Radiation sensitive gene marker and application thereof in detecting ray radiation

Abstract

The invention provides a radiation-sensitive gene marker and application thereof in detection of ray radiation, the radiation-sensitive gene marker comprises a BAX gene, a DDB2 gene and an FDXR gene, in-vitro peripheral venous blood is irradiated by using different types of rays, the expression levels of the radiation-sensitive genes BAX gene, DDB2 gene and FDXR gene are detected, and the radiation-sensitive gene marker can be used for detecting the radiation-sensitive genes BAX gene, DDB2 gene and FDXR gene. Then carrying out Pathway analysis on common differential genes, verifying a sequencing result of in-vitro peripheral blood lymphocytes by utilizing a fluorescent quantitative PCR (Polymerase Chain Reaction) technology, and showing that relative expression quantities of BAX, DDB2 and FDXR genes irradiated in different modes have significant difference (plt; therefore, the method can be used for quickly diagnosing the radiation of people, and judging whether the human body is injured by the ionizing radiation or not according to the fitting curve of the BAX gene, the DDB2 gene and the FDXR gene by collecting blood, extracting total RNA (Ribonucleic Acid), performing reverse transcription and sequencing and utilizing the relative expression quantity of the BAX gene, the DDB2 gene and the FDXR gene of a fluorescent quantitative PCR (Polymerase Chain Reaction) control gene.

Description

Technical Field

[0001] The present invention relates to the technical field of radiation biology ray type detection, and in particular to radiation sensitive gene markers and their application in ray radiation detection. Background Art

[0002] With the widespread application of nuclear energy and nuclear technology in industry, medicine and other fields, the hazards and protection of ionizing radiation have received increasing attention. At the same irradiation dose, rays with high linear energy transfer (LET) (such as neutron irradiation) cause greater damage than rays with low LET (such as X-rays and gamma rays). Neutron radiation mainly occurs in clinical radiotherapy, nuclear power plant leaks, space navigation, high-altitude flights and atomic bomb explosions. Neutron radiation usually coexists with other ionizing radiation, which hinders neutron dose estimation and neutron damage risk assessment. Due to the different types of interactions between rays and matter, the radiation damage mechanisms between neutrons and gamma rays are also different. Neutrons are electrically neutral particles and do not cause ionization. They mainly produce secondary charged particles through interactions with atomic nuclei, affecting the structure and function of biological macromolecules. X-rays and gamma rays mainly interact with extranuclear electrons to cause ionization and excitation of matter. Due to the characteristics of the interaction between neutrons and matter, the radiation damage caused by neutrons to the body is more complex and difficult to repair, causing more serious health effects. At present, most of the health impact assessments of neutrons are based on the assumption that neutrons and gamma rays have the same contribution. However, this simplification is not accurate and may lead to a serious underestimation of health effects and the degree of damage. Summary of the invention

[0003] The invention discloses a radiation sensitive gene marker and its application in detecting ray radiation, aiming to solve the technical problems existing in the prior art.

[0004] The present invention adopts the following technical solutions:

[0005] In a first aspect, the present invention provides a radiation-sensitive gene marker, which is a BAX gene, a DDB2 gene and a FDXR gene. The Gene ID of the BAX gene in NCBI is 581, the Gene ID of the DDB2 gene in NCBI is 1643, and the Gene ID of the FDXR gene in NCBI is 2232. The relative expression levels of the BAX gene, the DDB2 gene and the FDXR gene increase with the increase of the irradiation dose.

[0006] In a second aspect, the present invention provides the use of radiation-sensitive gene markers in detecting radiation, wherein the use is for non-disease diagnosis and treatment purposes.

[0007] Preferably, the application comprises the following steps:

[0008] Different types of radiation were applied to the isolated peripheral venous blood to detect the gene expression levels of radiation-sensitive gene markers BAX, DDB2, and FDXR;

[0009] By irradiating lymphocytes with neutrons, the linear relationship between the relative expression level of sensitive gene markers BAX, DDB2 and FDXR and the neutron radiation dose was constructed, thereby obtaining the fitting curve between the relative expression level of sensitive gene markers and the radiation dose.

[0010] The actual radiation dose is determined based on the fitting curve of the relative expression level of the sensitive gene marker gene and the neutron radiation dose. Preferably, the irradiation of the ex vivo peripheral venous blood with different doses of radiation includes: 1.42Gy neutron irradiation; first receiving 0.71Gy neutron irradiation and then receiving 0.71Gy gamma ray irradiation; 1.42Gy gamma ray irradiation.

[0011] In a third aspect, the present invention provides a kit for detecting radiation doses of different types of rays, wherein the marker in the kit is the radiation sensitive gene marker described above.

[0012] In a fourth aspect, the present invention provides a use of a kit for preparing a kit for detecting radiation doses of different types of rays.

[0013] The present invention provides radiation sensitive gene markers and applications in detecting radiation. The radiation sensitive gene markers are BAX gene, DDB2 gene and FDXR gene. Different types of radiation are used to irradiate isolated peripheral venous blood, and the expression levels of the radiation sensitive genes BAX gene, DDB2 gene and FDXR gene are detected. Then, pathway analysis is performed on the common differential genes. The sequencing results of isolated peripheral blood lymphocytes are verified by using fluorescent quantitative PCR technology. The relative expression amounts of BAX, DDB2 and FDXR genes irradiated in different ways are significantly different (p<0.05). Therefore, the method can be used to quickly diagnose radiation in the population. Blood is collected, total RNA is extracted, reverse transcribed and sequenced, and the relative expression amounts of BAX gene, DDB2 gene and FDXR gene of the control gene are used by fluorescent quantitative PCR. According to the fitting curves of BAX gene, DDB2 gene and FDXR gene, it is judged whether the damage to the human body is caused by ionizing radiation. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The figure shows the result of screening differentially expressed genes for each radiation data set provided in Experimental Example 2 of the present invention;

[0015] Figure 2The figure shows the GO enrichment analysis diagram of the common differentially expressed genes after irradiation with different rays provided in Experimental Example 3 of the present invention;

[0016] Figure 3 Shown is the fitting curve of the basic relative expression level of the BAX gene after irradiation at different doses in Experimental Example 6 of the present invention;

[0017] Figure 4 Shown is a fitting curve of the basic relative expression level of the DDB2 gene after irradiation at different doses in Experimental Example 6 of the present invention;

[0018] Figure 5 Shown is a fitting curve of the basic relative expression level of the FDXR gene after different doses of irradiation in Experimental Example 6 of the present invention. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the specific embodiments of the present invention and the corresponding drawings. In the description of the present invention, it should be noted that the term "or" is usually used in the sense of including "and / or", unless the content clearly indicates otherwise.

[0020] Experimental Example 1: Screening of radiation-sensitive gene markers

[0021] 1. Collection of samples from subjects

[0022] All procedures of this study were approved by the Medical Ethics Committee of Shanxi Medical University. After the subjects (or agents) had fully informed consent, peripheral venous blood samples were collected from three healthy adult males, 20 ml of blood was collected from each person, and each was placed in 12 5 ml hepatic EDTAK2 anticoagulation vacuum blood collection tubes. The subjects were aged 20-30 years, had no chronic disease, no smoking history, and no history of radiation and viral infection 6 months before blood collection.

[0023] 2. Irradiation and grouping

[0024] The neutron source was produced by the high-intensity deuterium-deuterium neutron source scientific facility HINEG-I of the Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, with an irradiation energy of 2.5 MeV, a dose rate of 1 Gy / h, and absorbed doses of 0.71 Gy and 1.42 Gy respectively; the gamma rays were produced by the Biobeam137Cs radiator of the Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences (Beijing Tongfang Company), with a gamma ray dose rate of 3.352 Gy / min, and absorbed doses of 0.71 Gy and 1.42 Gy respectively.

[0025] Group A: human peripheral venous blood not irradiated with neutrons;

[0026] Group B: human peripheral venous blood irradiated with 1.42 Gy neutrons;

[0027] Group C: human peripheral venous blood was first irradiated with 0.71 Gy neutrons and then with 0.71 Gy gamma rays;

[0028] Group D: Human peripheral venous blood was irradiated with 1.42 Gy of γ-rays.

[0029] 3. Isolation of human peripheral blood lymphocytes

[0030] The blood samples of each group of samples after irradiation were used to extract human peripheral blood lymphocytes.

[0031] a. Take a 15 ml centrifuge tube and add an equal amount of separation solution to the blood sample;

[0032] b. Use a pipette to draw a human peripheral venous blood sample and add it to the surface of the separation solution. Centrifuge at 600-800g for 20-30min;

[0033] c. After centrifugation, the centrifuge tube is divided into four layers from top to bottom. The top layer is the plasma layer; the second layer is the ring-shaped milky white lymphocyte layer; the third layer is the transparent separation liquid layer; and the fourth layer is the red blood cell layer. Use a pipette to draw the second ring-shaped milky white lymphocyte layer into another 15ml centrifuge tube, add 10ml of washing solution to the centrifuge tube, and mix the lymphocytes;

[0034] d. Centrifuge the mixed lymphocytes at 250g for 10 min.

[0035] e. Discard the supernatant, use a pipette to take 5 ml of washing solution to resuspend the cells; centrifuge at 250 g for 10 min;

[0036] f. Repeat step e and discard the supernatant to obtain lymphocytes.

[0037] 4. Extraction of total RNA from lymphocyte samples of each group after irradiation

[0038] a. Take 600 μl of lymphocyte samples from group A, group B, group C, and group D, add 600 μl of Lysis / Binding Buffer to homogenize, add 30 μl of miRNA Homogenate Additive to mix well, and place on ice for 10 min;

[0039] b. Add phenol (acid phenol) chloroform in the same volume as the lymphocytes. Centrifuge at maximum speed for 5 minutes at room temperature and collect the supernatant;

[0040] c. Add 1.25 times the volume of anhydrous ethanol to the lymphocytes to form a mixed solution;

[0041] d. Add the mixture to the centrifuge column (up to 700 μL), centrifuge at 13,000 rpm for 30 seconds at room temperature, and discard the supernatant;

[0042] e. Add 350 μL of miRNA Wash Solution 1 to the centrifuge column, centrifuge at 13,000 rpm for 30 seconds, discard the supernatant, and place the centrifuge column back into the collection tube;

[0043] f. Mix 10 μL of DNaseI and 70 μL of BufferRDD (QIAGEN#79254), then add to the membrane in the spin column and leave at room temperature for 15 minutes;

[0044] g. Add 350 μL of miRNA Wash Solution 1 to the centrifuge column, centrifuge at 13,000 rpm for 30 seconds, discard the supernatant, and place the centrifuge column back into the collection tube;

[0045] h. Pass 500 μL of WashSolution 2 / 3 through the column twice, centrifuge at 13,000 rpm for 30 seconds, discard the supernatant, and place the centrifuge column back into the collection tube;

[0046] i. After centrifuging the hollow column for 1 minute, place the centrifuge column in a new collection tube, add 100 μL of 95°C preheated Elution Solution to the center of the hollow column and place it for 2 minutes. Centrifuge at 13000 rpm for 20-30 seconds at room temperature. The liquid in the collection tube is the extracted total RNA, which is stored at -70°C.

[0047] 5. Transcriptome library construction and sequencing

[0048] The TruSeq Stranded Total RNA with Ribo-Zero Gold kit (IlluminaR) was used to digest ribosomal RNA, and the total RNA was sheared into short fragments by adding a shearing reagent. The sheared short RNA fragments were used as templates to synthesize a single-strand cDNA using a six-base random primer. Then, a two-strand synthesis reaction system was prepared to synthesize a second-strand cDNA. During the synthesis of the second-strand cDNA, dUTP was used instead of dTTP. Then, different adapters were connected. Then, the UNG enzyme method was used to digest one strand containing dUTP, and only the cDNA strand with different adapters of the connected strands was retained. The first strand of cDNA was purified using a kit. The purified first strand of cDNA was then end-repaired, A-tailed, and connected to sequencing adapters, and then the fragment size was selected, and finally PCR amplification was performed. After the constructed library was qualified by Agilent 2100 Bioanalyzer, it was sequenced using an Illumina sequencer. Library construction and sequencing were completed by Shanghai Ouyi Biomedical Technology Co., Ltd.

[0049] 6. Bioinformatics analysis

[0050] Fastqc software was used to perform quality control on the transcriptome data obtained by sequencing, and trimmomatic software was used to filter the sequencing data and obtain clean reads.

[0051] HISAT2 software was used to align clean reads to the reference genome, and Stringtie software was used to assemble reads. After clean reads were aligned to the transcription template using Bowtie2 software, transcripts were quantified using eXpress software to obtain the FPKM value of mRNA (using the known reference gene sequence and annotation file as the database, the sequence similarity alignment method was used to identify the expression abundance of each protein-coding gene in each sample, and the htseq-count software was used to obtain the number of reads aligned to the protein-coding gene in each sample, and then the FPKM value of the protein-coding gene expression was calculated according to the FPKM formula) and counts (the number of reads falling into a specific transcript interval). The DESeq software estimate SizeFactors function was used to standardize the counts to obtain the basemean value, and the nbinomTest function was used for significance testing, and the p-value and foldchange values ​​for difference comparison were calculated. The FDR error control method was used to correct the p-value for multiple hypothesis testing.

[0052] 7. Real-time fluorescence quantitative PCR detection

[0053] Real-time fluorescence quantitative PCR (RT-PCR) was used to analyze the changes in mRNA expression of different genes. The reaction conditions of RT-PCR were 95℃10s, 95℃5s, 60℃20s (40 cycles), and the ΔΔCt method was used for relative quantitative analysis of the mRNA expression level of each gene. The primer sequences of each gene are shown in Table 1.

[0054] Table 1 mRNA primer design sequence list

[0055] Gene Forward primer (5'-3') Reverse primer (5'-3') AEN CCATCGCTGACTACCGTACC GGCCCACCTGGATCTTCTTG BAX CCGAGAGGTCTTTTTCCGAGT GCTGGCAAAGTAGAAAAGGGC DDB2 CCAACCAGTTTTACGCCTCC TTCAGCAGGATCACGTTCCC FDXR CTGAGGCAGAGTCGAGTGAAG CCCGAAGCTCCTTAATGGTGA MDM2 GCCCTTCGTGAGAATTGGCT AAGCCCTCTTCAGCTTGTGT

[0056] Experimental Example 2 Analysis of gene expression differences after exposure to different radiation

[0057] The transcriptome data obtained by sequencing were quality controlled, filtered, assembled, and transcribed using fastqc software to obtain the FPKM value of mRNA. Differentially expressed genes were screened for each radiation data set. The screening conditions for differentially expressed genes were p-value < 0.05 and foldchange > 2 or foldchange < 0.5. Figure 1 The results of differentially expressed genes screening for each radiation data set provided in Experimental Example 2 of the present invention are shown in FIG. Figure 1 As shown, Figure 1 A. Figure 1 B. Figure 1 C represents the volcano plot, which shows the distribution of differentially expressed genes in neutron, neutron + γ ray, and γ ray. Figure 1 D. Figure 1 E. Figure 1 F represents the volcano plot, which shows 56 common differentially expressed genes in groups B, C, and D, 52 up-regulated genes, and 4 down-regulated genes.

[0058] Peripheral blood of three healthy adult males was irradiated with 1.42Gy neutrons (group B), 0.71Gy neutrons + 0.71Gy γ irradiation (group C), and 1.42Gy γ irradiation (group D). Compared with group A (not irradiated), groups B, C, and D all showed significant changes. Compared with group A, 303 genes were differentially expressed in group B, of which 153 genes were up-regulated and 150 genes were down-regulated ( Figure 1 A, D). Compared with group A, group C had 244 differentially expressed genes in three healthy adult males, of which 205 genes were up-regulated and 39 genes were down-regulated ( Figure 1 B, E). Compared with group A, group D had 197 differentially expressed genes in three healthy adult males, of which 139 genes were up-regulated and 58 genes were down-regulated ( Figure 1 C, F). There were 56 differentially expressed genes in groups B, C, and D, of which 52 genes were up-regulated and 4 genes were down-regulated.

[0059] Experimental Example 3 GO analysis of differentially expressed genes under different radiation exposures

[0060] The GO functional annotation analysis of differentially expressed genes was performed through the http: / / www.geneontology.org website. Figure 2 This is the GO enrichment analysis diagram of the common differentially expressed genes after different radiation irradiation provided in Experimental Example 3 of the present invention. Figure 2 A is the enrichment map of GO terms commonly involved in different irradiation methods; Figure 2 B is the distribution diagram of the common secondary GO Terms for different irradiation methods, such as Figure 2 As shown in the figure, the number of GO terms enriched in common by different irradiation methods in groups B, C, and D were 1123, 919, and 817, respectively. GO analysis was performed on the common differentially expressed genes in groups B, C, and D. The three groups had 289 common enriched GO terms, of which 119 were significantly different (p<0.05), including 48 second-level GO terms, which were related to bioadhesion, bioregulation, immune system processes, metabolic processes, positive and negative regulation of biological processes, response to stimuli, and protein activity.

[0061] Experimental Example 4 KEGG analysis of differentially expressed genes under different radiation exposures

[0062] KEGG signal pathway analysis was performed on the differentially expressed genes through the website https: / / www.genome.jp / kegg. Pathway analysis was performed on the differentially expressed genes in combination with the KEGG database. Table 3 is a table of common differentially expressed gene enrichment pathways. The results showed that neutron irradiation induced 199 pathways, with 37 significant pathway pathways (p<0.05). Neutron + γ irradiation induced 199 pathways, with 24 significant pathway pathways (p<0.05). γ irradiation induced 208 pathways, with 39 significant pathway pathways (p<0.05). There were 108 common pathways among groups B, C and D, of which 26 pathways had significant differences (p<0.05), including platinum drug resistance pathway, nucleotide excision repair pathway, cytokine-cytokine receptor interaction pathway, p53 signaling pathway, transcriptional misregulation in cancer pathway, colorectal cancer pathway, pancreatic cancer pathway, endometrial cancer pathway, etc.

[0063] Table 3 Common differentially enriched pathways

[0064]

[0065]

[0066] Experimental Example 5 Verification of differentially expressed genes under different radiation exposures

[0067] In order to further verify the differentially expressed mRNA in the expression profile, five genes with large differences in expression profile and p53 signaling pathway were selected compared with the irradiation group, including AEN, BAX, DDB2, FDXR, and MDM2. Fluorescence quantitative PCR technology was used to verify the sequencing results of peripheral blood lymphocytes of the three subjects. The results showed that the relative expression levels of AEN, BAX, DDB2, FDXR, and MDM2 genes in the three different irradiation groups were significantly different from those in the control group (p<0.05). The results are shown in Table 4, which are consistent with the sequencing results.

[0068] Table 4 Transcriptome validation results

[0069]

[0070]

[0071] Experimental Example 6 Human lymphocyte cell line 252 Study on the Dose-Effect Relationship of Cf Neutron Irradiation

[0072] 1. Cell Culture

[0073] Human lymphocyte cell line AHH-1 (purchased from the American Type Culture Collection (Manassas, VA, USA)) was inoculated in RPMI 1640 medium containing 10% fetal bovine serum and 0.1 U / L penicillin-streptomycin mixture and cultured in a 37°C, 5% CO2 incubator. When the cell growth density was about 1×10 7 / ml, and cells in the logarithmic growth phase were taken for the next experiment.

[0074] 2. Cell Irradiation

[0075] 252 Cf neutron source, average neutron energy 2.13MeV, dose rate 0.1Gy / h, absorbed doses 0, 0.14, 0.35, 0.71Gy.

[0076] 3. Extraction of total cell RNA and synthesis of cDNA

[0077] Total RNA of lymphocyte line AHH-1 was extracted using RNAprep pure cultured cell total RNA extraction kit. RNA reverse transcription was performed using PrimeScriptlM RT kit to synthesize cDNA. 100-200ng of RNA was added to 20μl of reaction system, which consisted of 1μL of 5×FastKing-RTEnzymeMix, 2μL of 10×KingRTBuffer, 2μL of EQ-RTPtimerMix and 10μL of gDNA removal system containing TotalRNA template. Reaction conditions: 42℃, 15min; 95℃, 3min to terminate the reaction, and stored at -20℃.

[0078] 4. Real-time fluorescence quantitative PCR detection: Real-time fluorescence quantitative PCR (RT-PCR) was used to analyze the changes in the mRNA expression of different genes. The reaction conditions were 95°C for 10s; 95°C for 5s, 60°C for 20s (40 cycles). The ΔΔCt method was used for relative quantitative analysis of the mRNA expression level of each gene. The primer sequences of each gene are shown in Table 1.

[0079] Using different doses of 0, 0.14, 0.35, and 0.71 Gy 252 Cf (Californium-252) neutron source irradiated human lymphocyte cell line AHH-1, and found that the relative expression of BAX, DDB2, and FDXR genes increased with the increase of irradiation dose. At 0.35Gy, the relative expression of BAX and FDXR genes was significantly different from that at 0Gy (t=-8.32, p<0.05; t=-4.85, p<0.05). At 0.71Gy, the relative expression of BAX, DDB2, and FDXR genes was significantly different from that at 0Gy (t=-20.89, p<0.05; t=-30.67, p<0.05; t=-10.83, p<0.05). Figure 3 Shown is the fitting curve of the basic relative expression level of the BAX gene after irradiation at different doses in Experimental Example 6 of the present invention; Figure 4 Shown is a fitting curve of the basic relative expression level of the DDB2 gene after irradiation at different doses in Experimental Example 6 of the present invention; Figure 5 The figure shows the fitting curve of the basic relative expression level of the FDXR gene after different doses of irradiation in Experimental Example 6 of the present invention. Figure 3-Figure 5 As shown in Figure 2, the relative expression levels of BAX, DDB2, and FDXR genes after different doses of irradiation were fitted with curves, and there was an obvious dose-response relationship (R 2 They are 0.803, 0.999, and 0.999 respectively) and the results are shown in Table 5.

[0080] Table 5 Fitting equations for BAX, DDB2, and FDXR genes

[0081]

[0082]

[0083] Therefore, BAX, DDB2, and FDXR genes can be used for rapid radiation diagnosis of the population. After nuclear exposure occurs, the medical station collects blood from people suspected of being exposed to radiation; extracts total RNA from the collected blood and performs reverse transcription; uses real-time fluorescence quantitative PCR technology to analyze changes in mRNA expression of different genes; and based on the fitting equations of the BAX, DDB2, and FDXR genes, it can be quickly determined whether the degree of damage to the human body is caused by ionizing radiation.

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A radiation sensitive gene marker, characterized in that: The radiation-sensitive gene markers are BAX gene, DDB2 gene and FDXR gene, wherein the GeneID of the BAX gene in NCBI is 581, the GeneID of the DDB2 gene in NCBI is 1643, and the GeneID of the FDXR gene in NCBI is 2232. The relative expression levels of the BAX gene, the DDB2 gene and the FDXR gene increase with the increase of the irradiation dose.

2. Use of the radiation-sensitive gene marker according to claim 1 in detecting radiation, wherein the use is for non-disease diagnosis and treatment purposes.

3. The use according to claim 2, characterized in that: The application includes the following steps: Different types of radiation were applied to the isolated peripheral venous blood to detect the gene expression levels of radiation-sensitive gene markers BAX, DDB2, and FDXR; By irradiating lymphocytes with neutrons, a linear relationship between the relative expression level of sensitive gene markers BAX, DDB2 and FDXR and the neutron radiation dose was constructed, thereby obtaining a fitting curve between the relative expression level of sensitive gene markers and the neutron radiation dose. The actual radiation dose is determined based on the fitting curve between the relative expression level of the sensitive gene marker gene and the neutron radiation dose.

4. The use according to claim 3, characterized in that: The different types of radiation irradiation performed on the ex vivo peripheral venous blood include: 1.42 Gy neutron irradiation; first receiving 0.71 Gy neutron irradiation and then receiving 0.71 Gy gamma ray irradiation; 1.42 Gy gamma ray irradiation.

5. A kit for detecting radiation doses of different types of radiation, characterized in that: The marker in the kit is the radiation-sensitive gene marker according to claim 1.

6. Use of the kit according to claim 5 in preparing a kit for detecting radiation doses of different types of rays.

Images