Linearization method for NGS sequencing, sequencing chip and sequencing method

Abstract

The invention relates to a linearization method for NGS sequencing, a sequencing chip and a sequencing method. The linearization method comprises the following steps: introducing a thiophosphate group as shown in a structure 1, a structure 2, a structure 3 or a structure 4 into an amplification primer sequence or a surface spacer sequence of a DNA primer; during linearization, a thiophosphate bond in the DNA primer is cut by using an AgNO3 solution, so that one chain in the DNA primer is broken. According to the novel linearization method, one DNA chain can be cut and removed very quickly and efficiently, the single-stranded DNA template suitable for sequencing is obtained, and the novel linearization method has the advantages of low damage to DNA, capability of obviously improving the sequencing quality, good stability and capability of keeping stable sequencing quality in actual PE (Poly Ethylene) sequencing application. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the technical field of gene sequencing, and in particular relates to a linearization method, a sequencing chip and a sequencing method for NGS sequencing. Background Art

[0002] Next-generation sequencing (NGS) technology is widely used in high-throughput genome sequencing, in which bridge amplification and linearization are key steps. Bridge amplification generates double-stranded DNA clusters on the chip surface, and the purpose of linearization is to remove one of the DNA strands and retain the other single-stranded DNA as a sequencing template (see Figure 1 ). Especially in paired-end sequencing, the linearization process has a direct impact on the accuracy and efficiency of sequencing.

[0003] Sequencing by Synthesis (SBS) is a widely used method in next-generation sequencing technology. Its principle is based on sequencing by synthesis, that is, by gradually synthesizing complementary DNA chains and detecting the introduction order of nucleotides in real time to perform base sequencing. The specific process is as follows:

[0004] (I) Sample preparation and bridge amplification: First, the DNA sample is randomly broken into shorter fragments and connected to specific primer sequences at the ends. Next, these fragments bind to the primers on the surface of the sequencing chip through primers. During the bridge amplification process, a large number of double-stranded DNA clusters are formed, which constitute the template for sequencing.

[0005] (ii) Linearization: After bridge amplification, the linearization step is used to remove one strand of the double-stranded DNA, leaving only the other single-stranded DNA fixed to the chip surface. At this point, the single-stranded DNA will serve as a sequencing template.

[0006] (III) Primer binding and DNA synthesis: Next, the sequencing primer binds to the single-stranded DNA fixed on the chip surface, and the SBS reaction begins. Fluorescently labeled nucleotides containing reversible terminators are gradually added by DNA polymerase, and only one base is added at a time. Since the terminator limits further chain extension, only one nucleotide can be added at a time.

[0007] (iv) Fluorescence signal detection: Each time a nucleotide is introduced, a fluorescent signal is released. The sequencer captures and records the fluorescent signal emitted by each cluster to determine the type of base added. Then, the terminal terminator is removed by chemical treatment to allow the next nucleotide to be added.

[0008] Repeat steps (iii) and (iv) above until the sequence is complete.

[0009] (V) Data processing and base calling: As the sequencing reaction of each cluster proceeds, the system gradually parses the base sequence in each DNA cluster by analyzing the intensity and color of different fluorescent signals to generate the final DNA sequence data.

[0010] In the above sequencing process, the efficiency of the linearization process directly affects the quality of subsequent sequencing. In the linearization step after bridge amplification, if one DNA chain can be efficiently cut off and the other chain is retained as a sequencing template, the number of available single-stranded DNA templates fixed on the chip surface will be greater. This means that in the Sequencing by Synthesis (SBS) process, there are more DNA molecules in each cluster, and the generated fluorescence signal is also stronger, thereby improving the signal intensity and signal-to-noise ratio (SNR). The signal is clearer and the baseline is more stable, which can significantly improve the accuracy of base calling. On the contrary, if the linearization efficiency is low, the number of single-stranded templates available for sequencing will be reduced, resulting in insufficient fluorescence signals generated by each cluster and a decrease in the signal-to-noise ratio. In this case, it is difficult for the sequencer to accurately distinguish different fluorescence signals, and errors are prone to occur during base calling, which in turn affects the final sequencing quality. Therefore, optimizing the linearization step is crucial to improving sequencing accuracy and reducing error rates.

[0011] There are three commonly used linearization methods:

[0012] USER enzyme excision method: This method introduces U base (uracil) into the primer on the chip surface, and then uses USER enzyme (uracil DNA glycosylase and endonuclease) to excise a DNA chain containing the U base. The USER enzyme method is currently the most efficient linearization method with the least DNA damage, and is therefore widely used in sequencing processes.

[0013] FPG enzyme excision method: This method introduces 8-oxo-G bases into the primers on the chip surface, and uses FPG enzyme (epiglucosylase) to recognize and excise the DNA chain containing this special base. Although FPG enzyme causes less damage to DNA, its efficiency in excising DNA chains on the chip surface is unstable, which will affect the uniformity and accuracy of sequencing templates in high-density cluster structures, resulting in unstable sequencing quality.

[0014] Sodium periodate chemical cleavage method: The third method is chemical cleavage, which introduces diol functional groups into oligonucleotide primers and fixes the primers on the chip surface. During linearization, the chip surface is treated with sodium periodate, which can cut diols and thus remove a DNA chain. Although this method has a high cutting efficiency, sodium periodate, as a strong oxidant, can cause significant damage to DNA, affecting the accuracy of sequencing and data quality.

[0015] It can be seen that the above three methods each have their own advantages and disadvantages, and in double-end sequencing, two different linearization methods are often needed to be used at the same time to cut the DNA chains in two directions respectively, which makes the linearization process more complicated and demanding. However, although the most commonly used USER enzyme excision method is highly efficient and has low damage, it cannot solve the needs of double-end sequencing alone; the efficiency of the FPG enzyme excision method is not stable enough, and sodium periodate is highly destructive to DNA. Therefore, the existing linearization methods still have obvious limitations in the application of double-end sequencing, and it is urgent to develop new, efficient, stable and less damaging linearization methods to improve the overall performance of double-end sequencing. Summary of the invention

[0016] Based on this, the purpose of the present invention is to provide a new, efficient, stable and less damaging DNA linearization method to improve the overall performance of sequencing (especially double-end sequencing).

[0017] The technical solutions for achieving the above-mentioned purpose include the following.

[0018] In a first aspect, the present invention provides a novel linearization method for NGS sequencing, comprising the following steps:

[0019] Introducing a phosphorothioate group as shown in Structure 1, Structure 2, Structure 3 or Structure 4 into the amplification primer sequence or the surface spacer sequence of the DNA primer;

[0020] During linearization, the phosphorothioate bond in the DNA primer is cut with an AgNO3 solution, resulting in a break in one strand of the DNA primer;

[0021] The linearized reaction formula is shown in Formula I, Formula II, Formula III or Formula IV:

[0022]

[0023]

[0024] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0025] In a second aspect, the present invention provides an NGS sequencing chip, wherein at least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a phosphorothioate group is introduced into an amplification primer sequence or a surface spacer sequence of the at least one DNA primer;

[0026] The DNA primers into which the phosphorothioate groups are introduced are shown in Structure 1, Structure 2, Structure 3 or Structure 4:

[0027]

[0028] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0029] Furthermore, two DNA primers are connected to the surface of the NGS sequencing chip, and the two DNA primers are P5 primer and P7 primer;

[0030] A phosphorothioate group is introduced into the P7 primer amplification primer sequence or the surface spacer sequence;

[0031] The P7 primer introduced with a phosphorothioate group is shown in Structure 1, Structure 2, Structure 3 or Structure 4:

[0032]

[0033] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0034] In a third aspect, the present invention provides a method for preparing the NGS sequencing chip of the present invention, comprising the following steps:

[0035] preparing the DNA primers, wherein at least one DNA primer is as shown in Structure 1, Structure 2, Structure 3 or Structure 4;

[0036] The DNA primers are modified onto the surface of the NGS sequencing chip.

[0037] In a fourth aspect, the present invention provides the linearization method described in the present invention, or the application of the NGS sequencing chip described in the present invention in NGS sequencing (especially double-end NGS sequencing).

[0038] In a fifth aspect, the present invention provides an NGS sequencing method, comprising the following steps:

[0039] Sample preparation and amplification: Prepare a sequencing library from a DNA sample to be tested, hybridize the sequencing library with the NGS sequencing chip of the present invention and perform surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0040] Linearization: AgNO3 solution is introduced into the NGS sequencing chip to react and cut off the DNA primer with the introduced thiophosphate group to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip;

[0041] The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

[0042] In a sixth aspect, the present invention provides a double-end NGS sequencing method, comprising the following steps:

[0043] Sample preparation and amplification: Prepare a sequencing library from a DNA sample to be tested, hybridize the sequencing library with the NGS sequencing chip of the present invention and perform surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0044] Linearization and sequencing of the first strand: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. Sequencing primer 1 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing;

[0045] Second-chain linearization and sequencing: After the first-chain SBS sequencing, the second chain is generated, and AgNO3 solution is introduced into the NGS sequencing chip to react and cut the P7 primer with the introduced thiophosphate group to obtain the single-stranded DNA fixed on the surface of the NGS sequencing chip; the sequencing primer 2 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-chain SBS sequencing.

[0046] The present invention has the following beneficial effects:

[0047] The present invention introduces a bridging thiophosphate group into the amplification primer sequence or the surface spacer sequence of the DNA primer, and then uses the DNA primer to modify the NGS sequencing chip and is used for linearization in NGS sequencing. During linearization, the bridging thiophosphate group is cut with a silver nitrate solution to obtain a single-stranded DNA template suitable for sequencing, thereby obtaining a new linearization method. The new linearization method of the present invention can cut and remove a DNA chain very quickly and efficiently to obtain a single-stranded DNA template suitable for sequencing, and its cutting reaction conditions have the advantage of low damage to DNA. Using it for NGS sequencing can significantly improve the sequencing quality; especially when it is used in conjunction with the existing USER enzyme excision method, it can significantly improve the quality of double-end sequencing, and has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the NGS sequencing process and its linearization method.

[0049] Figure 2 Schematic diagram of the linearization principle of the second strand based on the bridging phosphorothioate in the P7 primer sequence.

[0050] Figure 3 Schematic diagram of the linearization of the second strand based on the bridged phosphorothioate in the surface spacer sequence of the P7 primer.

[0051] Figure 4 This is the signal diagram of 8 parallel PE150 sequencing in the control group.

[0052] Figure 5 This is the signal diagram of 8 parallel PE150 sequencing in the experimental group of method 1.

[0053] Figure 6 This is the signal diagram of 8 parallel PE150 sequencing in the experimental group of method 2.

[0054] Figure 7 It is the maintenance rate of the second-strand signal in the control group, the experimental group of method 1 and the experimental group of method 2.

[0055] Figure 8 It is the Q30 difference between the first and second chains of the control group, the experimental group of method 1, and the experimental group of method 2. DETAILED DESCRIPTION

[0056] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0057] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0058] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0059] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0060] There are currently three known methods for NGS sequencing, namely USER enzyme excision, FPG enzyme excision, and sodium periodate chemical cutting. These three methods have their own advantages and disadvantages, and in double-end sequencing, two different linearization methods are often needed to be used simultaneously to cut the DNA chains in two directions respectively, which makes the linearization process more complicated and demanding. However, although the most commonly used USER enzyme excision method is highly efficient and has low damage, it cannot solve the needs of double-end sequencing alone; and the cutting efficiency of the FPG enzyme excision method is unstable, sometimes good and sometimes bad, resulting in very unstable sequencing quality; sodium periodate is highly destructive to DNA. Therefore, the existing linearization methods still have obvious limitations in the application of double-end sequencing. Based on this, the purpose of the invention is to develop a new linearization method that can cut efficiently, has good stability, and has little damage to DNA, so as to improve the overall performance of its sequencing in NGS sequencing, especially to improve the overall quality of double-end sequencing.

[0061] In order to achieve the above object, in one embodiment of the present invention, a linearization method for NGS sequencing is provided, comprising the following steps:

[0062] Introducing a phosphorothioate group as shown in Structure 1, Structure 2, Structure 3 or Structure 4 into the amplification primer sequence or the surface spacer sequence of the DNA primer;

[0063] During linearization, the phosphorothioate bond in the DNA primer is cut with an AgNO3 solution, resulting in a break in one strand of the DNA primer;

[0064] The linearized reaction formula is shown in Formula I, Formula II, Formula III or Formula IV:

[0065]

[0066]

[0067] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0068] Wherein, Base can be specifically selected from: adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R1-substituted adenine, R1-substituted guanine, R1-substituted cytosine, R1-substituted uracil, R1-substituted thymine; wherein R1 is a protecting group for hydrogen or amino, for example, R1 is selected from: H, benzoyl, benzyloxymethyl.

[0069] In some of these embodiments, n is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0070] In some embodiments, the AgNO3 solution is prepared with a buffer solution, and the buffer solution is preferably PBS; the pH of the PBS is preferably 5-9, preferably 6-8; the concentration of AgNO3 in the AgNO3 solution is preferably 10mmol / L-1000mmol / L, more preferably 20mmol / L-40mmol / L, and more preferably 25mmol / L-35mmol / L.

[0071] In some of the embodiments, the cleavage conditions for cleaving the phosphorothioate bond in the DNA primer with AgNO3 solution include: temperature of 15°C-40°C, time of 10min-120min; preferably, temperature of 20°C-30°C, time of 30min-90min, more preferably 50min-70min.

[0072] The linearization method of the present invention can very quickly and efficiently cut and remove a DNA chain to obtain a single-stranded DNA template suitable for sequencing, and its cutting reaction conditions have the advantage of low damage to DNA, thereby significantly improving the sequencing quality; especially when it is used in conjunction with the existing USER enzyme excision method, it can significantly improve the quality of double-end sequencing, and has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications.

[0073] Based on the above novel linearization method, the present invention provides an NGS sequencing chip in another embodiment, wherein at least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a phosphorothioate group is introduced into the amplification primer sequence or the surface spacer sequence of the at least one DNA primer; the DNA primer introduced with the phosphorothioate group is shown in Structure 1, Structure 2, Structure 3 or Structure 4:

[0074]

[0075] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0076] Specifically, adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R1-substituted adenine, R1-substituted guanine, R1-substituted cytosine, R1-substituted uracil, R1-substituted thymine; wherein R1 is a protecting group for hydrogen or amino, for example, R1 is selected from: H, benzoyl, benzyloxymethyl.

[0077] like Figure 2As shown, the present invention introduces a bridging thiophosphate functional group into the amplification primer sequence or surface spacer sequence of the P7 primer modified on the surface of the sequencing chip, which can achieve effective chemical cutting. The introduction of the bridging thiophosphate functional group can adopt the form of 5'-S-thiophosphate (5'-S-phosphorothioate) of structure 1, or the form of 3'-S-thiophosphate (3'-S-phosphorothioate) of structure 2. Both structure 1 and structure 2 can be broken under AgNO3 treatment to form 5' / 3' thiol-substituted DNA and 3' / 5' phosphate-terminated DNA. The remaining parts of the two forms on the chip surface cannot be extended by DNA polymerase. Therefore, the remaining P7 residues after linearization will not interfere with 2-strand sequencing.

[0078] Methods for synthesizing oligonucleotides containing 5'-S-phosphorothioate or 3'-S-phosphorothioate linkages are known in the art, and certain of these methods are amenable to automated solid phase oligonucleotide synthesis. For example, Wang DY, Lai BH, Feldman AR, Sen D.A general approach for the use of oligonucleotide effectors to regulate thecatalysis of RNA-cleaving ribozymes and DNAzymes.Nucleic Acids Res.2002Apr15;30(8):1735-42.doi:10.1093 / nar / 30.8.1735.PMID:11937626;PMCID:PMC113219.;Cook,AF,J.Am.Chem.Soc.,92:190-195,1970;Chladek,S.et al.,J.Am.Chem.Soc.,94:2079-2084,1972; Rybakov,VN,et al.,Nucleic Acids Res., 9:189-201, 1981; Cosstick, R. and Vyle, JS, J.Chem.Soc.CHem.Commun., 992-992, 1988; Mag, M., et al., Nucleic Acids Res., 19(7); 1437-1441, 1991; Xu, Y, and Kool, ET, Nucleic Acids Res., 26(13): 3159-3164, 1998; Cosstick, R. and Vyle, JS, Tetrahedron Lett., 30: 4693-4696, 1989; Cosstick, R. and Vyle, JS, Nucleic Acids Res., 18: 829-835, 1990; Sun, SG andPiccirilli, JA, Nucl. Nucl., 16: 1543-1545, 1997; Sun SG, et al., RNA, 3: 1352-1363, 1997; Vyle, JS, et al., Tetrahedron Lett., 33: 3017-3020, 1992; Li, X., et al. al.,J.Chem.Soc.Perkin Trans.,1:2123-22129,1994;Liu,XH and Reese,CB,TetrahedronLett.,37:925-928,1996;Weinstein,LB,et al.,J.Am.Chem.Soc.,118:10341-10350,1996;and Sabbagh,G.,et al.,Nucleic Acids Res.,32(2):495-501,2004;Patent Nucleic Acid sequencing by performing successive cycles of duplex extension,EP2233582A1;and other documents disclose related synthesis methods. .

[0079] like Figure 3 As shown, the bridged thiophosphate functional group that can be efficiently chemically cleaved can not only be introduced through the structure of the nucleoside, such as structure 1 and structure 2, but also can be introduced into the oligonucleotide primer or the surface spacer sequence connected thereto through the thiophosphoramidite spaced by the carbon chain, such as structure 3 and structure 4. Consistent with the principle described above, both structure 3 and structure 4 can be broken under AgNO3 treatment to form 5' / 3' mercaptoalkyl substituted DNA and 3' / 5' phosphate-terminated DNA. The remaining parts of the two forms on the chip surface cannot be extended by DNA polymerase. Therefore, the remaining P7 residue after linearization will not interfere with 2-strand sequencing.

[0080] Methods for synthesizing oligonucleotides containing structures 3 and 4 are known in the art, and some of these methods are suitable for automated solid phase oligonucleotide synthesis, such as patent US20100081140A1. The length of the alkyl chain used to space the SP atoms can be arbitrarily adjusted (for example, it can be an alkyl chain of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 carbons). Figure 3 The example only illustrates the use of the bridged phosphorothioate containing an alkyl spacer portion in the surface spacer sequence. Structures 3 and 4 can also be located in the amplification primer sequence like structures 1 and 2.

[0081] The "surface spacer sequence" described in the present invention is a specific base sequence added to the 5' end of the chip surface amplification primer to ensure sufficient space between different clusters and to improve surface amplification efficiency and sequencing accuracy. For example, in the embodiment of the present invention, it is a polyT (10 Ts).

[0082] The "amplification primer sequence" mentioned in the present invention refers to a primer sequence that is complementary to a specific region sequence on a nucleic acid fragment (library) to be amplified.

[0083] In double-end sequencing, two DNA primers are connected to the surface of the NGS sequencing chip, and the two DNA primers are P5 primer and P7 primer;

[0084] A phosphorothioate group is introduced into the amplification primer sequence or the surface spacer sequence of the P7 primer;

[0085] The P7 primer introduced with a phosphorothioate group is shown in Structure 1, Structure 2, Structure 3 or Structure 4:

[0086]

[0087] Wherein, Base is a heterocyclic base, n≧1, and is an integer.

[0088] The NGS sequencing chip of the present invention can be prepared according to conventional methods in the art, for example, mainly comprising the following steps:

[0089] preparing the DNA primers, wherein at least one DNA primer is as shown in Structure 1, Structure 2, Structure 3 or Structure 4;

[0090] The DNA primers are modified onto the surface of the NGS sequencing chip.

[0091] Based on the linearization method provided by the present invention, or the application of the NGS sequencing chip in NGS sequencing (especially double-end NGS sequencing), another embodiment of the present invention provides an NGS sequencing method, comprising the following steps:

[0092] Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the NGS sequencing chip and performing surface amplification to obtain a double-stranded DNA cluster to be tested that is fixed on the surface of the NGS sequencing chip;

[0093] Linearization: AgNO3 solution is introduced into the NGS sequencing chip to react and cut off the DNA primer with the introduced thiophosphate group to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip;

[0094] The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

[0095] Specifically, during double-end NGS sequencing, two DNA primers are connected to the surface of the NGS sequencing chip, and the surface of the NGS sequencing chip has two DNA primers connected, and the two DNA primers are P5 primer and P7 primer; a phosphorothioate group is introduced into the amplification primer sequence or the surface spacer sequence of the P7 primer; the double-end NGS sequencing method comprises the following steps:

[0096] Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the NGS sequencing chip and performing surface amplification to obtain a double-stranded DNA cluster to be tested that is fixed on the surface of the NGS sequencing chip;

[0097] Linearization and sequencing of the first strand: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. Sequencing primer 1 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing;

[0098] Second-chain linearization and sequencing: After the first-chain SBS sequencing, the second chain is generated, and AgNO3 solution is introduced into the NGS sequencing chip to react and cut the P7 primer with the introduced thiophosphate group to obtain the single-stranded DNA fixed on the surface of the NGS sequencing chip; the sequencing primer 2 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-chain SBS sequencing.

[0099] In some embodiments, the AgNO3 solution is prepared with a buffer solution, and the buffer solution is preferably PBS; the pH of the PBS is preferably 5-9, preferably 6-8; the concentration of AgNO3 in the AgNO3 solution is preferably 10mmol / L-1000mmol / L, more preferably 20mmol / L-40mmol / L, and more preferably 25mmol / L-35mmol / L.

[0100] In some embodiments, the reaction conditions include: temperature of 15°C-40°C, time of 10 min-120 min; preferably, temperature of 20°C-30°C, time of 30 min-90 min, more preferably 50 min-70 min.

[0101] The new linearization method or NGS sequencing chip provided by the present invention is used for NGS sequencing, which can very quickly and efficiently cut and remove a DNA chain to obtain a single-stranded DNA template suitable for sequencing, and has the advantage of low damage to DNA, which can significantly improve the sequencing quality, especially the quality of double-end sequencing, and has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications.

[0102] The present invention is further described in detail below with reference to specific embodiments.

[0103] Example 1

[0104] 1. Preparation of microfluidic chip 1

[0105] This embodiment provides a microfluidic chip for gene sequencing, wherein the surface of the chip is modified with primer P5, which has a dU base modification in the middle of its sequence and can be broken under the action of USER enzyme to achieve a 1-chain linearization function; at the same time, the surface of the chip is modified with primer P7, which contains a nucleoside sequence in which nucleosides are connected by thiophosphate bonds in the middle of its sequence (i.e., it has a 5'-S-thiophosphate functional group), which can be broken under AgNO3 treatment to achieve a 2-chain linearization function.

[0106] The method for preparing a microfluidic chip for gene sequencing in this embodiment comprises the following steps:

[0107] 1. Prepare P5 primer (DBCO-P5-dU) and P7 primer containing 5'-S-phosphorothioate (DBCO-5'-S-P7, as shown in Structure 1) by standard solid phase synthesis method.

[0108]

[0109] Among them, DBCO-P5-dU is to modify the dU base at the specified position of the P5 primer, and its sequence is: TTTTTTTTTTAATGATACGGCGACCACCGAGA / ideoxyU / CTACAC (SEQ ID NO: 1); DBCO-5'-S-P7 is to introduce a 5'-S-phosphorothioate group at the specified position of the amplification primer sequence of the P7 primer, and its sequence is: TTTTTTTTTCAAGCAGAAGACGGCA[5'-ST]ACGAGAT (SEQ ID NO: 2).

[0110] 2. According to the preparation process of the sequencing microfluidic chip supporting the Salus pro sequencer, the above primers are modified to the surface of the microfluidic chip and used in the double-end NGS sequencing experiment. The specific method is:

[0111] a. P5 primer solution containing 10uM DBCO-P5-dU (Shanghai Biosynthetics) and P7 primer solution containing 10uM DBCO-5'-S-P7 (Shanghai Biosynthetics) prepared with 3xSSC (buffer, pH 8.0) were introduced into the microfluidic chip with azide groups, the chip was vacuum sealed, and placed in a 37°C oven for reaction for 15h;

[0112] b. After the reaction is completed, unreacted primers are removed with formamide, and the chip surface is washed twice with 3xSSC and blown dry with nitrogen to obtain microfluidic chip 1 for use.

[0113] 2. Preparation of microfluidic chip 2

[0114] This embodiment provides a microfluidic chip for gene sequencing, wherein the surface of the chip is modified with primer P5, which has a dU base modification in the middle of its sequence and can be broken under the action of USER enzyme, thereby realizing the 1-chain linearization function; at the same time, the surface of the chip is modified with primer P7, which has a thiophosphate functional group modification with a carbon chain spacer in its surface spacer sequence and can be broken under AgNO3 treatment, thereby realizing the 2-chain linearization function.

[0115] The method for preparing a microfluidic chip for gene sequencing in this embodiment comprises the following steps:

[0116] 1. Prepare P5 primer (DBCO-P5-dU) and P7 primer containing 5'-phosphate-(CH2)4-S in the middle of the surface spacer sequence (DBCO-5'-P-C4-S-P7, such as structure 3, where n is 4) by standard solid phase synthesis method, and prepare P7 primer containing 8-oxo-G (DBCO-P7-8-oxo-G) as a control.

[0117]

[0118] Among them, DBCO-P5-dU uses DMT-dU phosphoramidite as a raw material to modify the dU base at the specified position of the P5 primer, and its sequence is: TTTTTTTTTTAATGATACGGCGACCACCGAGA / ideoxyU / CTACAC (SEQ ID NO: 1); DBCO-5'-P-C4-S-P7 uses carbon chain-spaced thiophosphoramidite as a raw material to introduce a 5'-phosphate-(CH2)4-S-group at a specified position in the middle of the surface spacer sequence of the P7 primer, and its sequence is: TTTTTTTTT[5'-P-C4-ST]CAAGCAGAAGACGGCAACGAGAT (SEQ ID NO: 3); DBCO-P7-8-oxo-G uses 8-oxo-G phosphoramidite as a raw material to introduce 8-oxo-G at a specified position of the P7 primer, and its sequence is: TTTTTTTTTTCAAGCA / i8oxodG / AAGACGGCAACGAGAT (SEQ ID NO: 4). The DMT-dU phosphoramidite, carbon chain-interval thiophosphoramidite and 8-oxo-G phosphoramidite used are all commercially available products. The structural formula of the carbon chain-interval thiophosphoramidite used in this example is as follows:

[0119]

[0120] 2. According to the preparation process of the sequencing microfluidic chip supporting the Salus pro sequencer, the above primers are modified to the surface of the microfluidic chip and used in the double-end NGS sequencing experiment. The specific method is:

[0121] a. P5 primer solution containing 10uM Dbco-P5-dU (Shanghai Biosynthetics) and P7 primer solution containing 10uM Dbco-5'-P-C4-S-P7 (Shanghai Biosynthetics) prepared with 3xSSC (buffer, pH 8.0) were introduced into the microfluidic chip with azide groups, the chip was vacuum sealed, and placed in a 37°C oven for reaction for 15h;

[0122] b. After the reaction is completed, unreacted primers are removed with formamide, and the chip surface is washed twice with 3xSSC and blown dry with nitrogen to obtain microfluidic chip 2 for use.

[0123] Microfluidic chip 3 for control experiment was prepared in the same way by replacing DBCO-5'-S-P7 with DBCO-P7-8-oxo-G.

[0124] Example 2 Application of microfluidic chips 1 and 2 in PE150 sequencing and cleavage stability of P7 chain

[0125] The microfluidic chips 1 and 2 prepared in Example 1 were equipped on the Salus Pro sequencer respectively. The linearization reagent 2 in the kit equipped with the sequencer was replaced with the AgNO3 solution used in the present invention, and the standard NSG double-end sequencing process was followed. The difference between the experimental group of method 1 and the experimental group of method 2 is that the P7 primer structure on the microfluidic chip used is different, and the reaction system for the linearization of the two strands is the AgNO3 solution. The principle of the linearization of the two strands in the experimental group of method 1 and the experimental group of method 2 is as follows Figure 2 and Figure 3 shown.

[0126] The only difference between the control group and the experimental group was the different P7 primer structures on the microfluidic chip, the linearization 2 reagents and the reaction conditions. The other steps were the same and were performed according to the standard NSG sequencing process.

[0127] Control group: traditional FPG digestion

[0128] 1) Prepare 800 mL of conventional FPG enzyme linearization reagent 2 (composed of 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1 mM DTT, 50 U / ml FPG enzyme) at one time, divide into 400 portions and store in a -20°C refrigerator for 1 month.

[0129] 2) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0130] 3) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic sequencing chip 3 prepared in Example 1 is loaded into the designated position of the Salus Pro sequencer.

[0131] 4) Randomly select 8 portions of the traditional FPG enzyme linearization reagent 2 frozen for 1 month in step 1) as the linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit, and perform 8 control groups in parallel.

[0132] 5) Perform PE150 sequencing: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; first perform 150 rounds of SBS sequencing on the first chain (the linearization method is the standard USER enzyme excision method), and after the second chain is generated, use the traditional linearization reagent 2 containing FPG enzyme to cut the P7 extended chain containing 8-oxo-G (cutting conditions: 37°C reaction for 30 minutes) to perform 150 rounds of SBS sequencing on the second chain.

[0133] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the Salus Pro sequencer.

[0134] Experimental group: Silver nitrate cleavage of bridged phosphorothioate

[0135] Method 1 Experimental Group

[0136] 1) Prepare 30 mM AgNO3 solution in PBS (pH=7) as the new nature reagent 2, prepare 800 mL at a time, divide into 400 portions and store in a -20°C refrigerator for 1 month.

[0137] 2) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0138] 3) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic chip 1 prepared in Example 1 is loaded into the designated position of the Salus Pro sequencer.

[0139] 4) Randomly select 8 portions of the novel linearization reagent 2 of the present invention after being frozen for 1 month in step 1) as the linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit, and perform parallel tests in 8 experimental groups.

[0140] 5) Perform PE150 sequencing: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; first perform 150 rounds of SBS sequencing on the first chain (the linearization method is the standard USER enzyme excision method), and after the second chain is generated, use the new linearization reagent 2 of the present invention to cut the P7 extended chain containing the 5'-S-phosphorothioate functional group (cutting conditions: room temperature (25°C) for 1 hour), and perform 150 rounds of SBS sequencing on the second chain.

[0141] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the Salus Pro sequencer.

[0142] Method 2 Experimental Group

[0143] 1) Randomly take 8 more portions of the 400 portions of new personality reagent 2 prepared and stored in the experimental group of method 1 above for use.

[0144] 2) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0145] 3) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic chip 2 prepared in Example 1 is loaded into the designated position of the Salus Pro sequencer.

[0146] 4) Eight randomly selected new linearization reagents 2 were used as linearization reagents 2 for cutting P7 in the Salus Pro sequencing kit, and eight experimental groups were tested in parallel.

[0147] 5) Perform PE150 sequencing: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; first perform 150 rounds of SBS sequencing on the first chain (the linearization method is the standard USER enzyme excision method), and after the second chain is generated, use the new linearization reagent 2 of the present invention to cut the P7 extended chain containing the thiophosphate functional group (containing 5'-phosphate-(CH2)4-S functional group) in structure 3 (cutting conditions: react at room temperature (25°C) for 1 hour), and perform 150 rounds of SBS sequencing on the second chain.

[0148] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the Salus Pro sequencer.

[0149] Result analysis:

[0150] In NGS PE sequencing, the positive strand (first strand, R1) and the reverse strand (second strand, R2) of the double-stranded DNA on the sequencing chip need to be sequenced in one run. In PE sequencing, the smaller the Q30 difference (ΔQ30) between the first and second strands, the better. The larger the Q30 difference (ΔQ30) between the first and second strands, the greater the difference in the sequencing error rate between the first and second strands. The sequencing signal can usually reflect the efficiency of double-stranded DNA cleavage in the surface amplification cluster. The signal maintenance rate (AvgIntensity_R2 / R1) can reflect the efficiency of chain cleavage. The higher the cleavage efficiency, the higher the sequencing signal in SBS sequencing. The higher the sequencing signal, the more favorable it is to the accuracy of base recognition, making the sequencing quality (Q30 and error rate) better.

[0151] From Table 1 and Figure 4 It can be seen that 8 samples were randomly selected from 400 samples of the traditional FPG linearization reagent 2 after being frozen for 1 month for parallel PE150 testing, which was the control group; under the conditions of similar cluster density (density), Phasing / Prephasing, etc., the consistency of the first-strand sequencing signal (AvgIntensity_R1) of the 8 parallel groups of the traditional FPG enzyme linearization reagent PE150 sequencing was good, but the consistency of the second-strand sequencing signal (AvgIntensity_R2) was poor, that is, the signal maintenance rate fluctuated greatly ( Figure 7 and Figure 8 ), the relative deviation of parallel groups 4 and 6 was relatively large, which resulted in a large difference in Q30 (ΔQ30) between the first and second chains, the second chain sequencing Q30 was lower than the first chain, and the sequencing error rate was significantly higher than the first chain; that is, the sequencing stability of traditional FPG enzyme cleavage was poor in actual production applications.

[0152] From Table 1 and Figure 5 and Figure 6 It can be seen that 16 samples (8 samples each for method 1 and method 2) were randomly selected from 400 samples of the new linearization reagent 2 of the present invention after being frozen for 1 month for parallel PE150 testing, namely the experimental group; under the conditions of similar cluster density (density), Phasing / Prephasing, etc., the consistency of the first-strand sequencing signal (AvgIntensity_R1) and the second-strand sequencing signal (AvgIntensity_R2) of the 8 parallel groups of PE150 sequencing tested by method 1 and method 2 of the present invention was good, that is, the signal maintenance rate was relatively stable ( Figure 7 and Figure 8 ); the sequencing Q30 and sequencing error rate of the first and second chains are consistent, and the sequencing quality and stability are good in actual production applications.

[0153] In summary, the linearization method of cutting two thiophosphates using the silver nitrate system in the experimental group can maintain high cutting efficiency in PE sequencing, and the consistency of parallel tests is good, that is, the stability is good, and more stable sequencing quality can be maintained in actual PE sequencing applications.

[0154] Table 1 Results of 8 parallel PE150 sequencing in the control group and experimental group, Method 1 and Method 2

[0155]

[0156]

[0157]

[0158] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A linearization method for NGS sequencing, characterized in that: The steps include: Introducing a phosphorothioate group as shown in Structure 1, Structure 2, Structure 3 or Structure 4 into the amplification primer sequence or the surface spacer sequence of the DNA primer; During linearization, the phosphorothioate bond in the DNA primer is cut with an AgNO3 solution, resulting in a break in one strand of the DNA primer; The linearized reaction formula is shown in Formula I, Formula II, Formula III or Formula IV: Wherein, Base is a heterocyclic base, n≧1, and is an integer.

2. The linearization method for NGS sequencing according to claim 1, characterized in that: Base is selected from the group consisting of adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R1-substituted adenine, R1-substituted guanine, R1-substituted cytosine, R1-substituted uracil, and R1-substituted thymine; wherein R1 is selected from the group consisting of H, benzoyl, and benzyloxymethyl.

3. The linearization method for NGS sequencing according to claim 1, characterized in that: n is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

4. The linearization method for NGS sequencing according to any one of claims 1 to 3, characterized in that: The AgNO3 solution is prepared with a buffer solution, and the buffer solution is preferably PBS; Preferably, the pH of the PBS is 5-9, preferably 6-8; Preferably, the concentration of AgNO3 in the AgNO3 solution is 10mmol / L-1000mmol / L, preferably 20mmol / L-40mmol / L, and more preferably 25mmol / L-35mmol / L.

5. The linearization method for NGS sequencing according to any one of claims 1 to 3, characterized in that: The cutting conditions of the cleavage of the phosphorothioate bond in the DNA primer with the AgNO3 solution include: a temperature of 15°C-40°C and a time of 10min-120min; Preferably, the temperature is 20°C-30°C, and the time is 30min-90min.

6. An NGS sequencing chip, characterized in that: At least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a phosphorothioate group is introduced into the amplification primer sequence or the surface spacer sequence of the at least one DNA primer; The DNA primers into which the phosphorothioate groups are introduced are shown in Structure 1, Structure 2, Structure 3 or Structure 4: wherein Base and n are as described in any one of claims 1-3.

7. The NGS sequencing chip according to claim 6, characterized in that: The surface of the NGS sequencing chip is connected to two DNA primers, which are P5 primer and P7 primer; A phosphorothioate group is introduced into the amplification primer sequence or the surface spacer sequence of the P7 primer; The P7 primer introduced with a phosphorothioate group is shown in Structure 1, Structure 2, Structure 3 or Structure 4: wherein Base and n are as described in any one of claims 1-3.

8. A method for preparing the NGS sequencing chip according to claim 6 or 7, characterized in that: The steps include: preparing the DNA primers, wherein at least one DNA primer is as shown in Structure 1, Structure 2, Structure 3 or Structure 4; The DNA primers are modified onto the surface of the NGS sequencing chip.

9. Use of the linearization method according to any one of claims 1 to 5, or the NGS sequencing chip according to claim 6 or 7 in NGS sequencing; preferably, the NGS sequencing is double-end NGS sequencing.

10. An NGS sequencing method, characterized in that: The steps include: Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the sequencing library with the NGS sequencing chip according to claim 6 or 7 and performing surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip; Linearization: AgNO3 solution is introduced into the NGS sequencing chip to react and cut off the DNA primer with the introduced thiophosphate group to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip; The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

11. A double-end NGS sequencing method, characterized in that: The steps include: Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the sequencing library with the NGS sequencing chip of claim 7 and performing surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip; Linearization and sequencing of the first strand: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. Sequencing primer 1 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing; Second-chain linearization and sequencing: After the first-chain SBS sequencing, the second chain is generated, and AgNO3 solution is introduced into the NGS sequencing chip to react and cut the P7 primer with the introduced thiophosphate group to obtain the single-stranded DNA fixed on the surface of the NGS sequencing chip; the sequencing primer 2 is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-chain SBS sequencing.

12. The NGS sequencing method according to claim 10 or 11, characterized in that: The AgNO3 solution is prepared with a buffer solution, and the buffer solution is preferably PBS; Preferably, the pH of the PBS is 5-9, preferably 6-8; Preferably, the concentration of AgNO3 in the AgNO3 solution is 10mmol / L-1000mmol / L, preferably 20mmol / L-40mmol / L, and more preferably 25mmol / L-35mmol / L.

13. The NGS sequencing method according to claim 10 or 11, characterized in that: The reaction conditions include: temperature of 15°C-40°C, time of 10min-120min; Preferably, the temperature is 20°C-30°C, and the time is 30min-90min.

Images