Fully premixed fluorescent PCR kit and stabilizer

Abstract

The invention discloses a fully premixed fluorescent PCR (polymerase chain reaction) kit and a stabilizer, the stabilizer comprises histidine and a Taq enzyme aptamer, the concentration of the histidine is 0.01-0.05 M, the concentration of the Taq enzyme aptamer is 1-20 nM, and the stabilizer further comprises at least one of NaCl, Tween-20 and trehalose. The invention discloses a PCR (Polymerase Chain Reaction) premixed solution containing the stabilizing agent, and a full-premixed fluorescent PCR kit. The stabilizer disclosed by the invention is simple to prepare, does not need to be freeze-dried, and can ensure that the sensitivity of the full-premixed fluorescent PCR kit is not reduced after the full-premixed fluorescent PCR kit is stored at 37 DEG C for 7 days and freeze-thaw for 3 times or stored at-20 DEG C for 12 months.

Description

Technical Field

[0001] The present invention relates to the field of PCR technology, in particular to a fully premixed fluorescent PCR kit and a stabilizer. Background Art

[0002] Fluorescence PCR technology has been widely used in many fields such as biological research, medical diagnosis, food safety, etc. due to its high sensitivity, high specificity and rapid result output. In addition, for ease of use, quite a few commercial companies manufacture fluorescent PCR kit products, of which there are three categories. One category is to separate the PCR reaction solution and the enzyme mix into two components. When using, the dosage needs to be calculated in proportion and mixed, which is more cumbersome and has the possibility of misoperation; the second category is to pack and freeze-dry the fluorescent PCR reaction solution, and add water to dissolve it when using it. The disadvantage is that special freeze-drying equipment is required, the process is complicated, the overall cost is high, and it is not suitable for long-term storage after re-dissolution. Therefore, it is mostly used in microfluidic chips or card boxes for one-time use; the third category is to place all the components of the fluorescent PCR reaction solution in one tube, that is, a fully premixed kit, which is more convenient to use and has a lower cost. However, the fully premixed fluorescent PCR kit has stability problems during long-term storage, and the sensitivity will decrease, which limits its application to a certain extent. The present invention mainly solves the stability problem of decreased sensitivity when the fully premixed fluorescent PCR kit is stored.

[0003] Patent application CN114934107A discloses a multiplex reverse transcription fluorescent PCR premixed reaction solution that can be frozen for storage. Its stabilizer is a metal ion chelator, which is less innovative and mainly evaluates whether the Ct value changes during long-term frozen storage. The detection performance of samples with detection limit concentration is not evaluated. Summary of the invention

[0004] The purpose of the present invention is to provide a fully premixed fluorescent PCR kit and a stabilizer to solve the stability problem of the sensitivity reduction of the fully premixed fluorescent PCR kit during long-term storage. The stabilizer applied to the fully premixed fluorescent PCR kit of the present invention is simple to prepare and does not require freeze-drying. The fully premixed fluorescent PCR kit can be stored at 37°C for 7 days and frozen and thawed 3 times, or stored at -20°C for 12 months without reducing sensitivity, and is applicable to hot-start Taq enzymes from multiple suppliers. The reason why the stability of the fully premixed fluorescent PCR kit decreases during long-term storage has not yet been determined. Some people believe that the 5' exonuclease activity of the Taq enzyme removes the 5' fluorescent probe group during storage, and some people believe that the fluorescent group is unstable and degraded during long-term storage. The present invention believes that the main factor is not this, but when the primer probe is stored together with the hot-start Taq polymerase, the high concentration of primers competes for the binding of the anti-Taq enzyme antibody to the Taq enzyme, resulting in a small number of antibodies being displaced, and this part of the antibody is separated from the binding state with the Taq enzyme and becomes easy to denature. This process is repeated during long-term storage and freezing and thawing, which will cause a considerable proportion of anti-Taq enzyme antibodies to denature, and ultimately more primers can bind to the Taq enzyme and initiate non-specific amplification, thereby causing a decrease in reaction sensitivity. The core of the present invention is to use components such as histidine to protect antibodies in combination with Taq enzyme aptamers, so that the sensitivity of the kit does not decrease when it is stored at 37°C for 7 days and frozen and thawed 3 times, or stored at -20°C for 12 months.

[0005] The objective of the present invention is achieved through the following technical solutions:

[0006] In a first aspect, the present invention provides a stabilizer for a fully premixed fluorescent PCR kit, comprising histidine and a Taq enzyme adaptor.

[0007] As some specific embodiments of the present invention, the concentration of histidine is 0.01M-0.05M.

[0008] As some specific embodiments of the present invention, the concentration of the Taq enzyme aptamer is 1nM-20nM.

[0009] As some specific embodiments of the present invention, the Taq enzyme adaptor has a nucleotide sequence as shown in SEQ ID NO.1 (CAAGACGGGCGGGTGTGGTAGGCGCCCGTG).

[0010] As some specific embodiments of the present invention, the stabilizer further includes at least one of NaCl, Tween-20, and trehalose.

[0011] As some specific embodiments of the present invention, the concentration of NaCl is 0.05M-0.15M;

[0012] And / or, the volume fraction of Tween-20 is 0.5‰-10‰;

[0013] And / or, the concentration of trehalose is 0.1M-0.5M.

[0014] In a second aspect, the present invention provides a PCR premix, comprising any of the stabilizers described above, and further comprising an antibody-blocked hot-start Taq polymerase, UNG enzyme, Mg 2+ and dNTPs.

[0015] As some specific embodiments of the present invention, the concentration of the antibody-blocked hot-start Taq polymerase is 0.05-0.15 U / μL;

[0016] and / or, the concentration of the UNG enzyme is 0.01-0.1 U / μL;

[0017] And / or, the Mg 2+ The concentration is 2-5mM;

[0018] And / or, the concentration of the dNTPs is 200-400 μM.

[0019] As some specific embodiments of the present invention, the PCR premix is ​​prepared with a Tris-HCl buffer with a pH of 8.5-8.8 and a concentration of 5-50 mM.

[0020] In a third aspect, the present invention provides a fully premixed fluorescent PCR kit, comprising a PCR full premix solution, wherein the PCR full premix solution includes any of the PCR premix solutions described above, and also includes PCR primers and probes.

[0021] The present invention does not limit the sequences of PCR primers and probes, and any primers and probes used for PCR reactions can achieve the purpose of the present invention.

[0022] As some specific embodiments of the present invention, the PCR primers and probes include at least one of primers and probes for detecting African swine fever P72 gene, primers and probes for detecting porcine actin gene, and primers and probes for detecting porcine circovirus type 2 gene.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The stabilizer of the present invention is simple to prepare and does not require freeze-drying. It can store the fully premixed fluorescent PCR kit at 37°C for 7 days and freeze-thaw 3 times, or store it at -20°C for 12 months without reducing the sensitivity, and is applicable to hot-start Taq enzymes from multiple suppliers. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0026] Figure 1 The PCR amplification curve of the mixed plasmid of African swine fever P72 gene and porcine actin gene by the reaction solution of Group 1 and Group 5 in Example 1;

[0027] Figure 2 The PCR amplification curve of the mixed plasmid of African swine fever P72 gene and porcine actin gene by the reaction solutions of Group 2 and Group 5 in Example 1;

[0028] Figure 3 The PCR amplification curve of the mixed plasmid of African swine fever P72 gene and porcine actin gene by the reaction solutions of Group 3 and Group 5 in Example 1;

[0029] Figure 4 The PCR amplification curve of the mixed plasmid of African swine fever P72 gene and porcine actin gene by the reaction solutions of Group 4 and Group 5 in Example 1;

[0030] Figure 5 The PCR amplification curves of Example 2 for detecting low-concentration mixed plasmids stored at 37°C and -20°C;

[0031] Figure 6 This is the PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration under normal freezing storage at -20°C in Example 3;

[0032] Figure 7 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration after being stored at 37° C. for 7 days and subjected to 3 freeze-thaw cycles in Example 3;

[0033] Figure 8 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration of the reaction solution 1 in Example 4 stored at 37° C. and −20° C.;

[0034] Fig. 9 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration stored at 37° C. and −20° C. in the reaction solution 2 in Example 4;

[0035] Fig.10 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration of the reaction solution 3 in Example 4 stored at 37° C. and −20° C.;

[0036] Fig.11 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration of reaction solution 4 in Example 4 stored at 37° C. and −20° C.;

[0037] Fig.12 The PCR amplification curve of the porcine circovirus type 2 genome plasmid at the detection limit concentration of the reaction solution 5 in Example 4 stored at 37° C. and −20° C.;

[0038] Fig.13 The PCR amplification curve of the reaction solution prepared by using the hot start Taq enzyme and stabilizer of Yisheng Bio in Example 5 to detect the mixed plasmids of African swine fever P72 gene and porcine actin gene of different concentrations;

[0039] Fig.14 The PCR amplification curves of the reaction solution prepared by Takara's hot start Taq enzyme and stabilizer and other components in Example 5 for detecting mixed plasmids of African swine fever P72 gene and porcine actin gene of different concentrations;

[0040] Fig.15 This is the PCR amplification curve of the reaction solution prepared with the hot-start Taq enzyme and stabilizer of Bio-Tech in Example 5 to detect mixed plasmids of African swine fever P72 gene and porcine actin gene of different concentrations. DETAILED DESCRIPTION

[0041] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0042] Example 1 Stabilizer formulation screening

[0043] 1. Prepare basic fluorescent PCR reaction solution:

[0044] It contains 10mM Tris-HCl (pH8.8), 50mM KCl, 250nM dNTPs, 4mM MgCl2, 0.1U / μL EXTaq hot-start PCR enzyme (Takara RR006, a mixture of anti-Taq monoclonal antibody and TaKaRa Ex Taq, i.e., antibody-blocked hot-start Taq polymerase), 0.02U / μL UNG enzyme (Takara 2820), 1‰ (v / v) Tween 20, 400nM African swine fever P72 gene primer, 200nM African swine fever P72 gene probe, 400nM porcine actin gene primer, and 200nM porcine actin gene probe.

[0045] The primer and probe sequences for the African swine fever P72 gene and porcine actin gene are as follows:

[0046] (1) Primer sequence of African swine fever P72 gene:

[0047] Forward primer: 5'-GATTGGCACAAGTTCGGACA-3' (SEQ ID NO. 2),

[0048] Reverse primer: 5'-AGATATAGATGAACATGCGTCTGG-3' (SEQ ID NO. 3);

[0049] Probe sequence of African swine fever P72 gene:

[0050] 5'-CCTGAAAGCTTATCTCTGCGTGGT-3' (SEQ ID NO. 4).

[0051] The probe sequence of the African swine fever P72 gene carries a FAM fluorescent group at the 5' end and a BHQ1 quenching group at the 3' end.

[0052] (2) Primer sequence of porcine actin gene:

[0053] Forward primer: 5'-GGAAGGACCTCTACGCCAAC-3' (SEQ ID NO. 5),

[0054] Reverse primer: 5'-GTGATCTCCTTCTGCATCCTGT-3' (SEQ ID NO. 6);

[0055] Probe sequence of porcine actin gene:

[0056] 5'-ACCACCATGTACCCCGGCATC-3' (SEQ ID NO. 7).

[0057] The probe sequence of the porcine actin gene carries a VIC fluorescent group at the 5' end and a BHQ1 quenching group at the 3' end.

[0058] 2. Prepare 5 sets of fluorescent PCR reaction solutions according to the method shown in Table 1 below:

[0059] Table 1 Preparation of fluorescent PCR reaction solution

[0060]

[0061] 3. Fluorescence quantitative PCR detection

[0062] The mixed plasmids of African swine fever P72 gene (sequence is GenBank: FR682468.1 (103590..105530), connected to PUC57 vector through blunt ends, synthesized by Sangon Biotechnology) and porcine actin gene (sequence is GenBank: AY550069.1, connected to PUC57 vector through blunt ends, synthesized by Sangon Biotechnology) were tested with final concentrations of 100 copies / μL and 10 copies / μL respectively.

[0063] Take 15 μL of the reaction solution in group 1-group 5, add 5 μL of template (including the above mixed plasmid) to prepare the PCR reaction system, and perform the fluorescence quantitative PCR reaction in the ABI7500 fast fluorescence quantitative PCR instrument, repeating twice. The PCR amplification conditions are: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds, 60℃ annealing for 30 seconds, a total of 40 cycles. Collect the fluorescence of FAM and VIC channels.

[0064] 4. Amplification results:

[0065] PCR was performed in 5 groups of experiments, and the amplification curves were shown in Figure 1-4 Compared with the control group, the freshly prepared basic reaction solution group 5, the amplification curve of group 1 stored at 37°C for 3 days was poor ( Figure 1 ); After adding histidine, the amplification curve of group 2 was significantly improved compared with group 1 ( Figure 2 ); Group 3 added working concentration of Taq enzyme aptamer, but did not show the synergistic effect between Taq enzyme aptamer and anti-Taq enzyme antibody, and the amplification curve was still poor ( Figure 3 ); Group 4 is group 1 with additional anti-Taq enzyme antibody added after storage at 37°C, and the amplification curve is significantly improved ( Figure 4 ).

[0066] Based on the above results, it can be inferred that the decrease in sensitivity caused by storage at 37°C is related to the denaturation of anti-Taq enzyme antibodies. Therefore, supplementing anti-Taq enzyme antibodies and adding histidine to protect antibodies can improve the amplification curve. However, when Taq enzyme aptamers and antibody-blocked hot-start Taq enzymes are used together to prepare a fully premixed fluorescent PCR reaction solution, the stability is significantly reduced. This should be because the Taq enzyme aptamers and anti-Taq enzyme antibodies compete to bind to the Taq enzyme, and some antibodies aggregate and denature after detaching from the Taq enzyme, resulting in insufficient blocking of Taq enzyme activity. Finally, the sensitivity of the fluorescent PCR reaction is significantly reduced. The hot-start effect mainly comes from the Taq enzyme aptamers rather than the Taq enzyme antibodies. The primer probes added to the ordinary fully premixed fluorescent PCR reaction solution will also have an effect similar to that of the Taq enzyme aptamers. Although their affinity with the Taq enzyme is not as good as that of the Taq enzyme aptamers, they will also replace antibodies during long-term storage and cause stability problems such as decreased sensitivity.

[0067] Example 2 Stabilizer Performance Test

[0068] In this experiment, histidine was added to the fluorescent PCR reaction solution. Histidine is used as an antibody stability protectant in a variety of antibody drugs; NaCl was added to increase the ionic strength, and higher ionic strength also helps to increase antibody stability; detergent Tween20 and trehalose were also added as enzyme and protein stabilizers. The combined use of these agents significantly enhanced the stability of the fluorescent PCR reaction solution.

[0069] Reaction solution preparation: 20 mM histidine, 12% (w / w) trehalose, and 0.1 M NaCl were additionally added to the basic reaction solution formula of Example 1. The test was performed after being stored at -20°C for 7 days and 37°C for 7 days, respectively, and the test was repeated twice. The test template and PCR amplification reaction conditions were the same as in Example 1.

[0070] The results are as follows Figure 5 As shown in Table 2, the amplification results of the two low-concentration mixed plasmid samples (the concentrations of African swine fever P72 gene and porcine actin gene were both 10 copies / μL) were still good when stored at 37°C for 7 days, and the amplification Ct value did not increase compared with the storage at -20°C for 7 days.

[0071] Table 2 Amplification Ct value results of two storage conditions

[0072] aisle Store at -20℃ for 7 days Store at 37℃ for 7 days FAM 32.87 32.30 FAM 36.13 35.10 VIC 31.99 31.37 VIC 34.14 34.89

[0073] Example 3 Testing stability based on detection limit level

[0074] 1. Prepare PCR reaction solution for porcine circovirus type 2 detection:

[0075] The formula includes 10mM Tris-HCl (pH8.8), 50mM KCl, 250nM dNTPs, 4mM MgCl2, 0.1U / μL EX Taq hot start PCR enzyme (Takara RR006), 0.02U / μL UNG enzyme (Takara 2820), 1‰ (v / v) Tween20, 20mM histidine, 12% trehalose, 0.1M NaCl. The primer probe is 300nM porcine circovirus type 2 primer and 150nM probe.

[0076] Porcine circovirus type 2 primer sequences:

[0077] Forward primer: 5'-GGAGTCTGGTGACCGTTGC-3' (SEQ ID NO.8)

[0078] Reverse primer: 5'-CCAATCACGCTTCTGCATTTT-3' (SEQ ID NO.9)

[0079] Porcine circovirus type 2 probe sequence:

[0080] 5'-CCGCTCACTTTCAAAAGTTCAGCCA-3'(SEQ ID NO.10)

[0081] The 5' end of the porcine circovirus type 2 probe sequence carries a FAM fluorescent group, and the 3' end carries a BHQ1 quenching group.

[0082] 2. Fluorescence quantitative PCR detection

[0083] The kit (PCR reaction solution prepared in step 1) was stored at 37°C for 7 days, frozen for 4 hours at 1 day, 3 days, and 5 days respectively, and then placed at 37°C. 15 μL of the reaction solution was added with 5 μL of the template for testing, that is, the porcine circovirus type 2 genome (sequence NC_006232.1, connected to the PUC57 vector through blunt ends, synthesized by Sangon Biotechnology) plasmid with a detection limit concentration (1 copy / μL) was tested 10 times, and the kit was tested at -20°C for normal freezing for 7 days for comparison.

[0084] PCR reaction: The reaction was carried out in an ABI7500 fast fluorescence quantitative PCR instrument. The PCR amplification conditions were: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 5 seconds, 60°C annealing for 30 seconds, for a total of 40 cycles. The fluorescence of the FAM channel was collected.

[0085] 3. Test results

[0086] The test results of the test kit stored normally at -20℃ are as follows Figure 6 As shown in Figure 1, when the porcine circovirus type 2 genome plasmid sample with a detection limit concentration (1 copy / μL) was tested 10 times, the kit normally frozen and stored at -20°C was able to detect it in 10 tests; the test results of the kit stored at 37°C for 7 days and frozen and thawed 3 times were as follows Figure 7 As shown in the figure, only 3 out of 10 tests can detect it. Therefore, the stability of the current formula is still slightly insufficient, and the sensitivity is slightly reduced during the pressure test. It may be that the blocking effect of the antibody is still reduced under this condition.

[0087] Example 4: Stability retest based on detection limit level

[0088] Five reaction solutions were prepared according to the reagent formula shown in Table 3, and they were stored at 37°C for 7 days, respectively. They were frozen for 4 hours at 1 day, 3 days, and 5 days, and then placed at 37°C. According to the detection method of Example 3, 15 μL of each reaction solution was added to 5 μL of template for testing, and the porcine circovirus type 2 genome plasmid with a detection limit concentration (1 copy / μL) was repeatedly tested 10 times, and a kit for each of the five reaction solutions was kept at -20°C for normal freezing and storage for 7 days for comparison testing.

[0089] Table 3 Reagent formula

[0090] Reaction solution 1 The formula is the same as in Example 3 Reaction solution 2 Add 5 nM Taq enzyme adapter to reaction solution 1 Reaction solution 3 Prepared using commercially available PCR mix (Premix Ex Taq (Probe qPCR), Takara R390) Reaction solution 4 Prepared with commercial PCRmix that supports full premixing (Yisheng 11827) Reaction solution 5 Replace 20 mM histidine in reaction solution 2 with 20 mM arginine

[0091] The test results of reaction solution 1 are shown in Figure 8 The reaction solution stored at -20℃ could be detected in 10 tests, while the reaction solution stored at 37℃ and frozen and thawed 3 times could be detected only 4 times out of 10 tests; the test results of reaction solution 2 are shown in Fig. 9 The reaction solution stored at -20℃ was tested 10 times and all the samples were detected. The reaction solution stored at 37℃ and frozen and thawed 3 times was also tested 10 times and all the samples were detected. The test results of reaction solution 3 are shown in Fig.10 The reaction solution stored at -20℃ could be detected 10 times, and the reaction solution stored at 37℃ and frozen and thawed 3 times could not be detected 10 times; the test results of reaction solution 4 are shown in Fig.11 The reaction solution stored at -20℃ could be detected 10 times, while the reaction solution stored at 37℃ and frozen and thawed 3 times could be detected only 2 times; the test results of reaction solution 5 are shown in Fig.12 The reaction solution stored at -20°C could be detected 10 times, while the reaction solution stored at 37°C and frozen and thawed three times could be detected only three times.

[0092] Therefore, although the effect of adding Taq enzyme aptamers in Example 1 is poor and cannot increase stability, in this example, due to the effects of various antibodies and protein protectants such as histidine, adding a lower concentration of Taq enzyme aptamers has a better effect. After being stored at 37°C and frozen and thawed three times, the samples with the detection limit concentration can still be detected 100%. The stability is better than that of reaction solution 1, and compared with the commercial fluorescent PCR mix, the stability is not only better than that of ordinary fluorescent PCR mix, but also better than that of fluorescent PCR mix that supports full premixing. In the test of replacing histidine with arginine in reaction solution 5, although it is generally believed that arginine also has the effect of protecting proteins and antibodies, the final effect is not ideal and is not as good as histidine.

[0093] Example 5 Stability test of different Taq enzyme preparation kits

[0094] 1. Prepare fluorescent PCR reaction solution: containing 10mM Tris-HCl (pH8.8), 50mM KCl, 250nM dNTPs, 4mM MgCl2, 400nM African swine fever P72 gene primer, 200nM African swine fever P72 gene probe, 400nM porcine actin gene primer, 200nM porcine actin gene probe, 1‰ (v / v) Tween 20, 10% trehalose, 0.1M NaCl, 5nM Taq enzyme aptamer, 10mM histidine, and then add 0.1U / μL hot start Taq enzyme from three different suppliers (in this embodiment, all of them are antibody-modified hot start Taq enzymes, i.e., antibody-blocked Taq polymerase), namely, Hieff HotStart Taq DNA Polymerase(10729), Takara's Ex Hot Start Version (RR006), purchased from Bio-Tech HS Taq DNA Polymerase (SE0201) and store at -20°C for 12 months.

[0095] 2. Then test the mixed plasmids of African swine fever P72 gene and porcine actin gene at final concentrations of 1000 copies / μL, 100 copies / μL, and 10 copies / μL, take 15 μL of reaction solution and add 5 μL of template for testing, and repeat the test twice. The reaction conditions are the same as in Example 1.

[0096] 3. The results are as follows Figure 13-15 As shown, the results of Yisheng Biology are shown in Fig.13 、Takara enzyme Fig.14 、Bai Li Ge Biotech's Fig.15 The three concentrations all showed good amplification. This example shows that the stabilizer of the present invention and the hot-start Taq enzymes from three different suppliers prepared reaction solutions all had good stability, which shows that the applicability is relatively high.

[0097] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A stabilizer for a fully premixed fluorescent PCR kit, characterized in that: Includes histidine and Taq enzyme aptamers.

2. The stabilizer according to claim 1, characterized in that The concentration of histidine is 0.01M-0.05M.

3. The stabilizer according to claim 1, characterized in that The concentration of the Taq enzyme aptamer is 1 nM-20 nM.

4. The stabilizer according to claim 1, characterized in that The Taq enzyme aptamer has a nucleotide sequence as shown in SEQ ID NO.

1.

5. The stabilizer according to claim 1, characterized in that The stabilizer also includes at least one of NaCl, Tween-20 and trehalose.

6. The stabilizer according to claim 5, characterized in that The concentration of NaCl is 0.05M-0.15M; And / or, the volume fraction of Tween-20 is 0.5‰-10‰; And / or, the concentration of trehalose is 0.1M-0.5M.

7. A PCR premix, characterized in that: The stabilizer of the fully premixed fluorescent PCR kit according to any one of claims 1 to 6, and also includes an antibody-blocked hot start Taq polymerase, UNG enzyme, Mg 2+ and dNTPs.

8. The PCR premix according to claim 7, characterized in that: The concentration of the antibody-blocked hot-start Taq polymerase is 0.05-0.15 U / μL; and / or, the concentration of the UNG enzyme is 0.01-0.1 U / μL; And / or, the Mg 2+ The concentration is 2-5mM; And / or, the concentration of the dNTPs is 200-400 μM.

9. The PCR premix according to claim 8, characterized in that: The PCR premix is ​​prepared with a Tris-HCl buffer having a pH of 8.5-8.8 and a concentration of 5-50 mM.

10. A fully premixed fluorescent PCR kit, comprising a PCR fully premixed solution, characterized in that: The complete PCR premix includes the PCR premix as described in any one of claims 7 to 9, and further includes primers and probes.

Images