A method for preparing sialylated pullulan
By utilizing the sialidyltransferase technology of the budding short-skinned pullulan strain EP1001 and genetically engineered strains, the problem of sialic acid transfer during pullulan fermentation was solved, achieving efficient preparation of sialylated pullulan with high sialic acid conversion rate and excellent product performance.
Patent Information
- Application Number
- CN202510379676.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-03-28
AI Technical Summary
Existing technologies struggle to efficiently transfer sialic acid molecules to pullulan molecules during the fermentation process of budding short-stem mold strains, forming sialylated pullulan, and there is a lack of efficient preparation methods.
Using the budding short-stem mold strain EP1001 and/or its genetically engineered strains, sialic acid molecules are transferred to pullulan polysaccharide molecules via sialyl transferase to form sialylated pullulan polysaccharide. This process includes the construction of the genetically engineered strain, the cloning and expression of the sialyl transferase gene, and the addition and extraction of sialic acid during fermentation.
The efficient preparation of sialylated pullulan was achieved, with a sialic acid conversion rate of up to 95.8%. The sialic acid content in the product was significantly increased, combining the beneficial effects of both sialic acid and pullulan.
Smart Images

Figure CN119876300B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of synthetic biology and metabolic engineering. Specifically, it belongs to the field of fermentation engineering technology for host cells modified by metabolic engineering, and specifically relates to a method for preparing sialylated pullulan polysaccharide by fermentation of *Brucea buddingis* and its genetically engineered strains. Background Technology
[0002] pullulan ( Figure 1 Pullulan is a novel high-molecular-weight biomaterial with excellent film-forming, fiber-forming, gas-barrier, adhesive, easy-processing, and non-toxic properties, and has been widely used in food, medicine, light industry, chemical, and petroleum fields. Studies have found that pullulan can act as a prebiotic, promoting the growth of beneficial bifidobacteria. Furthermore, in the human body, it is only slowly broken down into glucose by enzymes, without causing a rapid rise in blood sugar levels in a short period, making it suitable for inclusion in diets specifically for diabetics and patients with glucose intolerance. In addition, due to its non-toxic, non-immunogenic, non-mutagenic, and non-carcinogenic properties, pullulan is widely used in many biomedical fields such as targeted drug delivery, gene delivery, and wound healing. On the one hand, the covalent binding of viruses and pullulan can significantly enhance the intrinsic productivity of immunoglobulin G and immunoglobulin M while reducing the productivity of immunoglobulin E, thereby effectively inactivating viruses. On the other hand, in drug delivery systems, the specific binding of pullulan to the liver can satisfy the liver's targeted action, and pullulan derivatives also have broad application prospects as non-toxic conjugates for vaccines.
[0003] Sialic acid ( Figure 2 Sialic acid is a general term for N- or O-substituted derivatives of neuraminic acid, a monosaccharide with a nine-carbon backbone and carboxylic acid function. The sialic acid family consists of more than 40 derivatives of neuraminic acid. Sialic acid is a fundamental component of brain gangliosides and polysialic acid chains, which modify nerve cell adhesion molecules, promote intercellular interactions, neuronal outward growth, synaptic connectivity modification, and memory formation. Furthermore, sialic acid plays an important role in many physiological and pathological processes, including embryonic nervous system development, metastasis, regulation of immune responses, and bacterial or viral infections. Additionally, a diet rich in sialic acid can increase brain sialic acid levels, enhancing learning and memory.
[0004] This invention relates to the fermentation process of pullulan polysaccharide production by the budding short-skinned puerarin strain EP1001. It was discovered that this strain can endogenously secrete a sialyl transferase, which can transfer exogenous sialyl molecules to pullulan polysaccharide molecules, forming a sialylated pullulan polysaccharide complex, i.e., sialylated pullulan polysaccharide. This complex combines all the beneficial effects of sialyl and pullulan polysaccharide. The entire production process is simple and easy to operate. Summary of the Invention
[0005] One of the purposes of the present application is to provide a strain of Aureobasidium pullulans EP1001 capable of endogenous secretion of sialyltransferase, which was preserved in the China General Microbiological Culture Collection Center on April 19, 2022, with the preservation number of CGMCC No. 40158, the classification name of Aureobasidium pullulans, and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.
[0006] Another purpose of the present application is to provide a genetically engineered strain of EP1001 with high expression of sialyltransferase, which is obtained by inserting the nucleic acid sequence of sialyltransferase into the genome of the EP1001 strain.
[0007] Still another purpose of the present application is to provide a method for transferring sialic acid molecules to pullulan molecules by sialyltransferase through the strain of Aureobasidium pullulans EP1001 and / or the genetically engineered strain of EP1001.
[0008] Still another purpose of the present application is to provide a sialylated pullulan product containing sialic acid and pullulan molecules.
[0009] The present application provides a method for preparing sialylated pullulan, which is prepared by the strain of Aureobasidium pullulans EP1001 and / or the genetically engineered strain of EP1001, after 24.0 hr-60.0 hr of fermentation, 1.0 g / L-30.0 g / L of sialic acid is added, and the sialic acid is catalyzed by sialyltransferase to be transferred from the activated glycosyl donor to the acceptor pullulan sugar chain end to form a sialylated pullulan complex, i.e., sialylated pullulan. The supernatant after centrifugation of the fermentation broth is precipitated by an organic solvent, and finally the sialylated pullulan is obtained. The content of pullulan in the sialylated pullulan is 55.05 g / L, the content of sialic acid in the sialylated pullulan is 9.58 g / L, the content of free sialic acid in the culture and / or the culture broth is 0.42 g / L, and the sialic acid conversion rate is as high as 95.8%.
[0010] The present application provides a method for preparing sialylated pullulan, which mainly includes the following steps.
[0011] S1. Obtaining the sialyltransferase gene sequence.
[0012] S1.1 Obtaining the RNA of the EP1001 strain.
[0013] Liquid culture of EP1001 strain, 4°C, 4000rpm / min, centrifugal 15.0min, discard supernatant; resuspend the bacteria with 100.0μL TE buffer containing lysozyme, add 350.0μL lysis solution, vortex mix, 4°C, 12000rpm centrifugal 2.0min; transfer the supernatant to a new centrifuge tube, add 250.0μL absolute ethanol, mix, 4°C, 12000rpm centrifugal 30s-60s; discard the waste liquid, add 350.0μL deproteinization solution to the centrifuge tube, 4°C, 12000rpm centrifugal 30s-60s; discard the waste liquid, add 80.0μL DNase I working solution to the centrifuge tube, room temperature for 15.0min, then 4°C, 12000rpm centrifugal 30s-60s; discard the waste liquid, add 30.0μL-100.0μL RNase-Free ddH2O to the centrifuge tube, room temperature for 2.0min, to obtain the genomic RNA solution of EP1001 strain. The various reagents used in the above steps are conventional reagents known to those skilled in the art, and the related technical terms are conventional designations known to those skilled in the art.
[0014] S1.2 Cloning of sialyltransferase gene of EP1001 strain.
[0015] The RNA solution obtained in the above steps was subjected to reverse transcription to synthesize cDNA according to the reaction components and reaction volumes in Table 1.
[0016] Table 1 Reaction components and reaction volumes for reverse transcription of RNA to cDNA:
[0017]
[0018] The various reagents used in Table 1 are conventional reagent components known to those skilled in the art, and the related technical terms are conventional designations known to those skilled in the art.
[0019] In a 0.2ml PCR (polymerase chain reaction) reaction tube, the sialyltransferase gene was amplified using cDNA as a template according to the reaction components and reaction volumes in Table 2.
[0020] Table 2 Reaction components and reaction volumes for amplifying sialyltransferase gene using cDNA as a template:
[0021] Reaction components Reaction volume Genomic cDNA solution 1.0 μL PCR forward primer F (10.0 μM) 0.75 μL PCR reverse primer R (10.0 μM) 0.75 μL Premix Taq 12.5 μL ddH2O q.s. to 25.0 μL .
[0022] After mixing the above reaction system, it was placed in a PCR amplifier and pre-denatured at 95.0°C for 5.0 min, then cycled 40 times according to the reaction program of 95.0°C denaturation for 10 s, 60.0°C extension for 30 s, and 72.0°C annealing for 30 s, and finally reacted at 4°C for 10.0 min to terminate the cycle. The obtained PCR reaction solution was the cDNA sequence of the sialyltransferase gene SEQ ID NO: 1.
[0023] The primer sequences of the PCR forward primer F and the PCR reverse primer R in the PCR reaction system were as follows: the PCR forward primer F (SEQ ID NO: 3): CTTCAAATTTGTGTGTATCAT;
[0024] The PCR reverse primer R (SEQ ID NO: 4): TCAGCAATGAATAGTTCTGAA.
[0025] S1.3 Construction of sialyltransferase gene expression vector.
[0026] The 5'-end of the cDNA sequence of the sialyltransferase gene SEQ ID NO: 1 obtained in the above step was linked to SEQ ID NO: 2, and the sequence of SEQ ID NO: 2 and the sequence of SEQ ID NO: 1 were sequentially cloned into the Pichia pastoris expression vector pPIC9 plasmid (pPIC9-EP1001) by using the methods of chemical synthesis, gene editing, and gene recombination commonly used in the art. Figure 3 ), and the pPIC9-EP1001 recombinant plasmid for high expression of the sialyltransferase gene was obtained.
[0027] S1.4 Genetic transformation of the sialyltransferase gene.
[0028] S1.4.1 A single colony was picked from the PDA plate of the EP1001 strain and inoculated into 5.0 mL of YPD liquid medium, which was incubated at 30°C and 200 rpm / min overnight. The YPD liquid medium was a commercially available product.
[0029] S1.4.2 The culture was transferred to 50.0 mL of YPD liquid medium, and the initial OD600 of the culture was 0.2. The culture was incubated at 30°C and 200 rpm / min for 4.0-6.0 hr. When the OD600 was 0.8-1.0, the culture was centrifuged at 4000 rpm / min for 5.0 min, and the supernatant was discarded.
[0030] S1.4.3 The precipitate was resuspended with 15.0 mL of sterile water, centrifuged at 4000 rpm / min for 4.0 min, and the supernatant was discarded. Then, 500 μL of 0.1 mol / L lithium acetate solution was added to resuspend the culture, and the culture was aliquoted into 5 1.5 mL centrifuge tubes.
[0031] S1.4.4 Centrifuge at 8000 rpm / min for 1.0 min and discard the supernatant; add 240.0 μL of 50% PEG, 36.0 μL of 1.0 mol / L lithium acetate solution, and 2.0 μg of recombinant pPIC9-EP1001 plasmid to the precipitate, and bring the total volume to 360.0 μL with sterile water.
[0032] S1.4.5 Vortex the reagents and culture to mix well, heat shock in a 42℃ water bath for 30.0 min-60.0 min, centrifuge at 8000 rpm / min for 1.0 min and discard the supernatant. Add 1.0 mL of sterile water to the precipitate to wash the culture, centrifuge at 8000 rpm / min for 1.0 min and discard the supernatant. Repeat twice.
[0033] S1.4.6 The precipitate was resuspended in 1.0 mL of YPD liquid medium and thawed at 30 °C for 2.0 hr.
[0034] S1.4.7 After resuscitation, the culture was washed twice with 1.0 mL of sterile water and then resuspended in sterile water. An appropriate amount of the culture was spread on a YPD solid plate containing 200.0 mg / L ampicillin and cultured at 30°C until a single colony appeared, thus obtaining the EP1001 genetically engineered strain that highly expresses the sialyl transferase gene.
[0035] S2 seed culture.
[0036] S2.1 Preparation of Potato Glucose Agar Medium (PDA): Weigh 200.0g of peeled potatoes, cut them into small pieces, add 1000.0mL of distilled water and boil for 30.0min. Filter the solution through six layers of gauze to obtain a clear liquid. Add water to the clear liquid to 1000.0mL, then add 20.0g of glucose and dissolve it completely. Then add 20.0g of agar and stir to mix evenly to obtain potato glucose agar medium.
[0037] S2.2 Preparation of plate / slant seed culture: EP1001 strain and / or EP1001 genetically engineered strain, deposited at the China General Microbiological Culture Collection Center (CGMCC No. 40158), were inoculated onto PDA plates / slant culture medium using an inoculation needle via streak inoculation for activation culture. Specific steps: The budding short-stem fungus strain EP1001 or the EP1001 genetically engineered strain was removed from the -80°C freezer and allowed to thaw naturally on ice. It was then transferred to PDA plates / slant culture medium using an inoculation needle on a sterile laminar flow hood and incubated at 30°C in the dark for 72.0 hours.
[0038] S2.3 Preparation of liquid seed culture solution, the single colony of Aureobasidium pullulans strain plate / slope is inoculated in the liquid seed culture medium for shake flask activation. The specific steps are as follows: 30.0 ml of seed culture medium is loaded into a 250.0 ml flask for high-temperature and high-pressure sterilization, and after cooling, the single colony of Aureobasidium pullulans strain slope is inoculated in the liquid seed culture medium for shake flask activation, and the culture conditions are as follows: the rotation speed is 220 rpm, the temperature is 30℃, and the culture is carried out until OD600=10.0; the liquid seed culture medium comprises the following components: yeast extract powder 1.0 g / L-2.0 g / L, glucose 10.0 g / L-50.0 g / L, sucrose 1.0 g / L-10.0 g / L, molasses 1.0 g / L-10.0 g / L, (NH4)2SO4 0.10 g / L-0.66 g / L, NaNO3 0.25 g / L-0.84 g / L, K2HPO4 1.0 g / L-5.0 g / L, NaCl 1.0 g / L-2.0 g / L, MgSO4·7H2O 0.1 g / L-0.2 g / L, pH 7.0, 121℃ sterilization for 20.0 min.
[0039] S3 Fermentation of Aureobasidium pullulans to produce pullulan.
[0040] S3.1 The activated liquid seed culture solution is inoculated into a bioreactor containing fermentation medium at an inoculation amount of 5.0%-25.0% for fermentation culture. The fermentation medium comprises the following components: glucose 10.0 g / L-50.0 g / L, sucrose 1.0 g / L-10.0 g / L, (NH4)2SO4 0.10 g / L-0.66 g / L, NaNO3 0.25 g / L-0.84 g / L, K2HPO4 1.0 g / L-5.0 g / L, NaCl 1.0 g / L-2.0 g / L, MgSO4·7H2O 0.1 g / L-0.2 g / L, pH 7.0, 121℃ sterilization for 20.0 min, and the fermentation medium is obtained.
[0041] S3.2 Fermentation culture conditions: 5.0 L bioreactor, liquid volume 1.0 L-2.5 L, inoculation amount 5.0%-25.0% in the fermentation medium, fermentation temperature 27.0℃-30.0℃, stirring speed 200 rpm / min-600 rpm / min, aeration ratio 1.0:1.0-2.0 (V / V), vessel pressure 0.01 Mpa-0.02 Mpa, fermentation temperature 27.0℃-30.0℃, pH is controlled at 4.5-7.0 12.0 hr before fermentation, pH is controlled at 2.8-3.5 12.0 hr-60.0 hr, and the fermentation culture is carried out for 48.0 hr-60.0 hr.
[0042] Further, the components of glucose 10.0 g / L-50.0 g / L and sucrose 1.0 g / L-10.0 g / L in the fermentation medium are separately subjected to high-temperature and high-pressure sterilization, and are added to the fermentation medium at the beginning of the batch fermentation.
[0043] Further, the components of glucose 10.0 g / L-50.0 g / L and sucrose 1.0 g / L-10.0 g / L in the fermentation medium are separately subjected to high-temperature and high-pressure sterilization, and are added to the fermentation medium at the beginning of the batch fermentation.
[0044] Further, the components of glucose 10.0 g / L-50.0 g / L and sucrose 1.0 g / L-10.0 g / L in the fermentation medium are added to the fermentation medium by continuous flow, with an initial concentration of 0.0 g / L-20.0 g / L, a flow rate of 1.0 g / L / h-3.0 g / L / h, a fermentation time of 48.0 hr-60.0 hr, and a final total consumption of glucose and sucrose of 60.0 g / L.
[0045] Further, the carbon source in the fermentation medium includes glucose, fructose, sucrose, mannose, galactose, lactose, maltodextrin, honey and other sugars and derivatives that can be utilized by Aureobasidium pullulans, which can be added alone and / or in combination of two or more.
[0046] Further, the fermentation period of Aureobasidium pullulans fermentation culture for producing pullulan is 24 hr and / or 36 hr and / or 48 hr and / or 60 hr and / or 72 hr.
[0047] Further, the final product is the fermentation culture and / or culture solution of Aureobasidium pullulans.
[0048] Further, the above-mentioned culture and / or culture solution contains sialyltransferase and pullulan.
[0049] Further, the above-mentioned sialyltransferase includes α-2,3-sialyltransferase and / or α-2,6-sialyltransferase and / or α-2,8-sialyltransferase, which can be one or more.
[0050] S4 Preparation of sialylated pullulan.
[0051] To the fermentation culture and / or culture solution obtained by culturing the Aureobasidium pullulans for 24 hr and / or 36 hr and / or 48 hr and / or 60 hr and / or 72 hr, 1.0 g / L-30.0 g / L of sialic acid is added, and the pH of the culture and / or culture solution is adjusted to 6.5-7.5 according to the fermentation tank control process conditions, and the culture is continued for 12.0 hr-36.0 hr.
[0052] Further, the culture is continued for 12 hr-24 hr.
[0053] Further, the added sialic acid is an N- or O-substituted derivative of neuraminic acid, which can be added alone or in a mixture of two or more derivatives.
[0054] Further, the Aureobasidium pullulans strain EP1001 was preserved in the China General Microbiological Culture Collection Center on April 19, 2022, with a preservation number of CGMCC No. 40158, a classification name of Aureobasidium pullulans, and an address of No. 3, Beichen West Road, Beijing City, Chaoyang District, and can naturally secrete sialyltransferase.
[0055] Further, the Aureobasidium pullulans strain EP1001 is a genetically engineered strain derived from the EP1001 genetically engineered strain with high expression of sialyltransferase gene obtained in S1, and the genetically engineered strain can highly secrete sialyltransferase.
[0056] S5. Isolation and extraction of sialylated pullulan.
[0057] Take 10.0 ml of the culture and / or culture solution, centrifuge at 12000 rpm / min for 15.0 min-20.0 min, transfer the supernatant to a new centrifuge tube, add 2.0 times-3.5 times the volume of anhydrous ethanol to the supernatant, mix well for 20-30 times, and then centrifuge at 12000 rpm / min for 15.0 min-20.0 min at 4°C in a high-speed centrifuge. Discard the supernatant, and dry the precipitate in a constant temperature drying oven at 120°C for 24.0 hr. Weigh the sialylated pullulan to obtain the crude yield.
[0058] S6. Determination of the content of pullulan in sialylated pullulan.
[0059] Weigh 50.0 mg of the above dried sialylated pullulan to prepare a 50.0 mg / L sialylated pullulan solution. The sulfuric acid-anthrone method is used to determine the total sugar, and the specific reference is made to the literature (Zhang Shuihua. Food Analysis. Beijing: China Light Industry Press, 2004). The content of pullulan in sialylated pullulan is calculated according to the standard curve.
[0060] S7 Determination of sialic acid content in sialylated pullulan.
[0061] Weigh 50.0 mg of the above dried sialylated pullulan to prepare a 50.0 mg / L sialylated pullulan solution. The sialylated pullulan solution is subjected to acid hydrolysis according to the acid hydrolysis step in the method for determination of total sugar by sulfuric acid-anthrone method (Zhang Shuihua. Food Analysis. Beijing: China Light Industry Press, 2004), and the hydrolysis solution is subjected to determination of sialic acid content according to a commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method).
[0062] S8 Determination of free sialic acid content in culture and / or culture broth.
[0063] Determination of free sialic acid content is performed according to a commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method).
[0064] Definitions.
[0065] The words used in this specification to describe the application and its various embodiments are to be understood not only in the sense of their commonly defined meanings, but to include by special definition in this specification structure, material or acts beyond the scope of the commonly defined meanings. Thus if an element can be understood in the context of this specification in more than one way, then the definition in this specification must be construed in a way which includes all of those meanings and the meaning must be taken to encompass all of them.
[0066] The various embodiments and aspects of the embodiments disclosed in this specification are to be understood not only in the sense of the particular embodiments described, but in the sense of providing the structure, material or acts described in any order, and any combination thereof. All words used herein are to be interpreted in an inclusive and non-exclusive sense, except where expressly stated to the contrary.
[0067] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Generally, the nomenclature used in this specification and the laboratory procedures in fermentation culture, genetic engineering, gene cloning, organic chemistry, and nucleic acid chemistry described in this specification are those well-known and commonly used in the art. Generally, sialic acid detection and sialyltransferase detection steps are performed according to the manufacturer's instructions.
[0068] In the drawings and specification, there have been disclosed exemplary embodiments of the application and, although specific terms are employed, they are used in a descriptive sense only and should not be construed as limiting the application. It will be apparent to one of ordinary skill in the art that various changes and modifications can be made to the embodiments described herein and that such changes and modifications are intended to be within the scope of the application. The scope of the application is set forth in the following claims and includes both combinations and sub-combinations of the various elements and features. The reference characters used to designate steps in the claims are provided for convenience only and are not intended to imply any particular order of performing the steps.
[0069] In the present application, the expression "comprising" as used herein includes and specifically refers to the expressions "consisting essentially of and "consisting of, in addition to its literal meaning. Thus, the expression "comprising" refers to embodiments in which the subject matter "comprising" the specifically listed elements does not contain additional elements, as well as embodiments in which the subject matter "comprising" the specifically listed elements can and / or does encompass additional elements. Likewise, the expression "having" is to be understood as the expression "comprising", also including and specifically referring to the expressions "consisting essentially of and "consisting of.
[0070] In the present application, the term "Pullulan" is a polysaccharide produced by linking maltotriose units, which are produced by linking glucose units with a-1,4 bonds, with a-1,6 bonds. Also known as pullulan, short-tailed yeast polysaccharide, and Aureobasidium pullulans polysaccharide.
[0071] In the present application, the term "Aureobasidium pullulans" is a yeast-like fungus widely distributed in nature.
[0072] In the present application, the term "nucleic acid" includes single- and double-stranded nucleic acids, ribonucleic acids, and deoxyribonucleic acids. It can comprise naturally occurring as well as synthetic nucleotides, and can be naturally modified or modified by synthetic means (e.g., by methylation, 5'- and / or 3'-capping). In a particular embodiment, the nucleic acid refers to double-stranded deoxyribonucleic acid.
[0073] In the present application, the term "vector" is used in its broadest meaning and comprises any intermediate vehicle of nucleic acid which is capable of introducing said nucleic acid, for example, into prokaryotic and / or eukaryotic cells and, where appropriate, into the genome. Such vectors are preferably replicated and / or expressed in the cells. Vectors comprise plasmids, phagemids, phages or viral genomes. The term "plasmid" as used herein generally relates to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA. The vectors according to the present application can exist in circular or linearized form.
[0074] In the present application, the term "genetically engineered strain" means a host which is genetically modified by grafting or splicing genes from one species into the cells of a host organism of a different species. Such DNA becomes part of the genetic make-up of the host and is replicated. "Genetically engineered" cells or microorganisms as used in the context of the present disclosure mean cells or microorganisms which are genetically modified or have an altered genetic make-up.
[0075] In the present application, the term "endogenous" refers to any polynucleotide, polypeptide or protein sequence which is a natural part of the cell and occurs in its natural position in the cell's chromosome. The term "exogenous" refers to any polynucleotide, polypeptide or protein sequence which originates from outside the cell under study and is not a natural part of the cell, or which does not occur in its natural position in the cell's chromosome or plasmid, for example, the genetically engineered strain of the present application, the exogenous sialyltransferase gene is cloned after the endogenous sialyltransferase gene, and then is introduced into the strain of Aureobasidium pullulans EP1001 after genetic modification.
[0076] In the present application, the term "sialic acid" particularly refers to any N- or O- substituted derivative of neuraminic acid. It can refer to 5-N-acetylneuraminic acid and 5-N-glycolylneuraminic acid, but preferably only to 5-N-acetylneuraminic acid. Sialic acid, particularly 5-N-acetylneuraminic acid, is preferably attached to a carbohydrate chain via an a-2,3- or an a-2,6-linkage.
[0077] In the present application, the term "sialylation" refers to the way in which a pullulan molecule comprising at least one sialic acid residue, in particular the sialyltransferase transfers sialic acid from an activated glycosyl donor to the acceptor pullulan molecule structure. The at least one sialyl (N-acetylneuraminyl) moiety can have a linear or branched structure comprising monosaccharide units which are interconnected by interglycosidic linkages. BRIEF DESCRIPTION OF DRAWINGS
[0078] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.
[0079] Figure 1 Molecular structure of pullulan.
[0080] Figure 2 Molecular structure of three common sialic acids, from left to right: N-acetylneuraminic acid (Neu5Ac), N-glycolylneuraminic acid (Neu5Gc), and 2-keto-3-deoxynononic acid (Kdn).
[0081] Figure 3 Vector structure of Pichia pastoris expression vector pPIC9. DETAILED DESCRIPTION
[0082] The various illustrative embodiments of the present application will now be described in detail below. The detailed description is made with reference to the drawings, in which like reference numerals are used to refer to like elements throughout. The detailed description is made with reference to the drawings, in which like reference numerals are used to refer to like elements throughout. The detailed description is made with reference to the drawings, in which like reference numerals are used to refer to like elements throughout.
[0083] It should be understood that the terms used in the present application merely describe particular embodiments, and are not intended to limit the present application. In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or stated range and any other stated value or stated range is also encompassed within the present application, and the upper limit and the lower limit of the smaller range can be independently included or excluded from the range.
[0084] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. Any and all
[0085] Many modifications and variations of this application description can be made in light of the above teachings without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is intended that the scope of the application be limited only by the claims.
[0086] As used in the present application, "comprise", "include", "have", "contain", and the like, are open-ended terms that is, they mean including but not limited to.
[0087] The raw materials used in the present application are all conventional commercially available products, and the methods used in the present application are all conventional methods in the art, and the quality of each substance used in the present application is conventional quality. If not otherwise specified, they are purchased from commercial channels or are publicly known.
[0088] Example 1
[0089] The seed culture step is shown in S2 seed culture.
[0090] The activated seed culture solution was inoculated into a bioreactor containing fermentation medium at an inoculation amount of 15.0%, and the fermentation culture was carried out. The fermentation medium comprises the following components: glucose 50.0 g / L, sucrose 10.0 g / L, (NH4)2SO40.66 g / L, NaNO30.84 g / L, K2HPO45.0 g / L, NaCl 1.0 g / L, MgSO4·7H2O 0.2 g / L, pH 7.0, sterilized at 121℃ for 20.0 min.
[0091] The fermentation culture conditions are as follows: 5.0 L bioreactor, liquid volume 2.5 L, inoculate the liquid seed culture medium into the fermentation medium at an inoculation amount of 15.0%, fermentation temperature 30℃, stirring speed 400 rpm / min, aeration ratio 1.0:2.0 (V / V), vessel pressure 0.01 Mpa, control pH 7.0 for 12.0 hr before fermentation, control pH 2.8 for 12.0-60.0 hr, fermentation culture for 60.0 hr.
[0092] The sialylated pullulan was separated and extracted by taking 10.0 ml of fermentation culture and / or culture solution, centrifuging at 12000 rpm / min for 20.0 min, transferring the supernatant to a new centrifuge tube, adding 3.0 times the volume of anhydrous ethanol to the supernatant, mixing well by inverting up and down for 30 times, then high-speed centrifuging at 4℃ 12000 rpm / min for 20.0 min, discarding the supernatant, and drying the precipitate in a constant temperature drying oven at 120℃ for 24.0 hr, then weighing, to obtain a crude yield of sialylated pullulan of 54.5 g / L (Table 3).
[0093] The content of pullulan in sialylated pullulan was determined by taking 50.0 mg of the above dried sialylated pullulan and preparing a 50.0 mg / L sialylated pullulan solution. The total sugar was determined by the sulfuric acid-anthrone method, and the specific reference is shown in the literature (Zhang Shuihua. Food Analysis. Beijing: China Light Industry Press, 2004). According to the standard curve, the content of pullulan in sialylated pullulan was calculated to be 43.6 g / L (Table 3).
[0094] Determination of sialic acid content in sialylated pullulan: 50.0 mg of the above dried sialylated pullulan was weighed to prepare a sialylated pullulan solution of 50.0 mg / L. The sialylated pullulan solution was subjected to acid hydrolysis according to the acid hydrolysis step in the total sugar determination method of sulfuric acid-anthrone. The hydrolyzate was determined according to a commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method), and the sialic acid content in the sialylated pullulan was determined to be 0.00 g / L (Table 3).
[0095] Determination of free sialic acid content in the culture and / or culture solution was performed according to a commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method), and the content was 0.00 g / L (Table 3).
[0096] Determination of sialyltransferase content in the culture and / or culture solution: In order to further confirm whether the Aureobasidium pullulans strain EP1001 can endogenously secrete sialyltransferase, a commercially available sialyltransferase 1 (SIAT1) detection kit (enzyme-linked immunosorbent assay method) was used to detect the sialyltransferase content in the fermentation supernatant. The final sialyltransferase content was determined to be 5.65 ug / L, confirming that the Aureobasidium pullulans strain EP1001 can endogenously secrete sialyltransferase.
[0097] Beneficial effects: The Aureobasidium pullulans strain EP1001 can endogenously secrete sialyltransferase, but the free sialic acid content in the culture and / or culture solution and the sialic acid content in the acid-hydrolyzed sialylated pullulan product are both 0.00 g / L, indicating that even if there is a low content of sialyltransferase in the culture and / or culture solution, sialylated pullulan cannot be generated without the addition of exogenous sialic acid (Table 3).
[0098] Example 2
[0099] Seed culture step: see S2 seed culture.
[0100] Fermentation culture conditions: 5.0 L bioreactor, liquid volume 2.5 L, inoculate the fermentation medium with the liquid seed medium at a 15.0% inoculum, fermentation temperature 30°C, stirring speed 400 rpm / min, aeration ratio 1.0:2.0 (V / V), vessel pressure 0.01 Mpa, control the pH at 4.5 for 12.0 hr before fermentation, control the pH at 3.5 for 12.0-60.0 hr, after 60.0 hr of fermentation culture, add 2.0 g / L of sialic acid to the culture and / or culture solution, control the pH at 6.5, and continue to culture for 24.0 hr.
[0101] Isolation and extraction of sialylated pullulan was the same as example 1. The final crude yield of sialylated pullulan was 51.2 g / L (Table 3).
[0102] Determination of pullulan content in sialylated pullulan: the same as example 1. According to the standard curve, the content of pullulan in sialylated pullulan was 43.9 g / L (Table 3).
[0103] Determination of sialic acid content in sialylated pullulan: the same as example 1. The content of sialic acid in sialylated pullulan was 0.98 g / L (Table 3).
[0104] Determination of free sialic acid content in culture and / or culture solution was determined according to commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method), and the content was 1.02 g / L (Table 3).
[0105] Beneficial effects, after 60.0 hr of fermentation culture, 2.0 g / L of sialic acid was added to the culture and / or culture solution, the yield of pullulan in sialylated pullulan was 43.9 g / L, the free sialic acid content in the culture and / or culture solution was 1.02 g / L, and the sialic acid content in sialylated pullulan was 0.98 g / L, the sialic acid utilization rate was 49.0%, and sialylated pullulan was prepared.
[0106] Example 3
[0107] Seed culture step: see S2 seed culture.
[0108] Fermentation culture conditions: 5.0 L bioreactor, liquid volume 2.5 L, inoculate the liquid seed culture medium into the fermentation culture medium according to the inoculation amount of 20.0%, fermentation temperature 28℃, stirring speed 500 rpm / min, aeration ratio 1.0:2.0 (V / V), container pressure 0.02 Mpa, 12.0 hr before fermentation, control pH at 4.5, 12.0 hr-48.0 hr control pH value at 3.2, after 48.0 hr of fermentation culture, add 2.0 g / L of sialic acid to the culture and / or culture solution, control pH value at 6.5, continue to culture for 24.0 hr.
[0109] Isolation and extraction of sialylated pullulan was the same as example 1. The final crude yield of sialylated pullulan was 44.80 g / L (Table 3).
[0110] Determination of pullulan content in sialylated pullulan: the same as example 1. According to the standard curve, the content of pullulan in sialylated pullulan was 39.87 g / L (Table 3).
[0111] Determination of sialic acid content in sialylated pullulan: same as example 1, the sialic acid content in sialylated pullulan was 1.35 g / L (Table 3).
[0112] Determination of free sialic acid content in culture and / or broth was measured according to commercially available sialic acid (SA) test kit (ELISA method) and the content was 0.65 g / L (Table 3).
[0113] Beneficial effects, under the premise of adding 2.0 g / L of exogenous sialic acid, the yield of sialylated pullulan was 39.87 g / L, the free sialic acid content in culture and / or broth was 0.65 g / L, the sialic acid content in sialylated pullulan was 1.35 g / L, and the sialic acid utilization rate was 67.5%. The earlier the exogenous sialic acid was added, the lower the yield of sialylated pullulan was, although the sialic acid utilization rate was improved (Table 3), because the early addition of sialic acid would competitively occupy the α-1, 4 and / or α-1, 6 glycosidic bonds of pullulan, affecting the linear linkage of substrate carbon source to pullulan molecules.
[0114] Example 4
[0115] Seed culture step S2 seed culture was used, and EP1001 genetically engineered bacteria obtained in step S1 were used for fermentation.
[0116] Fermentation culture conditions: 5.0 L bioreactor, liquid volume 2.5 L, inoculation of liquid seed culture medium into fermentation culture medium according to 15.0% inoculation amount, fermentation temperature 28°C, stirring speed 600 rpm / min, aeration ratio 1.0:2.0 (V / V), container pressure 0.02 Mpa, before fermentation, control pH at 4.5, 12.0 hr-60.0 hr control pH at 3.5, after 60.0 hr of fermentation culture, add 10.0 g / L of sialic acid to the culture and / or broth, control pH at 6.5, continue to culture for 12.0 hr.
[0117] Isolation and extraction of sialylated pullulan was the same as example 1, and the final crude yield of sialylated pullulan was 53.6 g / L (Table 3).
[0118] Determination of sialic acid content in sialylated pullulan: same as example 1, the sialic acid content in sialylated pullulan was 1.35 g / L (Table 3).
[0119] Determination of sialic acid content in sialylated pullulan: same as example 1, the sialic acid content in sialylated pullulan was 1.35 g / L (Table 3).
[0120] The determination of the free sialic acid content in the culture and / or culture solution was performed according to the commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method), and the content was 1.20 g / L (Table 3).
[0121] The beneficial effects were that, under the premise of adding 10.0 g / L of sialic acid exogenously, the yield of pullulan in the sialylated pullulan was 49.14 g / L, the free sialic acid content in the culture and / or culture solution was 1.20 g / L, the content of sialic acid in the sialylated pullulan was 8.80 g / L, and the sialic acid utilization rate was 88.0%. It can be seen that the modified EP1001 genetically engineered strain can secrete more sialyltransferase than the unmodified EP1001 strain, and can improve the utilization efficiency of sialic acid (Table 3).
[0122] Example 5
[0123] The seed culture step is S2 seed culture, and the EP1001 genetically engineered bacteria obtained in the S1 step are used for fermentation.
[0124] The activated seed culture solution is inoculated into a bioreactor containing fermentation medium at an inoculation amount of 10%, and the fermentation medium comprises the following components: (NH4)2SO40.66 g / L, NaNO30.84 g / L, K2HPO45.0 g / L, NaCl 1.0 g / L, MgSO4·7H2O 0.2 g / L, pH 7.0, 121 ℃ sterilization for 20 min.
[0125] The fermentation culture conditions are as follows: 5.0 L bioreactor, liquid volume 1.5 L, inoculation of liquid seed medium into fermentation medium at an inoculation amount of 10.0%, fermentation temperature 28 ℃, stirring speed 500 rpm / min, aeration ratio 1.0:2.0 (V / V), vessel pressure 0.02 Mpa; at the beginning of fermentation, a mixed solution of glucose and sucrose is added, the glucose concentration in the mixed solution is 50.0 g / L, the sucrose concentration is 10.0 g / L, the flow rate is 1.0 g / L / h (1.0 g refers to the weight of solute), and the continuous flow rate is 60.0 hr; 12 hr before fermentation, the pH is controlled at 4.5, 12.0 hr-60.0 hr the pH value is controlled at 3.5, after 60.0 hr of fermentation culture, 10.0 g / L of sialic acid is added to the culture and / or culture solution, the pH value is controlled at 6.5, and the culture is continued for 24.0 hr.
[0126] The sialylated pullulan is separated and extracted as in Example 1, and the final yield of sialylated pullulan is 57.9 g / L (Table 3).
[0127] Determination of the content of pullulan in the sialylated pullulan: same as Example 1. The content of pullulan in the sialylated pullulan was calculated according to the standard curve to be 55.05 g / L (Table 3).
[0128] Determination of the content of sialic acid in the sialylated pullulan: same as Example 1. The content of sialic acid in the sialylated pullulan was 9.58 g / L (Table 3).
[0129] Determination of the content of free sialic acid in the culture and / or culture solution was carried out according to the commercially available sialic acid (SA) detection kit (enzyme-linked immunosorbent assay method) to be 0.42 g / L (Table 3).
[0130] Beneficial effects, under the premise of adding 10.0 g / L of sialic acid exogenously, the yield of pullulan in the sialylated pullulan was 55.05 g / L, the content of free sialic acid in the culture and / or culture solution was 0.42 g / L, and the content of sialic acid in the sialylated pullulan was all 9.58 g / L, and the utilization rate of sialic acid was 95.8%. It can be seen that the mixed solution of glucose (concentration 50.0 g / L) and sucrose (concentration 10.0 g / L) added during fermentation can significantly improve the yield of pullulan produced by Aureobasidium pullulans fermentation, and also improve the utilization rate of sialic acid (Table 3).
[0131] Table 3 Results of the yield of sialylated pullulan, the content of sialic acid in the sialylated pullulan, the content of free sialic acid in the culture and / or culture solution, and the utilization rate of sialic acid in Example 1-Example 5.
[0132]
[0133] The present application provides a method for preparing sialylated pullulan, which is prepared by adding 1.0 g / L-30.0 g / L of sialic acid to Aureobasidium pullulans strain EP1001 and / or genetically engineered bacteria of EP1001 after fermentation for 24.0 hr-60.0 hr, and then catalyzing the sialic acid to be transferred from an activated glycosyl donor to the end of the acceptor pullulan sugar chain by sialic acid transferase to form a sialylated pullulan complex, i.e. sialylated pullulan. The supernatant after centrifugation of the fermentation broth is precipitated by an organic solvent to obtain the sialylated pullulan. The content of pullulan in the sialylated pullulan is 55.05 g / L, the content of sialic acid in the sialylated pullulan is 9.58 g / L, the content of free sialic acid in the culture and / or culture solution is 0.42 g / L, and the highest conversion rate of sialic acid is 95.8%.
Claims
1. A method for preparing a sialylated pullulan, characterized by, The method comprises the following steps: S1, Aureobasidium pullulans strain EP1001 and / or its genetically engineered strain, EP1001 strain was deposited in China General Microbiological Culture Collection Center on April 19, 2022; the deposit number is CGMCC No.40158, the classification name is Aureobasidium pullulans, and the deposit address is No.3, Beichen West Road, Beijing City, Chaoyang District; the genetically engineered strain is obtained by overexpressing the sialyltransferase gene sequence SEQ ID NO:1 in the EP1001 strain; S2, Aureobasidium pullulans strain EP1001 and / or its genetically engineered strain is cultured in a fermentation medium to obtain a culture and / or a culture solution containing sialyltransferase and pullulan; S3, adding sialic acid to the above culture and / or culture solution, and culturing for 12.0-36.0 hours to prepare sialylated pullulan; S4, centrifugal separation of the culture and / or culture solution obtained in step S3 to obtain sialylated pullulan.
2. The method for preparing a sialylated pullulan according to claim 1, characterized by, The genetically engineered strain is obtained by overexpressing the sialyltransferase gene sequence SEQ ID NO:1 in the EP1001 strain, and is obtained by linking the sequence SEQ ID NO:2 to the 5' end of the sialyltransferase gene sequence SEQ ID NO:1, and then sequentially cloning the sequence SEQ ID NO:2 and the sequence SEQ ID NO:1 into the pPIC9 plasmid, and then genetically transforming the EP1001 strain of Aureobasidium pullulans.
3. The method of preparing a sialylated pullulan according to claim 1, wherein, The fermentation medium culture is carried out in a 5.0L bioreactor with a liquid volume of 1.0L-2.5L, an inoculation amount of 5.0%-25.0%, a stirring speed of 200rpm / min-600rpm / min, a ventilation ratio of 1.0:1.0-2.0(V / V), a container pressure of 0.01Mpa-0.02Mpa, a fermentation temperature of 27.0℃-30.0℃, a pH value of 4.5-7.0 controlled for 12.0 hours before fermentation, a pH value of 2.8-3.5 controlled for 12.0-60.0 hours, and a fermentation culture for 48.0-60.0 hours.
4. The method for preparing a sialylated pullulan according to claim 1 or 3, characterized by, The fermentation medium culture comprises batch fermentation or fed-batch fermentation.
5. The method of preparing a sialylated pullulan according to claim 4, characterized in that, The batch fermentation has a carbon source concentration of 40.0-60.0g / L, including glucose, fructose, sucrose, mannose, galactose, lactose, malt dextrin, and honey, which can be added alone and / or in combination of two or more, and the fermentation culture is carried out for 48.0-60.0 hours.
6. The method of preparing a sialylated pullulan according to claim 4, wherein, The fed-batch fermentation has an initial carbon source concentration of 0.0-20.0g / L, including glucose, fructose, sucrose, mannose, galactose, lactose, malt dextrin, and honey, which can be added alone and / or in combination of two or more, and the fermentation culture is carried out for 48.0-60.0 hours.
7. The method of preparing a sialylated pullulan according to claim 6, wherein, The carbon source added in the flow includes glucose, fructose, sucrose, mannose, galactose, lactose, malt dextrin, and honey, which can be added alone and / or in combination of two or more.
8. The method of preparing a sialylated pullulan according to claim 1, wherein, The sialic acid is an N- or O-substituted derivative of neuraminic acid, which can be added alone and / or in combination of two or more derivatives.
9. The method for preparing sialylated pullulan polysaccharide according to claim 1, characterized in that, The sialic acid is added at a concentration of 1.0 g / L-30.0 g / L, at a time of 24.0 hr-60.0 hr of fermentation, and after the addition, the pH value is controlled at 6.5-7.5, and the culture is continued for 12.0 hr-36.0 hr.
Citation Information
Patent Citations
A scanning grid apparatus for suppressing scatter in radiographic imaging
EP0040158A1
Trench gate IGBT
EP1320133A2
Fusion enzymes having N-acetylglucosaminyl transferase activity
CN103348003A
CMP-dependent sialidase activity
CN107429237A