 bp band) were inserted at both ends of the Kdm2a exon 6 of the obtained mouse double-stranded DNA, and Zp3-Cre (413 bp band) was integrated into the genome of these mice, indicating that Kdm2a was successfully obtained. fl / fl ; Zp3-Cre genotype mice, namely Kdm2a cKO mice.

[0054] The genotype identification in the present invention uses rat tail tissue. Since the genotype identification uses the rat tail of the mouse, its genotype is Kdm2afl / fl , Zp3-Cre, the product length is 510bp. Zp3-Cre is only expressed and works in mouse oocytes. It is only integrated into the DNA sequence in other tissues of the body, but does not work. Since it is impossible to directly remove oocytes for identification, the mouse must be killed to retrieve the eggs. At this time, the genotype of the mouse oocyte is Kdm2a △ / △ 、Zp3-Cre.

[0055] (3) Obtaining maternal Kdm2a-deficient mice: The above-mentioned Kdm2a cKO female mice were mated with wild-type male mice (e.g. Figure 2 :Description of 3 genotypes (Kdm2a fl / fl , Kdm2a cKO, Kdm2a gKO) mice can give birth to offspring, in the following order: Figure 2 Left, middle, and right) of the offspring mice, the genotype of Kdm2a was screened Δ / - The genotype identification results of mice were as follows Figure 5 , Figure 5 In the figure, 320 bp is a band with a LoxP site and Kdm2a exon 6 knocked out, and 397 bp is a wild type without a LoxP site.

[0056] from Figure 5 It can be seen that: in the double-stranded DNA of each mouse, one strand is a band with a LoxP site and the sixth exon of Kdm2a knocked out (320bp), while the other strand is a wild type without the LoxP site (397bp); at the same time, Zp3-Cre is not integrated into the genome of these mice (no band) (theoretically, two genotype mice (Kdm2a Δ / - , Zp3-Cre) and (Kdm2a Δ / - ), here we only select Kdm2a Δ / - The mice were then bred for the next step), indicating that the genotype of these mice was Kdm2a Δ / - .

[0057] (4) Construction of Kdm2a gKO mice: The male and female Kdm2a Δ / - Mice were mated with each other, and the genotype of the offspring mice was separated and recombined, and the genotype was Kdm2a Δ / Δ The mice were Kdm2a gKO mice, and the genotype identification results were as follows. Figure 6 , Figure 6 Middle, lanes 1-15: Kdm2a gKO mice; lanes 16-24: Kdm2a cKO mice.

[0058] from Figure 6It can be seen that the Kdm2a exon 6 of the obtained mouse (1-15) DNA double strands was knocked out and carried a LoxP site (320 bp band, DNA structure see Figure 7 The bottom band) and Zp3-Cre was not integrated into the genome of these mice (no band), indicating that Kdm2a was successfully acquired Δ / Δ Genotype of mice, i.e. Kdm2a gKO mice.

[0059] In the obtained Kdm2a cKO mice, only Kdm2a in the female mouse oocytes was knocked out, while it was still retained in other tissues; we selected female Kdm2a cKO mice to mate with wild-type male mice. One strand of the offspring's DNA came from the maternal oocyte (i.e., knocked out), and the other strand came from the paternal sperm (non-knocked out), that is, semi-knockout mice were obtained. Δ / - Mice were mated with each other to obtain Kdm2a Δ / Δ mice (gKO mice).

[0060] The present invention uses conditional knockout to first knock out maternal Kdm2a, and then constructs gKO mice. Compared with direct systemic knockout, there are two differences: 1) The knockout site is different. This study knocks out the 6th exon, so that Kdm2a frameshift mutation no longer has Kdm2a function; while the existing direct knockout method knocks out most of the Kdm2a sequence; 2) The present invention uses Zp3-Cre to first knock out maternal Kdm2a, and by mating with wild-type male mice, the offspring knock out 50% Kdm2a, and then homozygous gKO mice are obtained; in this process, wild-type paternal Kdm2a is borrowed to alleviate the embryonic death caused by direct knockout of Kdm2a, and the reason may be: there is a buffering effect. The specific reason is being analyzed by the inventor using molecular biology, omics and other technologies. Therefore, no embryonic death, abnormality, etc. were found in the gKO mice of the present invention, and they have fertility.

[0061] 3. The method for mouse genotype identification is as follows:

[0062] (1) Lysis solution preparation: 10 μL of 0.4 mg / mL proteinase K, 66.7 μL of 10 mM Tris-HCl (pH=8.8), 0.03725 g of 50 mM KCl, and 3.5 μL of 0.1% Triton X-1009;

[0063] (2) Mouse tail DNA extraction: Use sterile ophthalmic scissors to cut the tail of a four-week-old mouse and place it in a sterile 1.5 ml centrifuge tube and mark it with an ear tag. Add 100 uL of lysis buffer to each tube, place it in a 56°C water bath overnight, place it in a 98°C metal bath for 15 min, and centrifuge it in a 4°C low-temperature centrifuge at 12,000 rpm for 15 min. The supernatant obtained is used as a DNA template;

[0064] (3) PCR reaction system (25uL): 2× Rapid Taq Master Mix 12.5μL, upstream and downstream primers (10μmol / L) 1.0μL each, cDNA 2.0μL; ddHO 2 O 8.5 μL;

[0065] (4) PCR amplification procedure: 95°C pre-denaturation (3 min), 95°C denaturation (15 s), 60°C annealing (15 s), 72°C extension (15 s), 35 cycles, 72°C complete extension (5 min), and storage at 4°C;

[0066] (5) Gel electrophoresis: Prepare 2% agarose gel and run at a constant voltage of 120 V for 30 min. Then, use an imaging system to obtain the genotype identification results.

[0067] In the present invention, the nucleotide sequence of the linearized plasmid of the targeting vector plasmid is as follows:

[0068] cgcttacaatttccattcgccattcaggctgcgcaactgttggggaagggcgatcggtgcgggcctcttcgctat

[0069] tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgtt

[0070] gtaaaacgacggccagtgaattgtaatacgactcactatagggcgaattggagctccaccgcccgggctggttctttc

[0071] cgcctcagaagccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctg

[0072] ccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaaggac

[0073] agtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcac

[0074] agtcgaggctgatcagcgagctctaggatctgcattccaccactgctcccattcatcagttccataggttggaatcta

[0075] aaatacacaaacaattagaatcagtagtttaacacattatacacttaaaaattttatatttaccttagagctttaaat

[0076] ctctgtaggtagtttgtccaattatgtcacaccacagaagtaaggttccttcacaaagagatcgcctgacacgatttc

[0077] ctgcacaggcttgagccatatactcatacatcgcatcttggccacgttttccacgggtttcaaaattaatctcaagtt

[0078] ctacgcttaacgctttcgcctgttcccagttattaatatattcaacgctagaactcccctcagcgaagggaaggctga

[0079] gcactacacgcgaagcaccatcaccgaaccttttgataaactcttccgttccgacttgctccatcaacggttcagtga

[0080] gacttaaacctaactctttcttaatagtttcggcattatccacttttagtgcgagaaccttcgtcagtcctggatacg

[0081] tcactttgaccacgcctccagcttttccagagagcgggttttcattatctacagagtatcccgcagcgtcgtatttat

[0082] tgtcggtactataaaaccctttccaatcatcgtcataatttccttgtgtaccagattttggcttttgtataccttttt

[0083] gaatggaatctacataaccaggtttagtcccgtggtacgaagaaaagttttccatcacaaaagatttagaagaatcaa

[0084] caacatcatcaggatccatggcacgcgcttctacaaggcgctggccgaagaggtgcgggagtttcacgccaccaagat

[0085] ctgcggcacgctgttgacgctgttaagcgggtcgctgcagggtcgctcggtgttcgaggccacacgcgtcaccttaat

[0086] atgcgaagtggacctcggaccgcgccgccccgactgcatctgcgtgttcgaattcgccaatgacaagacgctgggcgg

[0087] ggtttgctcgacattgggtggaaacattccaggcctgggtggagaggctttttgcttcctcttgcaaaaccacactgc

[0088] tcgacattgggtggaaacattccaggcctgggtggagaggctttttgcttcctcttgaaaaccacactgctcgatttg

[0089] ttagcagcctcgaatcaacccgggcgatcctaggcgatgagatctagctgtcgcgatactcataatgctcattctctg

[0090] ccagatttgaagtaatcttttattagaacaagaaggttactgggaaaaacacctttttctgaattcttggcttgagtt

[0091] taactaaaaatggcacaggtatgatggcacatgcctgtagtcattgcactttggagatagaaacagaaggatcaggaa

[0092] tggtctatgtataagttataatgtatgtataagtaatggtaagttaaggccagactctgctacatgaaactttggata

[0093] gaaggagagggagaaagatatcaaaacaaaaaagtacaatgaaatttcttttatgatgttggattccttatgtgttat

[0094] gtagccttgacccttaggaaactgtggaaaaattggacatataatgttcaaactattttagccattaagagacataat

[0095] ttctagttagaatgtatgaagtgactcattaacacaactacctacaagccctgatttttcagtatactttccatattt

[0096] aataagagatgtaaaatattgtatgcacagagtaacaaacactataaatacctttttacttaaaatttccttcatagt

[0097] ttttttcaatgattcttctctttctaatttttccccatggtttcagattttaatgtagagtatatccagcggggtggc

[0098] ttgagagaccctctcattttcaagaattctgatggacttggaataaagtaagtgctctctggtcctaagcctgagatg

[0099] gttgtaaaatggcttttacacccgggaattcggacagtggcaaatttgagaccccagagcagtaggaaattgaggata

[0100] atttcccagttactttgtgaagtatgactcttgtctcactggtgattcatatacctagaaataaaaactgtagatgaa

[0101] cttaaaaaccagttaagtctcttgagtctatcagtctgatagaattgctgctaacattgtgggatttcttcctataaa

[0102] aatgtgtaatcatttatattttaaaagtatttaaacttaatggtgtttctggaaagtgcttcatactttccagatcca

[0103] cactgactggagaagaagtgcttcttatttactggtgtttatttcacaggatgccggatccagacttcacagtgaatg

[0104] atgtcaaaatgtgtgtgggtaagtaacaaacttttggcctgcctcttcatctttgagggttaggaaccttaaaatata

[0105] tgttttattagaaagaattgtttaattagcagctcagaattttccttaaaggacatttaaaaagaaaacagctgggca

[0106] tggtggtgcacacctttaatcccagcacttgggaggcagaggcaggtggatctctgagttcgaggccagcctggtcta

[0107] cagagtgagtgccaggacagccaggggtacacagagaaaccctgtctggaaaaaacaaacaaacaaaaaacaacaaca

[0108] acaaacaaaaaaaagaaaacaactctataaggaagagataggaagttactatatatgttcaggagaaatttttctca

[0109] aaagcaaaaactttttaaaatttagttcatcggggctggtgagatggctcagtgggtaagagcacccgactgctctcc

[0110] cgaaggtccagagttcaaatcccagcaaccacatggtggctcacaaccatccgtaacgagatctgactccctcttctg

[0111] gagtgtctgaagacagctacagtgtacttacatataataaataaatatttttttaaaaaaaatttagttcatttaact

[0112] cctaggcatggaagataactgttatattctgtgaaaatgcagtaaaatggtattgagttgtctgtgtttccaacaaac

[0113] atgagcaaaaggagctcttctgactcttgctattctatggaatacaaatgttctatttcttactttggaaattagagt

[0114] agcaccactttttggccacgtggatccctgttaaactgctggataatcttgctctatcttgagaggtgaaagtcactg

[0115] acagtcttaattctctgatgccagtattactcatgccctaacgctcgtgttaccttctaagcacctagatacatgcat

[0116] ttcttggtaactagcacaacttgtgaattatgtgatcagtaaatctattgagttatcaaaatccttacctgtcctttc

[0117] aatcagaactcttttaggaggcttagataatttgtgagtactcaacattgtagaacttcacttaacaggctggaaaga

[0118] ggtggcttagcagttaagaacattgactactcatccagaggacctgggttcaattctcagcactcatgtgtcagctca

[0119] aaactatctgtaactcttgttccagagggtacaacaccctcacacagacatacatgcagtcaaaacagcaatgtacat

[0120] aaaataaaaataaatacattatttttttttaaagttcacttatcacttatttttgttgttgtttctagacagagaggt

[0121] tcaattaggtatattaagctaatctcaaactcattgtgtaactaagggtgaccttagactaattacctttctgtcccc

[0122] accttttgggtgctttagttacaggcatttgtcaccataccaagcttatgtgggctgggatcatatccagggctttgt

[0123] ctatgctaggtaactattctttcagcaactggtttatttcttcatcttctcagttctttcttagtcagccttcaggaa

[0124] agtaatttcctagatccataggcagtagacagccagagctttctgtttggttatttcatttttttccatgagacaggg

[0125] tttttctatgtagccctggctgctgtcctggaactctctctgtagaccagatctggctcaaacgcaagagatctacat

[0126] atattttcctactcagtgttgagattaaagttgtaggctaccatcatacctagcagacttattttttagtgatatatg

[0127] tgtgtgtgtttatggtttccatgaatacatgtgctcacagagtaagaagggttcgatcctctggagttacaagtagtt

[0128] gtgagctacctaacatgggtgctgaaagtagaacttgggtctctgaaagaatagcccctgatctttactgctgaaact

[0129] ctctctagctcccatcttagatattcttatggttgtggttcaccaatgacctccacgagagtcatctgtgataacttt

[0130] aaagtacatactcataagagaggattctgggaagatgatgagagcattctccatctacttgattattgccctgacaga

[0131] gtctatctgatataactgttgtggaattctggtgaaggcatgcaacttccagggaaagattcagacaataaagttaat

[0132] ttcaggttttactatagtaataaccacttttctacatcctccagccctcaccaactggaacccaagaaacagatgtgc

[0133] atgttttttcaaaagcatgacacataactttaaggagccaggatgggtcttgtcatttaaatagttgacacttatact

[0134] gtgattacagacttctacttctaacaaaatgtatagacataagagtaaggggcaagccgggcgtggtggcgcacgcct

[0135] ttaatcccagcactcgggaggcagaggcaggtggatctctgagttcgaggccagcctggtctacaaagtgagttccag

[0136] gacagccagggctatacagagaaaccctgtctcgaaaaaccaaaaaaaaaaaaaaaaaaaaaagtaggaggctgtttt

[0137] ataccatctctatgctgttacaatgcccttatatctgaccccaatgacttctataggacttaaaggctgccaaaaggc

[0138] agatgtggtggcacataatagagaaaccttatctcaaaaaacaaatacaaagggctggtagatgcttggtggctgtgg

[0139] tggctgtatacacctttaatcctagcactccagaggcagaagaagttggatctcttgagttttttgaggatagcctag

[0140] tctatagagtgagttcacgtatagggctacatagagaaaccctgtctcgaaccccccttagcgccctcccaaaaaaac

[0141] caaccaaccaaccaaacaaacaaacaaaaaaaccctaaaatagcataatggcacaatgacatattcagagaatgccca

[0142] cacagagaaaaaaaataaggttaaaaagaagcagtcttaaatatacaatccaagtgtggtttgcactcataaaaaaat

[0143] ctcagggggctggtgagatggctcagtgggtaagagcacccgactgctcttccaaaggttcagagttcaaatcccagc

[0144] aaccacatggtggctcacaaccatccttaacaagatctgactccctcttctggattggtctgaagacagctacagtgt

[0145] acttacatataataaataaatgaatctttaaaaaaaaaaaatctcagcatttgagaggcaagatgaacatgagttcca

[0146] ggcaccctgggccatgtgactctatagcaaccctaaacagacatgtgatgacaagaagggtagtatcaagcagactaa

[0147] tatatattttgggaataatagtagaaagagaggaaaggagcaagtaggaaaaatcataatagcggtaactagatggac

[0148] agttagttctctgggatgatggctcagtgtgtaaaagtacttgccaaaaaacctgacaacctgaccctaattgtacag

[0149] ctatcaccactatctactactagaatttatcaccccaaaaaagtctgttaagcagtcatttctcattctctcttccct

[0150] gtagcccctggcaaccacggatcttatgttttctagataaggatttatctaatcagtgtttcacatacctagaattat

[0151] ataatagtagcctttcatctgtgagttctcgcacatggcatactttccatgtttgtttgtgtgatttcattcttttta

[0152] accttttagcatatagtcttttttccttctgctacctgatgtgcttatagtaaggtttagtcttacacgttggacagc

[0153] actgtgcacggcgcgccataacttcgtatagcatacattatacgaagttatgtttaaactgctcattctctcttatca

[0154] ggatctcactgtgtatcataggcttggaactatgtagagcagtttgctttaaatatatagagatgctcctgctactga

[0155] gtgctgggattaaaggtatgcaccagcacactcagcatactgtgttttgttgttgttatgcttgaggaagactgatac

[0156] tgtgtttacatagtaactttatcagactgtaatatggactaaatgtaaagaagttttatattaaaaattattgacagg

[0157] actggagaaaccaactgaaaatagagaagtttaaactggtacccactaactcacatttctttttttgttgttgttagg

[0158] ggtagggggaggttcaagacaagatttctctgtgttaacagatgcatggctgttgtggaacttcctttgtagaccaggc

[0159] tggcctcaaagccccagagatccacctgcctctgcctgccaagtgctgggattaaaggcatgtacacatgcacaaccc

[0160] ttaattcatactcttgaaacagtctttaaaccgtcactgaaacagtatatatctcagtaagtcttttgtcttgcaagt

[0161] tacctggtccctgttgcttcatgtttgaaataaatactgacagtgatcatgtcagattgtagggttaagtgaggtatt

[0162] gaagaagaaccagtacttgatagtgtagtaacatgatgagtattgttattctctgatgtggttatgattatccttc

[0163] tcaagtaatttccttctgtattactgattatcttaacacaggatgccttgttagtaactatggcttaaacttctttca

[0164] tgtagggagtcgtcggatggtggatgtcatggatgtgaacacacagaaggggattgaaatgaccatggcacaatggac

[0165] acgatactatgagactccagaggaagagcgagaaaaaactctataatgttatcagcctagagtttagccacaccaggct

[0166] tgagaatatggtgcagcggccttccaccggttagtctttttcccacattctcatttatcttttttttctctcttgttct

[0167] ctctctctctcttcttcttccctccctctctctctctcttccttaaagcttattgatttgtgtgtatgtgcttcaca

[0168] tcatgaatccctgtcttgctcacctccccatctcctcataactgcccttcacccttgcaacttccttcttcctttcta

[0169] aaaaaaaaaaaaaaaaaaaataagaaaatatctcattgtggaagctgtagtatgtcacagtcacagtttgttc

[0170] tacagtatgtccctctgtccacacatcttcacttacaaatgtttattgcagcaagtcattggtctgtttcaagatccc

[0171] gcggcacttaagtagttaactttaaataatgccaattatttaaagttaataggcgatcgcaccatatgaatctcgagg

[0172] ttatgtacctgactgatgaagttcctatactttctagagaataggaacttcgaagggttccgcaagctctagtcgagc

[0173] cccagctggttctttccgcctcagaagccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcct

[0174] cccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcat

[0175] tttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggct

[0176] ggcaactagaaggcacagtcgaggctgatcagcgagctctagagaattgatcccctcagaagaactcgtcaagaaggc

[0177] gatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaa

[0178] gctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatga

[0179] atccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccatgggtcacgacgagatcatcgccgt

[0180] cgggcatgcgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgat

[0181] cgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccg

[0182] gatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacagga

[0183] gatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagctgcgcaag

[0184] gaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcctgcagttcattcagggcaccggacaggtcggtct

[0185] tgacaaaaagaaccgggcgcccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgccc

[0186] agtcatagccgaatagcctctccacccaagcggccggagaacctgcgtgcaatccatcttgttcaatggccgatccca

[0187] tggtttagttcctcaccttgtcgtattatactatgccgatatactatgccgatgattaattgtcaacaggctgcaggt

[0188] cgaaaggcccggagatgaggaagaggagaacagcgcggcagacgtgcgcttttgaagcgtgcagaatgccgggcctcc

[0189] ggaggaccttcgggcgcccgccccgcccctgagcccgcccctgagcccgcccccggacccaccccttcccagcctctg

[0190] agcccagaaagcgaaggagcaaagctgctattggccgctgccccaaaggcctacccgcttccattgctcagcggtgct

[0191] gtccatctgcacgagactagtgagacgtgctacttccatttgtcacgtcctgcacgacgcgagctgcggggcgggggg

[0192] gaacttcctgactaggggaggagtagaaggtggcgcgaaggggccaccaaagaacggagccggttggcgcctaccggt

[0193] ggatgtggaatgtgtgcgaggccagaggccacttgtgtagcgccaagtgcccagcggggctgctaaagcgcatgctcc

[0194] agactgccttgggaaaagcgcctcccctacccggtagaatttcgacgacctgcagccaaagcgctagagccagacatg

[0195] ataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgat

[0196] gctattgctttatttgtaaccattataagctgcaataaacaagtttagctatccatcagtcgagaattggctcccacg

[0197] gacactccgccccttctgagataccgcatcagtgtttcaggcttcttccatgtcccttcctgcataatctcgaccata

[0198] gacacctgtttctcggccatgtctattgcggcacccaccctggcggaatggccggtccaggtcctatacctcccttta

[0199] ttgggggtggcgtcccgtttgttcagcagcacccaggcatcactgaaaatcttctccatggcaggggcggtcaggggc

[0200] gtggtagtaatgcgggctttgtttgaccggtgtataggtgggaagagcacagcgtctggatgttctctaagcccactg

[0201] acgtccagccagtcattgagcactgctgtggttcgccgggagagcactttgtcaaggcccgcagctgtggtgattgtc

[0202] ttagtgtgactgatgtgcagggtcactgtgtctcctgtctgatccaagtccccaaccctgatgcgtgatatttcagac

[0203] attctcatgagggtgttataggctacgaacaggaaagccctgttgcgcaggtcgaccagccgctcgctcctgctgagc

[0204] agcacatccagcagcttcaggtcgtcccagcgcagggggattgcctgtcctgtcctctcacccttttcggttgcggct

[0205] tctcttctaattcttctcatggcaagactcactgacttgtcgtcggacaagggtggcagtccgcagtgggacagaagc

[0206] atattaagcatagcatagtgcttgtcgatggtagtggaggccaggtctgcatcgtgcaactgaagaaagtattcgcgt

[0207] gccatttcaggactaattggaaaccatgcaagctgccgagcatggcaccatctggcccagctatgaaagaccaacctc

[0208] aaatccctcaaagtgttaggagcgtacgccccctggtcattcataaacctcatgaagttttcagcggcctcctgatac

[0209] tctttgccgatgtttcgcaggaatccaccagatgaaccactaataatcagctcagaaaccttcctcttcttcttaggc

[0210] atggccgcaggaaagcagagccctgaagctcccatcaccggccaataagagccaagcctgcagtgtgacctcatagag

[0211] caatgtgccagccagcctgaccccaagggccctcaggcttgggcacactgtctctaggaccctgagagaaagacatac

[0212] ccatttctgcttagggccctgaggatgagcccaggggtggcttggcactgaagcaaaggacactggggctcagctggc

[0213] agcaaagtgaccaggatgctgaggctttgacccagaagccagaggccagaggccaggacttctcttggtcccagtcca

[0214] ccctcactcagagctttaccaatgccctctggatagttgtcgggtaacggtggacgccactgattctctggccagcct

[0215] aggacttcgccattccgctgattctgctcttccagccactggctgaccggttggaagtactccagcagtgccttggca

[0216] tccagggcatctgagcctaccaggtccttcagtacctcctgccagggcctggagcagccagcctgcaacacctgcctg

[0217] ccaagcagagtgaccactgtggggcacagggacacagggtggggcccaacagcaccattgtccacttgtccctcac

[0218] tagtaaaagaactctagggttgcggggggtgggggaggtctctgtgaggctggtaaggatatttgcctggcccatgg

[0219] agctagcttggctggacgtaaactcctcttcagacctgaagttcctatactttctagagaataggaacttcggaattc

[0220] gatatcaagctaagcttgattaactttaaataatgccaattatttaaagttagtagcgtcgcacgtgaaatcgatata

[0221] acttcgtatagcatacattatacgaagttatggtacctctggcttctgtgacaccatcaatattggatcctcaccaag

[0222] acttttcccagctatcttgtctccctgtgtcgtagagatcctgcactattaatcagtaggactggccttttcatgaat

[0223] cctaattgttagcagatgataaaaattttaagattttgggccacctcagagccctgaatctggtcttgggtggtagctg

[0224] agtttgtcagtgtgcaggcttcctctgtctagcatggttccagctaggccacccaatgctgccatcagcaggaagcag

[0225] ggtcagctttcctgctctcatgccctttgactgctctaccgaacctcccaaatgctgcagcctggaagaggctggact

[0226] cgctctcccactcatattctcagggctggctctcctgtgtctttgccagtgaggaagcagggctagtccttgatctca

[0227] agctcttgggttcaactctcccaattactgactactgtaggtgagcacgggcattgatgaggtgcagcgcctgatctc

[0228] gggcaaggggcatggccaactctcctgactgctgtgggcggtcggggcagggagccacatttgcattttcaatagaag

[0229] atcattatactggaagaatttttatagctctatacatgccaaaattaagctaaatgtggggaaaagtattggataaca

[0230] gtaactttcatttttagaagaattcatttttcaaaatcatttaattttcaccaagaacttaattgggaacttggtctt

[0231] tcagtgatagataagaatcttaaagtgttactgggaaactggcttaaagaatttctatgctataggtttatgtttgct

[0232] aagaaacttaattgggttaggtttgggaatgtgtgccatgtttggtggcataagctttaatcccagcacacaggggac

[0233] agaagtaggggagtctctcttgagtttggggccagcatgggctgcatagccagttccaagacagcctgctgtataaga

[0234] gagacccagtgtaaaaaataaagaacaaaaattaagggaaattttgtttagtgcaggtgaattttgcaccccccaatcc

[0235] atcaacttcattcactaggtgagaattttatgtaacatattgtaggatttagtaggtaaaactatgagttactactat

[0236] gagttggtttcattagtttttgataccatactatcctaaagttaattttcattttatctatctttgggtaaagtgctg

[0237] gctatctagtctattgtgaaagctattcaggaagtggagttggcttcacttttgaaatacacctatatatttttgagt

[0238] ctctcctcccttaattcctgactgtgaactcaagccaggtatggtggtttcagctacatggaagtcaaaaaagaaggt

[0239] cttaattagaccctttgctttccaaaattaatatggtatttgctagtaaatatgtttactctaggtagactacagct

[0240] aatagtttccaatatcataactatagtttattggtatgtatagcaaagagaaaaaataactcaatattttgctagtttg

[0241] atgagtcagtgtatatttcgttttgtttttagtttttttaggtttttggagacaggttctctctgtgtgtatctatggct

[0242] ttcttggaactcactatgttgatcaggctggcctcaaactcatgtttgcctatgttttcccagtgctgggattaaagg

[0243] tatatgccactgtgcccagcttttttcattgtgtatattggaccagatattcagctaaaagcagagattctcgtgaaa

[0244] ataggcttatttcccacaagaatgacaagaatctttcctatattagttatcataaatacacctaccccaagtgctaag

[0245] ataatagtttatgccatttttaataatgttcatttttttaataaagaattcagtaaaaggaaacatgaagccaaagca

[0246] tggtggtctttgtgtgttatcccagcatttgggaggtagagacaagaggattgcctgtactgcagagtaaacttttgt

[0247] gtcaaacatgagaattacagttgcattgcttataaatgtattctttaatagttctagaatttaatttaaagatgatta

[0248] tttttataaatatagagcttgattattaaaattgggaacattaaaaccattcatatatgaagtctactttgtattatt

[0249] ctgagtatctctaggtttggcttttttagttttttggttggttggttttttggggggtgtttttggagacaggatttc

[0250] cctgcgtagccttgtctgtcctagaactaacgctgtagtccacgctggcctctggctcacagagattcacttgctcct

[0251] tcctcctgagtgctgagattgaaggtgagcaccaccactgcccggctcttagtttttattgttgttgttgttttgttt

[0252] tgctttttgtttttgcttttggtttttcgagacagggtttctctgtatagccctggctgtcctggaactcactttgta

[0253] gaccaggctggcctcgaactcagaaatccgcctgcctctgcctcccgagtgctgggattaaaggcgtgcgccaccatg

[0254] cccggccttttgttttgttttacttattttatttttatgtgtatggtagtttggtccaggtgttttgtgttgtggtgg

[0255] ttgtgagctgcaatatgggtgtgaggcatagaacacctggtgcccttaaccattaaacagcctctctagtcgtattat

[0256] cagcctatccgtcctgcggccgcgtaccagcttttgttccctttagtgagggttaatttcgagcttggcgtaatcatg

[0257] gtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaa

[0258] agcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacct

[0259] gtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctc

[0260] gctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatc

[0261] cacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc

[0262] gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaa

[0263] cccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgct

[0264] taccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttc

[0265] ggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaa

[0266] ctatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagc

[0267] gaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtat

[0268] ctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtag

[0269] cggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctac

[0270] ggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcaccta

[0271] gatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatg

[0272] cttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagat

[0273] aactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccaga

[0274] tttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtc

[0275] tattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacagg

[0276] catcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc

[0277] ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc

[0278] actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagta

[0279] ctcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgc

[0280] gccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgct

[0281] gttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgg

[0282] gtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactctt

[0283] cctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaa

[0284] taaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggc

[0285] gggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttc

[0286] ctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgcttt

[0287] acggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcg

[0288] ccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggt

[0289] ctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaa

[0290] cgcgaattttaacaaaatattaa.

[0291] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0292] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0293] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for constructing a Kdm2a gene systemic knockout mouse model, characterized in that: The construction method comprises: Designing a targeting site of the Kdm2a gene, constructing a targeting vector plasmid, and transferring the targeting vector plasmid into mouse embryonic stem cells to insert LoxP sites at both ends of the sixth exon of the Kdm2a gene, respectively, and screen to obtain positive embryonic stem cells; injecting the positive embryonic stem cells into wild-type mouse blastocyst stage embryos to form chimeric embryos, and culturing chimeric mice with the chimeric embryos; The female and male chimeric mice were self-fertilized to obtain F0 generation Kdm2a fl / - Mice; Kdm2a in F0 fl / - Mice were self-crossed and Kdm2a was obtained by screening fl / fl Mice; The Kdm2a fl / fl The mice were crossed with female Zp3-Cre transgenic tool mice and screened for Kdm2a fl / - , Zp3-Cre mice, Kdm2a fl / - , Zp3-Cre mice were self-bred to screen for oocyte-specific knockout of Kdm2a fl / fl , Zp3-Cre mice, i.e., Kdm2a cKO mice; The female Kdm2a cKO mice were crossed with male wild-type mice, and the offspring genotype was Kdm2a Δ / - mice, and obtained mice with maternal Kdm2a deficiency; The male and female maternal Kdm2a-deficient mice were mated to obtain mice with the genotype of Kdm2a Δ / Δ The mice are Kdm2a gene systemic knockout mice, Kdm2a gKO.

2. The method for constructing a Kdm2a gene systemic knockout mouse model according to claim 1, characterized in that: The method of designing a targeting site of the Kdm2a gene, constructing a targeting vector plasmid, and transferring the targeting vector plasmid into mouse embryonic stem cells to insert LoxP sites at both ends of the sixth exon of the Kdm2a gene, and screening to obtain positive embryonic stem cells specifically includes: The targeting site of the Kdm2a gene was designed, and the sixth exon of the Kdm2a gene was selected as the targeting site. Targeting vectors were designed for both ends of the targeting site and a targeting vector plasmid was constructed. The constructed targeting vector plasmid was transferred into mouse embryonic stem cells, and two LoxP sites were added to both ends of the targeting site by homologous recombination, and positive embryonic stem cells were obtained by screening.

3. The method for constructing a Kdm2a gene systemic knockout mouse model according to claim 1, characterized in that: The linearized plasmid map of the targeting vector plasmid is shown in FIG8 .

4. A Kdm2a gene systemic knockout mouse model, characterized in that: The systemic knockout mouse model is constructed by the method for constructing a Kdm2a gene systemic knockout mouse model according to any one of claims 1-3.

Images