FMR1 genotype detection kit

Abstract

The invention discloses an FMR1 genotype detection kit, and relates to the technical field of gene detection. The kit comprises a group of primer nucleotide sequences (SEQ ID NO: 1-2) for detecting the genotype of the FMR1 and DNA tag nucleotide sequences (SEQ ID NO: 3-12) at the 5'end of the primer. The kit also contains a PCR amplification reagent (comprising DNA polymerase, a reaction buffer solution and a primer group) and a reagent (such as terminal repair enzyme, a linker, ligase and the like) for constructing a three-generation sequencing library. The kit can be used for detecting the repetition number of CGG of the FMR1 gene, the insertion condition of AGG, SNVs, Indels and the like, has the advantages of comprehensive and accurate detection, great clinical application potential and the like, and provides a powerful tool for diagnosis, carrier screening and genetic counseling and intervention of the fragile X syndrome.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a kit for detecting FMR1 genotype. Background Art

[0002] Fragile X syndrome (FXS) is an X-linked incompletely penetrant genetic disease and one of the most common genetic diseases. The incidence rate in males is about 1 / 4000 and that in females is about 1 / 7000. Typical phenotypes of FXS include mental retardation, language disorders, special facial features, behavioral disorders, etc. A small number of patients may have epilepsy, abnormal cardiac structure, etc. FXS is closely related to the abnormal expansion of the (CGG)n repeat sequence in the 5' non-coding region of the FMR1 gene located at Xq27.3. Theoretically, the (CGG)n of this sequence is 6-44 repeats under normal conditions; when (CGG)n is 45-54 repeats, it is called an intermediate state; when (CGG)n reaches 55-200 repeats, it is called a premutation. The FMR1 gene promoter of premutation carriers is unmethylated, and can produce FMR1 protein with an expression level slightly lower than the normal value, which may lead to related diseases such as premature ovarian failure or ataxia, but generally does not cause FXS. The premutation gene is unstable, and the CGG sequence may be expanded during female cell meiosis to exceed 200 repeats. When (CGG)n exceeds 200 repeats, it is called a full mutation. The promoter of the fully mutated FMR1 gene is methylated, resulting in gene silencing and protein expression being blocked, which affects brain development and leads to fragile X syndrome. Asymptomatic women carrying premutations or full mutations are called FXS carriers because they may give birth to children with FXS.

[0003] There are two main reasons that affect the expansion of CGG repeat sequences: (1) the number of CGG repeats. The larger the number of repeats, the higher the risk of expansion into a full mutation; (2) the number and embedding pattern of AGG. The insertion of AGG is conducive to the stable inheritance of the CGG repeat sequence. Clinically, this structure also helps to predict the risk of premutation expansion. The transmission of a full mutation only occurs in mothers who carry a full mutation or a premutation. The higher the number of CGG repeats in a mother who carries a premutation, the greater the chance that the offspring will carry a full mutation. Therefore, FMR1 genotype testing can not only diagnose FXS, but also screen out FXS carriers, so that corresponding genetic counseling and intervention can be carried out.

[0004] At present, the most common method for detecting FXS genotype is through FMR1 gene amplification combined with capillary electrophoresis (CE). However, the sample throughput of this method is limited by CE and the detection cost is high. In addition, this method cannot accurately determine single nucleotide variants (SNVs), small fragment deletions and duplications (Indels), and some AGG insertions. In addition, Southern blot can also be used for FMR1 gene detection, but this method has large errors and cumbersome steps, low detection throughput, and requires a large amount of genomic DNA, which limits its large-scale application in clinical practice. Due to the great difficulty in accurately aligning, splicing and interpreting CGG repeat sequences, the second-generation sequencing widely used in the field of genetic disease detection is extremely difficult to detect FXS. The FXS analysis method combining long-fragment PCR with third-generation sequencing overcomes the limitations of second-generation sequencing in terms of read length and detection of repeat sequences, and can read specific nucleic acid sequences, so it can identify the number and location of SNVs, Indels, and AGG insertions. In addition, it can also detect the methylation status of FMR1 and has great potential for clinical application. Summary of the invention

[0005] The first object of the present invention is to provide a set of primers for detecting FMR1 genotype and artificial DNA tags at the 5' end of the primers.

[0006] The second object of the present invention is to provide a kit for detecting FMR1 genotypes. The kit can detect the number of CGG repeats, the insertion of AGG, SNVs, Indels, etc. of the FMR1 gene.

[0007] To achieve the above-mentioned object, the present invention is implemented by the following scheme:

[0008] A primer set for detecting FMR1 genotype and an artificial DNA tag at the 5' end of the primer, the primer set comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in the sequence table SEQ ID NO: 1, the nucleotide sequence of the reverse primer is shown in the sequence table SEQ ID NO: 2, and the nucleotide sequence of the artificial DNA tag is shown in SEQ ID: 3-12.

[0009] SEQ ID NO: 1: CAGCGTTGATCACGTGACGTGGTTTCAGTG

[0010] SEQ ID NO: 2: CTTGTAGAAAGCGCCATTGGAGCCCCGCA

[0011] SEQ ID NO: 3: GAGTCTAG

[0012] SEQ ID NO:4: CACGATGT

[0013] SEQ ID NO: 5: CGTAAGCT

[0014] SEQ ID NO: 6: AAGTGGTA

[0015] SEQ ID NO: 7: AGAGGACA

[0016] SEQ ID NO: 8: ACCATAGT

[0017] SEQ ID NO: 9: TATGCGTC

[0018] SEQ ID NO: 10: TACGCAGA

[0019] SEQ ID NO: 11: TATTCTCC

[0020] SEQ ID NO: 12: TTAGCATG

[0021] The 5' end of the forward primer and / or the reverse primer is connected with an artificial DNA tag, and the artificial DNA tag is a nucleotide sequence selected from at least any one of the sequences in the sequence list SEQ ID NO: 3 to SEQ ID NO: 12.

[0022] The primer set is used for PCR amplification to obtain a long DNA fragment containing a (CGG)n repeating sequence in the 5' non-coding region of the FMR1 gene.

[0023] The present invention provides application of the primer set in preparing a kit for detecting FMR1 genotype.

[0024] The invention provides a kit for detecting FMR1 genotype, comprising one or two of the primers with or without DNA labels, a PCR amplification reagent and a third-generation sequencing library construction reagent.

[0025] In one embodiment, the PCR amplification reagents include a DNA polymerase, a reaction buffer, and a primer set.

[0026] In one embodiment, the kit further comprises reagents for purifying products after PCR amplification, and purification is required after PCR amplification.

[0027] In one embodiment, in the kit, the third-generation sequencing library construction reagents include end repair enzymes, adapters, ligases, DNA purification magnetic beads, reaction buffers and exonucleases.

[0028] In one embodiment, the third generation sequencing is selected from Nanopore sequencing of ONT, and those skilled in the art may also select PacBio sequencing of Pacific Biosciences.

[0029] A method for detecting FMR1 genotype comprises the following steps:

[0030] 1) using the primer set and PCR amplification reagent to perform PCR amplification on the sample to obtain a long DNA fragment containing the (CGG)n repeat sequence in the 5' non-coding region of the FMR1 gene;

[0031] 2) Purify the PCR amplification product;

[0032] 3) Use the third-generation sequencing library construction reagent to convert the purified PCR amplification product into a sequencing library;

[0033] 4) Sequencing the sequencing library using a third-generation sequencing platform;

[0034] 5) Perform bioinformatics analysis on the sequencing data to determine the number of CGG repeats in the FMR1 gene, identify AGG insertions, and detect SNVs and Indels.

[0035] The bioinformatics analysis includes aligning the sequencing data with the reference sequence to determine the number of CGG repeats, the location and number of AGG insertions, and the location and type of SNVs and Indels.

[0036] The method is applicable to the detection of biological samples such as blood, saliva, and tissue.

[0037] Compared with the prior art, the present invention has the following outstanding advantages and technical effects:

[0038] 1. The present invention can simultaneously detect multiple key information such as the number of CGG repeats, AGG insertions, SNVs, Indels, etc. of the FMR1 gene, providing more comprehensive data support for clinical diagnosis and genetic counseling. Compared with traditional capillary electrophoresis and Southern blot hybridization methods, the amount of information detected is increased.

[0039] 2. The present invention effectively overcomes the deficiencies of the prior art in detecting SNVs, Indels and AGG insertions by combining specially designed primers with third-generation sequencing technology, thereby improving the accuracy of the detection results.

[0040] 3. The kit of the present invention is relatively optimized in sample processing and detection process. Compared with the additional costs caused by repeated detection or inaccurate detection in traditional methods, it has potential cost advantages when applied on a large scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 : Results of Nanopore sequencing, PCR-CE and CAFXS methods for detecting different FMR1 genotype standards. AB: Results of Nanopore sequencing method for detecting N1 / P2 (29 / 53, 9A9A9 / none); C: Results of PCR-CE method for detecting N1 / P2 (29 / 54); D: Results of CAFXS method for detecting N1 / P2 (29 / 54, 9A9A9 / none); EF: Results of Nanopore sequencing method for detecting N1 / P5 (29 / 54, 9A9A9 / 11A42); G: Results of PCR-CE method for detecting N 1 / P5 (29 / 55) result diagram; H: CAFXS method detection N1 / P2 (29 / 55, 9A9A9 / 11A43) result diagram; IJ: Nanopore sequencing method detection P3 (30 / 53 / 66, 10A9A9 / none / none) result diagram; K: PCR-CE method detection P3 (30 / 54 / 67) result diagram; L: CAFXS method detection P3 (30 / 67, 10A9A9 / none) result diagram; MN: N Nanopore sequencing method to detect NA06968 (33 / 110, 9A23 / none) results; O: PCR-CE method to detect NA06968 (33 / 111) results; P: CAFXS method to detect NA06968 (33 / 113, 9A23 / none) results; QR: Nanopore sequencing method to detect P4 (30 / 155, 10A9A9 / none) results; S: PCR-CE method to detect P4 ( 30 / 156) result graph; T: CAFXS method detection result graph of P4 (30 / 153, 10A9A9 / none); UV: Nanopore sequencing method detection result graph of NA20239 (20 / 203, 10A9 / 9A9A183); W: PCR-CE method detection result graph of NA20239 (20 / >200); X: CAFXS method detection result graph of NA20239 (20 / 202, 10A9 / 9A9A182).

[0042] Figure 2:Nanopore sequencing results of 10 samples and 100 samples tested simultaneously. A: electrophoresis of normal sample amplification products with DNA tag sequences SEQ ID NO: 3-12 added to the 5' end of upstream and downstream primers respectively; BG: respectively represent the results of simultaneous detection after the standard products N1 / P2, N1 / P5, P3, NA06968, P4, NA20239 were mixed with the purified PCR products of 4 normal samples in equal amounts; HM: respectively represent the results of simultaneous detection after the purified PCR products of the standard products N1 / P2, N1 / P5, P3, NA06968, P4, NA20239 were mixed with the purified PCR products of 4 normal samples at a ratio of 1% each (23.5% for each normal sample, 94% for the 4 normal samples in total). DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the following embodiments will further illustrate the present invention in conjunction with the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. On the contrary, the present invention covers any substitution, modification, equivalent method and scheme made on the essence and scope of the present invention as defined by the claims.

[0044] Example 1: FMR1 genotype detection was performed using the kit of the present invention in combination with Nanopore sequencing.

[0045] Experimental materials: Prepare the kit for detecting FMR1 genotype of the present invention, which contains specific primers (nucleotide sequences such as SEQ ID NO: 1-2) and DNA tags at the 5' end of the primers (nucleotide sequences such as SEQ ID NO: 3-12). In addition, the following reaction system (50 μL system) is also required: 1×Expand Long Template buffer 2 (Roche Diagnostics, Cat#11681842001), 3.75U Expand Long Template Enzyme mix (Roche Diagnostics, Cat#11681842001), 2.2 mol / L betaine (SIGMA-Aldrich, Cat#B0300-5VL), 0.5 mmol / L dNTPs (Takara, Cat#4030N), 0.33 mmol / L upstream and downstream primers with Barcode at the 5' end, and 50 ng template DNA.

[0046] Equipped with a well-performing and calibrated PCR amplifier for precise control of reaction temperature and time; Tiangen TIANquick Midi Purification Kit (Tiangen, Cat#DP204-02) for PCR product purification; related reagents and equipment required for construction of Nanopore sequencing library, such as UltraⅡEnd-prep reaction buffer, UltraⅡEnd-prep enzyme mix (New England Biolabs, Cat#E7546S), etc.; as well as Nanopore sequencer (Oxford Nanopore Technologies, MinION) and Qubit 3 Fluoromter (ThermoFisher, Cat#Q33216) for determining DNA concentration.

[0047] Step 1: PCR amplification

[0048] PCR amplification: Prepare a 50 μL reaction system and add the above reagents in sequence.

[0049] On the PCR instrument, amplify according to the conditions shown in Table 1:

[0050] Table 1. PCR amplification program

[0051]

[0052] Step 2: PCR product purification

[0053] Take 45 μL of PCR product and purify it using Tiangen TIANquick Midi Purification Kit (Tiangen, Cat# DP204-02) according to the instructions. First, add an appropriate amount of binding solution to allow the PCR product to fully bind to the magnetic beads, remove impurities by magnetic separation, then wash the magnetic bead-DNA complex with 70% ethanol, and finally add 30 μL ddH2O to elute to obtain the purified PCR product. After elution, take 1 μL to determine the concentration. When testing multiple samples, take an equal amount of purified PCR products and mix them to 80 ng. The DNA tag sequences at the 5' end of the upstream and downstream amplification primers of each sample are different, and a mixed sample is prepared for subsequent library construction.

[0054] Step 3: Construct Nanopore sequencing library

[0055] (1) End repair

[0056] Prepare the end repair system according to Table 2:

[0057] Table 2. End repair system

[0058]

[0059] On a PCR instrument, the reaction was carried out under the following conditions: 20°C for 5 min; 65°C for 5 min. This will make the ends of the PCR product flat and suitable for subsequent adapter ligation.

[0060] (2) Adding adapters and purification

[0061] After the end repair reaction is completed, add 25 μL Ligation Buffer (LNB), 10 μL NEBNext QuickT4 DNA Ligase (New England Biolabs, Cat#E6056L), and 5 μL Adapter Mix F (AMX-F), and incubate at room temperature for 10 min to connect the adapter to the PCR product. Then take 80 μL magnetic beads (Agencourt AMPure XP Beads, Beckman Coulter, Cat#A63880) and add them to the reaction solution. Incubate at room temperature and 25 r / min for 5 min; remove impurities such as unconnected adapters by magnetic separation. After centrifugation, place the sample on a magnetic stand and discard the supernatant. Add 250 μL ShortFragment Buffer (SFB), resuspend the magnetic beads and discard the supernatant. Repeat the purification once. After the magnetic beads are dried (about 30 seconds), the DNA is eluted with 15 μL Elution Buffer. The resulting DNA eluate is the target DNA Nanopore sequencing library. The DNA concentration is measured on a Qubit 3 Fluoromter (ThermoFisher, Cat# Q33216) using Qubit dsDNAHS reagent (Ecosai, Cat# NGS00-3013).

[0062] Step 4: Nanopore sequencing and analysis

[0063] According to the total concentration of the library, 20 ng of the library was prepared with the binding reagent (Oxford Nanopore Technologies, Cat# SQK-LSK110) according to the system shown in Table 3 to prepare the final library that can be used on the machine. The sequencing was performed on the machine according to the instructions of the chip (Oxford Nanopore Technologies, MinION) manufacturer.

[0064] Representative sequencing results are shown in Figure 1 As shown, Figure 1 AB and Figure 1EF in the figure represents the sequencing results of the "intermediate state" samples (CGG repeat numbers are 29 / 53 and 29 / 54). By comparing and analyzing the sequencing data, the CGG repeat numbers and AGG insertions of the samples can be clearly determined (N1 / P2: 9A9A9 / none, N1 / P5: 9A9A9 / 11A42). Figure 1 IJ in Figure 1 MN in Figure 1 The QR in the figure indicates the sequencing results of premutation carrier samples P3, NA06968, and P4 (CGG repeat numbers are 30 / 66, 33 / 110, and 30 / 155, respectively), and presents the insertion of AGG in the premutation state (P3: 10A9A9 / none / none, NA06968: 9A23 / none, P4: 10A9A9 / none). Figure 1 The UV in the figure indicates the sequencing result of the full mutation carrier sample NA20239 (CGG repeat number is 20 / 203), which clearly shows the insertion of AGG in the full mutation state (10A9 / 9A9A183).

[0065] This example uses a PCR-CE-based method (Asuragen and Biofast kits) and a long-read sequencing-based CAFXS method (Beijing Berry Genomics Co., Ltd. kit) as controls. The results are as follows: Figure 1 As shown, Figure 1 C, G, K, O, S, and W represent the capillary electrophoresis results of samples N1 / P2, N1 / P5, P3, NA06968, P4, and NA20239, which are from the kits of Asuragen and Biofast, respectively. Figure 1 D, H, L, P, T and X in the figure represent the CAFXS method result diagrams of samples N1 / P2, N1 / P5, P3, NA06968, P4 and NA20239 respectively. By comparison, it is found that the detection effect of the kit of the present invention on FMR1 genotype is better than that of the PCR-CE method and is equivalent to that of CAFXS. This shows that the kit of the present invention has high accuracy and reliability in detecting FMR1 genotype and can accurately distinguish different types of FMR1 genotype samples.

[0066] Table 3. Nanopore sequencing system

[0067]

[0068] * If the volume is less than 75 μL, add Elution Buffer to make up to 75 μL.

[0069] Example 2: Clinical samples were tested using the kit of the present invention in combination with Nanopore sequencing.

[0070] Peripheral blood genomic DNA of 10 subjects was collected as a validation sample to ensure that the sample collection process was standardized and the sample quality met the experimental requirements. Referring to Example 1, the kit of the present invention was used to simultaneously detect the FMR1 genotype of 10 samples. First, different DNA tags in SEQ ID NO: 3 to SEQ ID NO: 12 were added to the 5' end of the amplification primers of the 10 samples. Amplification was performed according to the PCR amplification reaction system and procedure in Example 1 to ensure that the FMR1 gene fragment of each sample was effectively amplified. After PCR amplification, the product was purified in the same manner as in Example 1, using the Tiangen TIANquick MidiPurification Kit for purification. After PCR purification, the library was constructed by mixing the PCR products of the 10 samples, and the library was constructed according to the method for constructing a Nanopore sequencing library in Example 1, including end repair, adding a linker and purification, to obtain a library for Nanopore sequencing. The sequencing results were analyzed, and the detection results of the CAFXS method based on long read sequencing (Beijing Berry Genomics Biotechnology Co., Ltd.) were used as a control. The comparison results are shown in Table 4.

[0071] Table 4. Test results of 10 samples

[0072]

[0073] As can be seen from Table 4, for the CGG repeat number and AGG insertion of each sample, the test results of the kit of the present invention are highly similar to those of the CAFXS method (Berry). The CGG repeat number of sample 1 was 36 / 151 detected by the kit of the present invention, and 36 / 153 detected by the CAFXS method; the AGG insertion was 9A9A6A9 / 9A141 detected by the kit of the present invention, and 9A9A6A9 / 9A143 detected by the CAFXS method. The test results of other samples also showed similar consistency. The experiment showed that the kit of the present invention accurately analyzed the FMR1 genotypes of 10 samples, which was basically consistent with the results of the control method. The accuracy and reliability of the kit of the present invention in clinical sample detection were verified.

[0074] Example 3: Using the kit of the present invention in combination with Nanopore sequencing to achieve simultaneous detection of multiple samples

[0075] Six standard samples were selected, including N1 / P2, N1 / P5, P3, NA06968, P4, NA20239, and four normal samples. DNA was extracted and purified from these samples to ensure sample quality. Referring to Example 1, it was simulated whether the kit of the present invention can simultaneously detect the FMR1 genotypes of 10 samples and 100 samples. PCR amplification was performed on the six standard samples and the four normal samples, respectively. During the amplification process, different DNA tags were added to the 5' end of the primer of each sample. After the amplification was completed, the PCR product was purified using the TIANquick Midi Purification Kit to obtain a purified PCR product.

[0076] Equal mixing experiment: The purified PCR products of 6 standard samples were mixed with the purified PCR products of 4 normal samples in equal amounts. After mixing, the end repair, linker addition, purification and other steps were performed according to the method for constructing a Nanopore sequencing library in Example 1 to construct a library for Nanopore sequencing.

[0077] Low ratio mixing experiment: The purified PCR products of 6 standards were mixed with the purified PCR products of 4 normal samples at a ratio of 1% each, and the 4 normal samples accounted for 94% in total (23.5% for each normal sample). The library for Nanopore sequencing was constructed according to the above library construction method.

[0078] Nanopore sequencing and analysis: The libraries constructed by the two mixed methods were sequenced on a Nanopore sequencer respectively according to the sequencing operation method in Example 1. The sequencing results were analyzed to observe whether the FMR1 genotypes of different samples could be accurately detected.

[0079] The Nanopore sequencing results of 10 samples and 100 samples tested simultaneously are shown in the figure below. Figure 2 As shown, in Figure 2 In A, the electrophoresis diagram of the amplification products of normal samples in which the DNA tag sequences SEQ ID NO: 3-12 are added to the 5' ends of the upstream and downstream primers, respectively, verifies the effectiveness of the primers and the amplification reaction. Figure 2 BG in the figure shows the results of simultaneous testing after equal amounts of purified PCR products of standards N1 / P2, N1 / P5, P3, NA06968, P4, and NA20239 were mixed with four normal samples. Through the analysis of sequencing data, the FMR1 genotype characteristics of different samples can be accurately distinguished, and the CGG repeat number of each standard can be clearly presented without obvious signal interference or misjudgment. Figure 2HM in the figure shows the results of simultaneous testing after the purified PCR products of the standard were mixed with the purified PCR products of 4 normal samples at a ratio of 1% per case. Even if the proportion of the standard in the mixed sample is low, the genotype of the standard can still be accurately identified through sequencing results.

[0080] Experiments show that the kit of the present invention can successfully detect all abnormally amplified FMR1 alleles in the wild-type background. After comparison with the control method, it is confirmed that the kit of the present invention has extremely high accuracy in FMR1 genotype detection. At the same time, the kit of the present invention can detect 100 or even more samples at the same time, with low cost for single sample detection and simple operation, which is more suitable for large-scale population screening.

[0081] It should be understood that although the present invention has been described exemplarily according to its preferred embodiments, it should not be limited to the above embodiments. For those skilled in the art, the present invention may have various modifications and variations. The reaction reagents, reaction conditions, etc. involved in the PCR reaction and the construction of the third-generation sequencing library can be adjusted and changed accordingly according to specific needs. Therefore, for those skilled in the art, several simple substitutions can be made without departing from the concept and principle of the present invention, which should all be included in the scope of protection of the present invention.

Claims

1. A primer set for detecting FMR1 genotype, characterized in that: The primer set includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in the sequence listing SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown in the sequence listing SEQ ID NO:

2.

2. A primer set for detecting FMR1 genotype according to claim 1, characterized in that: The 5' end of the forward primer and / or the reverse primer is connected with an artificial DNA tag.

3. A primer set for detecting FMR1 genotype according to claim 2, characterized in that: The nucleotide sequence of the artificial DNA tag is selected from at least any one of the sequences in the sequence list SEQ ID NO: 3 to SEQ ID NO:

12.

4. A primer set for detecting FMR1 genotype according to any one of claims 1 to 3, characterized in that: The primer set is used for PCR amplification to obtain a long DNA fragment containing a (CGG)n repeating sequence in the 5' non-coding region of the FMR1 gene.

5. A kit for detecting FMR1 genotype, characterized in that: It comprises the primer set described in any one of claims 1 to 3, as well as PCR amplification reagents and third-generation sequencing library construction reagents.

6. A kit for detecting FMR1 genotype according to claim 5, characterized in that: The PCR amplification reagent includes DNA polymerase, a reaction buffer and the primer set.

7. A kit for detecting FMR1 genotype according to claim 5, characterized in that: Also included are reagents for purification of PCR products after amplification.

8. A kit for detecting FMR1 genotype according to claim 5, characterized in that: The third-generation sequencing library construction reagents include end repair enzymes, adapters, ligases, DNA purification magnetic beads, reaction buffers and exonucleases.

9. A kit for detecting FMR1 genotype according to claim 5, characterized in that: The kit is used to detect the number of CGG repetitions, the insertion of AGG, SNVs and Indels of the FMR1 gene.

Images