Universal type human T cell product preclinical biological distribution detection kit based on mRNA and detection method of universal type human T cell product preclinical biological distribution detection kit

Abstract

The invention relates to an mRNA-based universal human T cell product preclinical biological distribution detection kit and a detection method thereof, and belongs to the technical field of biological medicine industry. The invention provides application of an mRNA (messenger ribonucleic acid) sequence as shown in SEQ ID No.1 in preparation of a product for specifically distinguishing human T cells from human tumor cells. The invention develops a novel universal specific biological analysis method for detecting non-genetically modified T cells of human by detecting the mRNA specific sequence of CD3, and the method can be well used for biological analysis of preclinical pharmacokinetics and biological distribution of T cell treatment products.

Description

Technical Field

[0001] The present invention relates to a universal human T cell product preclinical biodistribution detection kit based on mRNA and a detection method thereof, belonging to the technical field of biopharmaceutical industry, cell gene therapy product research and development, tumor immunotherapy product research and development, molecular biology research, cell engineering research, drug preclinical research, pharmacokinetic research, drug bioanalysis, and biodistribution research. Background Art

[0002] In recent years, biopharmaceuticals have been developing strongly around the world. In addition to traditional chemical small molecule drugs, more and more biological drugs have been approved for clinical use. Current biological drugs mainly include monoclonal antibodies, proteins, peptide drugs, ADC drugs, bispecific antibodies, etc. In addition, cell and gene therapy drugs have also become new and popular research objects in biopharmaceutical research and development. Among them, cell therapy products have become an important focus of cell gene therapy drugs.

[0003] Since Novartis Pharmaceuticals' Kymriah became the world's first CAR-T cell therapy product approved for marketing, in the field of immune cell therapy, different types of immune cell therapy R&D pipelines have flourished, and many products have entered the preclinical or clinical R&D stage. There are many types of immune cell therapy products currently reported in the research and development stage, in addition to genetically modified products carrying CAR structure expression such as CAR-T, CAR-NK, CAR-γ δ T cell products, there are also non-genetically modified or even gene-knocked T cell therapy products such as γ δT, tumor-infiltrating T lymphocytes (TIL), and other non-genetically modified or even gene-knocked autologous or allogeneic NK cells, NKT cells, etc.

[0004] The analysis and evaluation of pharmacokinetic distribution is an inevitable part of the drug in the preclinical and clinical research stages. Cell therapy products face practical difficulties and challenges in the technical implementation of preclinical pharmacokinetic distribution evaluation research in the industry. For example, genetically modified CAR-T or CAR-γ δT and other T cell therapy products that are genetically modified and clearly carry exogenous genes can be specifically distinguished from clinical human blood samples and preclinical blood samples and tissue samples loaded with human tumor cells at the DNA level by detecting the exogenous CAR sequence, so as to conduct detection and analysis. Therefore, for genetically modified immune cell therapy products with CAR, the biological analysis of their preclinical pharmacokinetic and distribution is relatively easy.

[0005] For immune cell therapy products, it is generally necessary to use tumor-bearing animals carrying human tumor cells to conduct preclinical pharmacokinetic, toxicokinetic and biodistribution studies. However, for human-derived immune cell therapy products that do not carry exogenous genes such as CAR or have undergone knockout of individual other genes, it is difficult to distinguish them from human tumor cells in tumor-bearing animals, which also makes it impossible to perform pharmacokinetic and distribution analysis. Therefore, for immune cells that do not carry exogenous genes such as CAR sequence structures, how to perform biological analysis of pharmacokinetic and distribution at the DNA level has become a practical difficulty in the preclinical research and development of such cell therapy products.

[0006] At the genomic DNA level, whether it is immune cells such as T cells or human tumor cells, that is, as long as they are human cells, their DNA sequences are basically exactly the same, and it is difficult to find relatively good differential sequences. This is one of the common challenges faced by immune cells that have not been genetically modified. Similarly, for human T cell therapy products, although it is well known in the art that CD3 is a characteristic marker of T cells and T cells can be detected by CD3, at the genomic DNA level, both T cells and tumor cells can express CD3 gene sequences and CD3 can also be detected. Therefore, for unmodified T cells, it is very difficult to develop a specific CD3 method suitable for preclinical or even clinical use at the DNA level.

[0007] Patent 202311203128.3 proposes a universal analytical method for detecting human T cells based on nucleic acid variants. This is a universal T cell detection method at the DNA level. It is based on the difference between CD3 and T cells in gene methylation, and conducts T cell detection through CD3 variants. This method can well achieve DNA-level detection. However, this method requires the extracted DNA to be transformed, additional transformation experimental steps to be performed, and also involves the control of transformation efficiency. Moreover, it is difficult to distinguish between dead and live cell products at the DNA level. This is a general recognition in the industry of the shortcomings of DNA-level detection of cell therapy products, so this method has shortcomings such as cumbersome steps and limited application in actual application. Summary of the invention

[0008] The technical problems to be solved by the present invention are: 1. Screening of CD3 target sequences at the mRNA level. The CD3 molecule contains multiple subunits, namely CD3ε, CD3δ, CD3γ and CD3ζ, with molecular weights generally above 20KD, and the smallest molecular weight is 16KD. The mRNA sequences corresponding to these subunits are relatively long. Therefore, it is difficult and challenging to find suitable subunits among multiple subunits and to find sequences with good specificity in very long sequences, as the screening library capacity is large.

[0009] 2. Design and screening of primer pairs and probes. Designing and screening primer pairs and probes that meet practical applications for different target molecules has realistic differences and personalized technical challenges in terms of technical implementation. Different primer pairs are designed for many candidate target sequences, and specific primers are confirmed. In addition, primers need to be effectively amplified with high fidelity to prevent dimers, non-specificity, and other problems that affect effective amplification and non-specific amplification and efficiency. Probes also need to overcome similar technical problems.

[0010] 3. Preparation and provision of standards. Since it involves mRNA-based testing, the preparation and provision of mRNA standards and whether the mRNA standards are stable and have good applicability are also potential challenges.

[0011] 4. Construction of the reaction system. For example, whether to choose to construct a one-step reaction system or a two-step reaction system. The reaction system of the two-step RT-qPCR method is more complicated, and the one-step method involves efficiency and repeated use of RNA, which are technical challenges.

[0012] 5. Adjustment of the components and proportions in the reaction system, selection of enzymes, optimization of reaction temperature and other conditions, and how to control the Tm value from the source design.

[0013] 6. Overcome the relative instability, large fluctuations, easy degradation of RNA and the problems of preparation and stability of mRNA standards.

[0014] 7. In order to meet industrial applications, especially the application of bioanalysis of pharmacokinetic distribution, in addition to comprehensively overcoming the above practical technical difficulties and focusing on the optimization and improvement of technical details, it is also necessary to meet the regulatory requirements of biodistribution methodology for cell gene therapy products, such as sensitivity, matrix effect, accuracy, precision and amplification efficiency, etc. In addition, if the requirements of industrial drug analysis are to be met, potential matrix interference must be overcome, which is a routine technical problem to be overcome in this technical field of pharmaceutical research and development, and is also one of the most difficult technical challenges faced by the industrial analysis community.

[0015] In order to solve the above technical problems, the present invention adopts the following technical solutions: In a first aspect, the present invention provides the use of the mRNA sequence shown in SEQ ID No. 1 in preparing a product for specifically distinguishing human T cells from human tumor cells.

[0016] In a second aspect, the present invention provides the use of a reagent for detecting the mRNA sequence shown in SEQ ID No. 1 in the preparation of a universal mRNA-based preclinical biodistribution detection kit for human T cell products.

[0017] In a third aspect, the present invention provides a primer pair for specifically distinguishing human T cells from human tumor cells. The primer pair is used to amplify the mRNA sequence shown in SEQ ID No. 1; the primer pair consists of a Primer-F forward primer and a Primer-R reverse primer, the Primer-F forward primer is the primer shown in SEQ ID No. 2, and the Primer-R reverse primer is the primer shown in SEQ ID No. 3.

[0018] In a fourth aspect, the present invention provides the use of the primer pair for specifically distinguishing human T cells from human tumor cells in the preparation of a universal mRNA-based preclinical biodistribution detection kit for human T cell products.

[0019] In a fifth aspect, the present invention provides a probe, which is a Taqman probe having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 4.

[0020] In a sixth aspect, the present invention provides a primer probe set for specifically distinguishing human T cells from human tumor cells, comprising the primer pair for specifically distinguishing human T cells from human tumor cells and the probe.

[0021] In a seventh aspect, the present invention provides the use of the primer probe set for specifically distinguishing human T cells from human tumor cells in the preparation of a universal mRNA-based preclinical biodistribution detection kit for human T cell products.

[0022] In an eighth aspect, the present invention provides mRNA standards, wherein the sequence of the mRNA standard is an mRNA sequence as shown in SEQ ID No. 1 with an extension protection sequence as shown in SEQ ID No. 6 added to the 5' end and an extension protection sequence as shown in SEQ ID No. 7 added to the 3' end.

[0023] Preferably, the sequence of the mRNA standard is the sequence shown in SEQ ID No. 5.

[0024] In a ninth aspect, the present invention provides the use of the mRNA standard in the preparation of a product for specifically distinguishing between human T cells and human tumor cells.

[0025] In a tenth aspect, the present invention provides a universal human T cell product preclinical biodistribution detection kit at the mRNA level, comprising: the primer probe set for specifically distinguishing human T cells and human tumor cells and the mRNA standard.

[0026] Preferably, it also includes: RNA carrier diluent and Master Mix mixed components.

[0027] Preferably, the mRNA standard is used to construct a standard curve, a primer pair or a primer probe set is used to construct a qPCR detection system, a specific mRNA sequence shown in SEQ ID No. 1 is obtained through an amplification reaction, and the differences between human T cells and human tumor cells are identified.

[0028] Preferably, the amplification reaction conditions are: 55°C / 15 minutes; 95°C / 30 seconds; 95°C / 10 seconds, 60°C / 30 seconds, 45 cycles.

[0029] In an eleventh aspect, the present invention provides an application of the mRNA sequence shown in SEQ ID No. 1 in detecting the pharmacokinetic distribution of human T cell products in mice and tumor-bearing mice bearing human tumor cell lines.

[0030] The present invention has the beneficial effects: The present invention has developed a new type of universal and specific bioanalysis method for detecting human non-genetically modified T cells by detecting CD3 mRNA specific sequences, which can be well used for preclinical pharmacokinetic and biodistribution bioanalysis of T cell therapy products (including natural non-genetically modified T cells, non-CD3 gene knockout T cells, CAR-T cells and TIL cells, etc.). mRNA exists in living cells and is also based on the in vivo transcription of living cells. The half-life of mRNA in vivo is short, and it is difficult to retain it when the cell dies. Therefore, the present invention can detect cell therapy products at the mRNA level, and can better reflect the survival and distribution of living cells compared to DNA level detection. At present, there is no similar analysis method for evaluating T cell pharmacokinetic distribution at the mRNA level. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is an agarose gel electrophoresis diagram of the results of primer amplification on genomic DNA. Figure 1 A is based on the genomic DNA level of human tumor cells (Daudi) to determine the utility and specificity of pre-selected primers; Figure 1 B is to determine the utility and specificity of the preselected primers at the T cell genomic DNA level; Figure 1 A and Figure 1 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair; 9: the fourth TCR primer pair; 10: the fifth TCR primer pair.

[0032] Figure 2It is an agarose gel electrophoresis diagram of the primer amplification results screened at the mRNA level. Figure 2 A is to determine the utility and specificity of pre-selected primers based on RNA levels in human tumor cells (Daudi); Figure 2 B is to determine the utility and specificity of the preselected primers at the human T cell RNA level; Figure 2 A and Figure 2 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair.

[0033] Figure 3 The specificity of the CD3δ primer pair and the specifically amplified mRNA target sequence of the present invention for various tumor cells and mice is identified at the mRNA level. Among them, M: DNA Marker; 1: A549 lung cancer human alveolar basal epithelial cells; 2: Daudi tumor cells; 3: NOG non-tumor-bearing mice; 4: T cell injection; 5: B-NDG mice bearing melanoma; 6: C57BL / 6 mice bearing human lymphoma; 7: NOG mice bearing human lymphoma cell line Daudi-luc cells. DETAILED DESCRIPTION

[0034] The present invention is further described by the following embodiments. It should be understood that the following embodiments are only used to illustrate the present invention, but not to limit the present invention.

[0035] At the DNA level, although the genomic DNA sequences contained in various cells of the same species are common, due to the spatiotemporal differences in gene expression, the transcription of these sequences at the RNA level has spatiotemporal differences, such as tissue specificity or cell specificity. For T cells or human tumor cells, although there are common sequences at the genomic DNA level, there may be differences at the mRNA level, for example, the mRNA sequence may not be expressed or may be different.

[0036] Based on this, the present invention has developed a new universal and specific bioanalysis method for detecting human non-genetically modified T cells by detecting CD3 mRNA-specific sequences. Although CD3 is an important marker of T cells and is well known in the industry, CD3 has four major subunits: CD3ε, CD3δ, CD3γ, and CD3ζ, and each subunit has an mRNA sequence of hundreds of bases. After a series of explorations, a large number of comparisons, experimental screening, and optimization, the present invention finally determined that a one-step RT-qPCR universal analysis method for detecting T cells (not limited to the type of T cells) was constructed based on a CD3δ mRNA sequence.

[0037] The universal and specific preclinical bioanalysis method of T cells of the present invention is to amplify and detect the target RNA sequence in the mRNA standard, quality control sample and / or the sample to be tested by a one-step RT-qPCR method. The method designs the probe molecule based on the TaqMan probe method. The TaqMan probe is based on the cDNA chain of RNA reverse transcription, is a single-stranded DNA, the 5' end is coupled with the luminescent group FAM, and the 3' end is coupled with the quenching group TAMRA. The free complete probe has no fluorescent signal, and the fluorescence emitted by the luminescent group will be absorbed and quenched by the quenching group. When the probe is hydrolyzed, the luminescent group and the quenching group are separated and the fluorescent signal can be detected. At the beginning of the reaction, the template chain is denatured by heat to form a single strand. The TaqMan probe preferentially anneals with the template chain, and the primer subsequently anneals to the template, followed by chain extension. During the extension process, the Taq enzyme exerts 5´-3´ exonuclease activity, and when it encounters the probe, it will remove the probe base by base from the 5´ end. The luminescent group will separate from the quenching group, so the fluorescence detection system can receive the fluorescence signal. For each DNA chain amplified, a fluorescent molecule is formed, and the accumulation of the fluorescence signal and the formation of the PCR product are synchronized. The standard curve is based on the linear relationship between the Ct value and the Log value of the sample concentration (in terms of copy number). The quality control sample and the sample to be tested can be calculated based on the standard curve regressed and fitted with the standard sample. The Log value of the unknown sample concentration is obtained by the Ct value of the sample, and then the sample concentration is obtained. The one-step RT-qPCR method can directly combine the mRNA standard and the blood or tissue sample containing mRNA in one reaction system, and realize reverse transcription and qPCR amplification in one round of experimental steps, instead of first reverse transcribing RNA into cDNA and then taking cDNA for qPCR. The continuous one-step method is conducive to the operation of the methodology, and the reduction of steps is conducive to the stability of the method and the comparability of different batches of experiments.

[0038] The tumor cells described in the present invention include but are not limited to A549 lung cancer human alveolar basal epithelial cells, Daudi tumor cells, melanoma, human lymphoma, human lymphoma cell line Daudi-luc cells, etc. The T cells described in the present invention include but are not limited to natural non-genetically modified T cells, non-CD3 gene knockout T cells, CAR-T cells and TIL cells, etc.

[0039] Primer and probe design: CD3δ forward primer (Primer-F forward primer): 5' TACTGGCTACCCTTCTCTCGCA3' (SEQ ID No. 2) CD3δ reverse primer (Primer-R reverse primer): 5' CCCAGGTCCAGTCTTGTAATGTCT 3' (SEQ ID No. 3) CD3δ probe (Taqman probe): 6-FAM5'TGAGGACAGAGTGTTTG 3'NFQ-MGB (SEQ ID No. 4) Primer probes specifically amplify mRNA target sequences: 5' TACTGGCTACCCTTCTCCGCAAGTGAGCCCCTTCAAGATACCTATAGAGGAACTTGAGGACAGAGTGTTTGTGAATTGCAATCCAGCATCACATGGGTAGAGGGAACGGTGGGAACACTGCTCTCAGACATTACAAGACTGGACCTGGG3' (SEQ ID No. 1) Standard mRNA sequence of the method constructed by the present invention (mRNA-CD3δ standard) 5' ATGGAACATAGCACGTTTCTCTCTGGCCTGGTACTGGCTACCCTTCTCGCAAGTGAGCCCCTTCAAGATACCTATAGAGGAACTTGAGGACAGAGTGTTTGTGAATTGCAATCCAGCATCACATGGGTAGAGGGAACGGTGGGAACACTGCTCTCAGACATTACAAGACTGGACCTGGGAAAACGCATCCTGGACCCACGAGGA3' (SEQ ID No. 5) In addition, in the bioanalysis method of pharmacokinetic and distribution, both qPCR and RT-qPCR require standards for constructing the standard curve of the method or preparing quality control samples. For qPCR, the standards are DNA or plasmid standards. However, for the one-step RT-qPCR method, the standards have certain challenges, because the stability of the mRNA standard and the intact bases containing the target sequence are very important. The standard uses the cDNA corresponding to the mRNA target sequence as a template to construct a template plasmid, which is synthesized by in vitro transcription and then purified. In order to ensure the stability of mRNA and the integrity of the target sequence mRNA standard after synthesis, the present invention designs that some sequences are extended at both ends of the target sequence as protective sequences when synthesizing the mRNA standard. The extended protective sequence at the 5' end is: ATGGAACATAGCACGTTTCTCTCTGGCCTGG (SEQ ID No. 6); the extended protective sequence at the 3' end is AAAACGCATCCTGGACCCACGAGGA (SEQ ID No. 7).

[0040] In summary, the present invention can be well used for the bioanalysis of preclinical pharmacokinetics and biodistribution of T cell therapy products (including natural non-genetically modified T cells, non-CD3 gene knockout T cells, and even CAR-T cells and TIL cells, etc.). Moreover, mRNA exists in living cells and is also based on the in vivo transcription of living cells. The half-life of mRNA in vivo is short, and it is difficult to retain it when the cells die. Therefore, the detection of cell therapy products at the mRNA level is more advanced than the DNA level detection in that it can better reflect the existence and distribution of living cells. At present, there is no similar analysis method for evaluating the pharmacokinetics and distribution of T cells at the mRNA level, which is also the creative advantage of the present invention.

[0041] Instruments and Equipment 1) Real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific, QuantStudio 5 or equivalent); 2) Fluorescence quantitative PCR 8-tube strip & cap (BBI, F602004-0001, or equivalent); 3) Vortexer (IKA, LAB DANCER S000 or equivalent); 4) -10℃ ~ -30℃ refrigerator (Haier, DW-30L818, or equivalent substitute); 5) -60℃~ -90℃ refrigerator (Haier, DW-86L959BPT, or equivalent substitute); 6) Tabletop mini centrifuge (IKA, mini G, or equivalent); 7) 96-well PCR plate (AXYGEN, PCR-96-LP-AB-C, or equivalent); 8) 2~8℃ refrigerator (Midea, MC-4L1005, or equivalent substitute); 9) Pipette (Eppendorf, 0.1~2.5 µL, 0.5~10 µL, 2~20 µL, 10~100 µL, 20~200 µL, 100~1000 µL); 10) Biological safety cabinet (Haier, 1780-ⅡA2, or equivalent alternative).

[0042] Reagents and Materials 1) mRNA-CD3δ standard (-60℃~ -90℃); 2) CD3δ forward primer (-10℃ ~ -30℃); 3) CD3δ reverse primer (-10℃ ~ -30℃); 4) CD3δ probe (-10℃ ~ -30℃); 5) Hiscript II U+ One Step qRT-PCR Probe Kit (Vazyme, Cat#Q223, Lot#7E2120L4 or other batch alternatives, -10℃ ~ -30℃); 6) Human T cells (Shandong Zhizhen Pharmaceutical Technology Co., Ltd., Ruihongdi Pharmaceutical, -60℃~ -90℃); 7) Yeast tRNA (Thermo Fisher Scientific, Cat#AM7119, -10℃~-30℃); 8) RNase-free double distilled water (Sangon Biotech, Cat#B541018-0010, -10℃ ~ -30℃); 9) Blank NOG tumor-bearing mice (Viton Liva).

[0043] Solution preparation 1) RNA carrier diluent: Add tris-HCl with a final concentration of 5 ± 0.1 mM, EDTA with a final concentration of 0.5 ± 0.05 mM, and SDS (sodium dodecyl sulfate) with a mass volume ratio of 0.1% to RNase-free double distilled water, adjust the pH to between 6.5 and 7.0, and then add Yeast tRNA with a final concentration of 0.04 ± 0.005 mg / mL. Aliquot and freeze for later use.

[0044] 2) Blank experimental animal RNA solution: Use 0.04 mg / mL Yeast tRNA diluent (RNA carrier diluent) to dilute the total RNA extracted from the whole blood or tissues of blank NOG tumor-bearing mice to 200 ng / μL, vortex to mix, and store for later use.

[0045] 3) Probe and primer dilution solution: Use RNase-free double distilled water to dissolve the probe and primer powders to a final concentration of 10 μM, vortex to mix, and store for later use.

[0046] 4) mRNA standard stock solution: Dilute the mRNA-CD3δ standard to 1.000×10 with 0.04 mg / mL Yeast tRNA diluent (RNA carrier diluent). 8 The copies / μL were stored in aliquots in an ultra-low temperature refrigerator for later use.

[0047] The reaction system preparation and reaction condition control are shown in Tables 1 to 5.

[0048] Table 1 Preparation of reaction system for standards and quality control samples

[0049] Table 2 Preparation of reaction system for test samples

[0050] Table 3 Standard curve preparation

[0051] Table 4 Quality control sample preparation

[0052] Table 5 Reaction Condition Control

[0053] The temperature setting of the reaction conditions can only fluctuate up and down by ±0.5°C.

[0054] Sensitivity and quantitative range The quantitative range of the method of the present invention is 2.000×10 7 Copies / reaction or µg total RNA ~ 5.000×10 1 copies / reaction or µg total RNA, with a sensitivity of 50 copies / reaction or µg total RNA.

[0055] The main components of the kit formed based on the technical solution of the present invention include: (1) T cell detection mRNA standards; (2) RNA carrier diluent; (3) Mixed reagents of RNA primer pairs and probe sets; (4) Master Mix:

[0056] The following examples are further listed to illustrate the present invention in detail. It should also be understood that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention belong to the scope of protection of the present invention. The specific process parameters and the like in the following examples are also only examples within a suitable range, that is, those skilled in the art can make a selection within a suitable range through the description herein, and are not limited to the specific values ​​​​exemplified below.

[0057] Example 1: Experimental example of screening specific primer amplification results at the genomic DNA level CD3 is a characteristic marker of T cells. TCR is also a characteristic marker of T cells. According to the characteristics of T cells, the inventors designed and synthesized multiple pairs of primers from different CD3 chains and different TCR chains. In preclinical studies, the pharmacokinetic distribution of T cells is generally based on studies on mice bearing human tumor cells. Therefore, these preselected primers are used to carry out specific screening for human tumor cells and T cells. If T cells can amplify the target sequence at the DNA level, sequences of corresponding sizes can also be amplified on tumor cells, so it is difficult to distinguish T cells from other human cells at the genomic level. This embodiment is intended to illustrate that it is difficult to find a method to specifically distinguish natural T cells at the DNA level, which also indirectly illustrates the significance of the present invention in detecting T cells at the mRNA level.

[0058] Figure 1 : Agarose gel electrophoresis of primer amplification results screened on genomic DNA. Figure 1 A is based on the genomic DNA level of human tumor cells (Daudi) to determine the utility and specificity of pre-selected primers; Figure 1 B is to determine the utility and specificity of the preselected primers at the T cell genomic DNA level; Figure 1 A and Figure 1 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair; 9: the fourth TCR primer pair; 10: the fifth TCR primer pair.

[0059] The first CD3 primer pair is the aforementioned CD3δ forward primer and CD3δ reverse primer. The sequences of the other primer pairs are shown in Table 6.

[0060] Table 6 Sequences of primer pairs

[0061] Discussion: The present invention pre-screened multiple pairs of primers for different target sequences as shown in Example 1 by Blast comparison, wherein the primer pairs for CD3 in the ten pre-selected sequences involved can amplify the same sequence for tumor cells and T cells at the genomic DNA level (see Figure 1 ), so it is impossible to specifically distinguish tumor cells and T cells. The last 5 pairs of primers of these 10 pairs of primers are primer pairs for TCR. Some primer pairs cannot amplify bands for tumor cells and T cells at all and are unusable; although two pairs of primers can amplify bands, they can amplify bands of the same size for the genomic DNA of tumor cells and T cells. The results show that neither the CD3 primer pair nor the TCR primer pair of T cells can specifically detect and distinguish T cells and tumor cells at the genomic DNA level, and some cannot even amplify the target sequence. It can be seen that it is difficult to find a T cell detection method that is specific at the genomic DNA level to realize preclinical pharmacokinetic and distribution research.

[0062] Therefore, the 10 pairs of preselected sequences cannot be used to specifically distinguish tumor cells from T cells at the genomic DNA level. That is, specific detection cannot be performed at the genomic DNA level. Even if the TCR primer pair of T cells is used, it is still impossible to distinguish T cells from tumor cells, or the preselected primer pair cannot amplify the target sequence at all. It can be seen that it is difficult to find a specific T cell detection method for practical and preclinical pharmacokinetic and distribution research at the genomic DNA level.

[0063] Example 2: Experimental example of screening primer amplification specificity at the mRNA level As mentioned above, Example 1 is to screen specific primer pairs for distinguishing T cells and tumor cells at the genomic DNA level, but it is found that it is difficult to specifically detect T cells at the DNA level. In this embodiment, at the mRNA level, mRNA is reverse transcribed into cDNA for PCR amplification, thereby screening the availability and specificity of primer pairs. In the pre-screening primer pairs involved in Example 1, the fourth TCR primer pair and the fifth TCR primer pair are no longer used further in Example 2 because there is no amplification product in Example 1, and the other pre-screening primer pairs are continued to be used in Example 2. Through the gel electrophoresis diagrams of Examples 1 and 2, among the many primer pairs based on CD3 subunits, after exploration and screening, the sequences and methods that can specifically distinguish T cells from human cells, especially tumor cells, are finally found, so that the primer pairs and target sequences claimed for protection in the present invention can be determined.

[0064] Figure 2 It is an agarose gel electrophoresis diagram of the primer amplification results screened at the mRNA level. Figure 2 A is to determine the utility and specificity of pre-selected primers based on RNA levels in human tumor cells (Daudi); Figure 2 B is to determine the utility and specificity of the preselected primers at the human T cell RNA level; Figure 2 A and Figure 2 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair.

[0065] Discussion: The first CD3 primer pair (i.e., the CD3δ primer pair claimed in the present invention) was selected from the five pairs of CD3 chain primers to specifically distinguish T cells from tumor cells (see Figure 2 ). In addition, Figure 2 As shown, it was also found that a pair of primers targeting TCR can also distinguish T cells from human tumor cells (see Figure 2 ). However, TCR is T cell subset specific, and different T cell subsets may have different TCR chain types, while CD3 is present in all T cells, so the screened CD3 primer pair is more suitable for developing a broader and more universal T cell detection method. Therefore, the present invention finally determines the screened CD3 primer pair, and the optimized design implementation scheme based on the mRNA target sequence corresponding to the primer pair.

[0066] Example 3: Practicality of the primer pairs and target sequences claimed in the present invention in preclinical pharmacokinetic and distribution In order to further verify the applicability and practicality of the CD3δ subunit-based primer pair and target sequence (the mRNA target sequence specifically amplified by the CD3δ primer pair and primer probe claimed to be protected by the present invention) screened and determined by the present invention in preclinical pharmacokinetic distribution studies, reverse transcription PCR amplification was performed using this primer pair in RNA samples of multiple T cells and mice or tumor-bearing mice to examine the specificity of the detection method of the present invention.

[0067] Figure 3The specificity of the CD3δ primer pair and the specifically amplified mRNA target sequence of the present invention for various tumor cells and mice is identified at the mRNA level. Among them, M: DNA Marker; 1: A549 lung cancer human alveolar basal epithelial cells; 2: Daudi tumor cells; 3: NOG non-tumor-bearing mice; 4: T cell injection; 5: B-NDG mice bearing melanoma; 6: C57BL / 6 mice bearing human lymphoma; 7: NOG mice bearing human lymphoma cell line Daudi-luc cells.

[0068] Discussion: Figure 3 As shown, in the results of reverse transcription PCR of many samples, only T cell samples can amplify the target band of the expected size, and mice, tumor-bearing mice and various tumor cells have no amplified bands. The results show the specificity of the technical solution, which is completely suitable for the pharmacokinetic distribution detection of T cell products loaded with human tumor cells, and has practical value in preclinical T cell research. In short, the results prove that the present invention has good specificity and has specific value for the pharmacokinetic distribution detection of T cells in animal experiments based on tumor-bearing mice or experiments with human tumor cells.

[0069] Example 4: Application performance of standard curve The standard curve was prepared according to the technical method and steps of the present invention, and the results were very good. The accuracy and precision results of the standard curve are shown in Table 7.

[0070] Table 7 Accuracy and precision results of standard curve

[0071] Discussion: The standard curve meets the requirement of 50 copies of sensitivity very well, and the accuracy and precision are very good, with the precision less than 10% and the accuracy around 100%, indicating that the performance of the method of the present invention is excellent, the performance of the standard curve is very good, and accurate detection of samples can be achieved.

[0072] Example 5: Accuracy and Precision Investigation Example According to the method and steps of the present invention, three sets of quality control samples (ULOQ, HQC, MQC, LQC, LLOQ) with five known different concentrations were prepared, and the copy number concentration was detected by the standard curve. The accuracy (recovery rate) of each set of quality control samples met the accuracy requirements of the qPCR quantitative method in the medical field, and the accuracy of all samples in each set was within 50-150%, for example, basically stable within 80-120%, and the accuracy of each set of batches was between 80-120%, and the precision (CV%) was within 20%, and the performance of accuracy and precision was very good. The accuracy and precision results of each set of quality control samples and batches are shown in Tables 8 to 11.

[0073] Table 8 Accuracy and precision results of the first set of quality control samples

[0074] Table 9 Accuracy and precision results of the second set of quality control samples

[0075] Table 10 Accuracy and precision results of the third set of quality control samples

[0076] Table 11 Results of inter-batch accuracy and precision

[0077] Example 6: Matrix effect investigation case Based on the method of the present invention, RNA from tissues or blood of 5 different blank experimental animals was used to prepare an analyte with a target concentration of 25,000 copies per microgram or per reaction, and then the recovery rate was tested. The results of the matrix effect test are shown in Table 12.

[0078] Table 12 Results of matrix effect investigation

[0079] The results showed that the recovery rates of samples prepared from RNA of five mice were all within the acceptable range of 50-150% required by the industry, and some individual recovery rates were around 90%, indicating that this method has good performance and selectivity and is not easily interfered by matrices from different individual sources.

Claims

1. Use of the mRNA sequence shown in SEQ ID No. 1 in preparing a product for specifically distinguishing human T cells from human tumor cells.

2. Use of a reagent for detecting the mRNA sequence shown in SEQ ID No. 1 in the preparation of a universal mRNA-based preclinical biodistribution detection kit for human T cell products.

3. Use of a primer pair for specifically distinguishing human T cells from human tumor cells in the preparation of a universal mRNA-based human T cell product preclinical biodistribution detection kit, the primer pair being used to amplify the mRNA sequence shown in SEQ ID No. 1; the primer pair consists of a Primer-F forward primer and a Primer-R reverse primer, the Primer-F forward primer is the primer shown in SEQ ID No. 2, and the Primer-R reverse primer is the primer shown in SEQ ID No.

3.

4. Use of a primer-probe set for specifically distinguishing human T cells from human tumor cells in the preparation of a universal human T cell product preclinical biodistribution detection kit based on mRNA, the primer-probe set comprising a primer pair and a probe for specifically distinguishing human T cells from human tumor cells; the primer pair is used to amplify the mRNA sequence shown in SEQ ID No. 1; the primer pair consists of a Primer-F forward primer and a Primer-R reverse primer, the Primer-F forward primer is the primer shown in SEQ ID No. 2, and the Primer-R reverse primer is the primer shown in SEQ ID No. 3; the probe is a Taqman probe with a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No.

4.

5. Use of an mRNA standard in the preparation of a product for specifically distinguishing human T cells from human tumor cells, wherein the sequence of the mRNA standard is an mRNA sequence as shown in SEQ ID No. 1 with an extended protection sequence as shown in SEQ ID No. 6 added to the 5' end and an extended protection sequence as shown in SEQ ID No. 7 added to the 3' end.

6. The use according to claim 5, characterized in that The sequence of the mRNA standard is the sequence shown in SEQ ID No.

5.

7. Application of the product for detecting the pharmacokinetic and biodistribution of human T cells in normal mice and tumor-bearing mice based on the mRNA sequence shown in SEQ ID No. 1.

Images