Primer group and kit for detecting antipsychotic gene and application

Abstract

The invention relates to a primer group and a kit for detecting antipsychotic drug genes and application, and relates to the technical field of biology, the primer group comprises 39 groups, and the sequences of the 39 groups of primer groups are as shown in SEQ ID NO: 1-117; the 39 primer groups respectively correspond to 38 detection sites of four drug metabolic enzyme genes, and the established detection method can effectively detect mutation conditions of 38 SNP sites, so that polymorphism detection of the four drug metabolic enzyme genes is realized; the method has the advantages of being high in speed, low in cost, high in sensitivity, easy to realize multi-system and multi-site joint detection and the like; according to the kit for detecting the antipsychotic drug genes, samples can be uniformly distributed in different reaction cavities, cross contamination among different reaction holes is prevented, interpretation is facilitated, the use amount of the samples is reduced, and the experiment cost is saved, so that high-throughput and high-sensitivity simultaneous detection of multiple gene loci is realized; and the polymorphism detection of the antipsychotic drug gene is more efficient and accurate.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a primer set, a kit and an application thereof for detecting antipsychotic drug genes. Background Art

[0002] The main intervention for mental illness is drug therapy. Genetic variation in drug metabolism, transport, and drug target genes and changes in their expression levels can affect the drug's concentration and sensitivity in the body, leading to individual differences in drug responsiveness. Among them, genetic factors account for an average of 60% of the differences in drug metabolism and efficacy between individuals, and for some drugs, even up to 95%.

[0003] In recent years, with the development of human genomics, the field of pharmacogenomics has developed rapidly, and more and more pharmacogenomic biomarkers and their detection methods have emerged. Pharmacogenomics has become an important tool for guiding clinical individualized medication, assessing the risk of serious adverse drug reactions, guiding new drug development and evaluating new drugs. Seven major categories of testing projects have been developed in the field of psychotropic pharmacogenomics, with as many as 90 drugs tested, which basically covers all psychotropic drugs and chronic disease drugs approved by the FDA and marketed in China.

[0004] The Pharmacogenetics Knowledge Base (PharmGKB) divides personalized drug genetic testing projects into four levels according to the maturity of the projects, and believes that level 1 projects meet the highest standards for clinical application. Level 1A projects are projects that are recognized by the Clinical Pharmacogenetics Implementation Consortium (CPIC), medical societies that recognize CPIC's pharmacogenomics guidelines, and the Pharmacogenomics Research Network (PGRN) of the National Institutes of Health. Such projects are usually demonstrated by large-scale randomized controlled clinical trials (RCTs) to demonstrate the significance of the projects; Level 1B projects have definite clinical evidence suggesting correlation, and this correlation has been confirmed by studies with a certain sample size, but further clinical evidence is needed. There are 20 level 1A drugs used to treat mental illnesses, including amitriptyline, imipramine, and atomoxetine. CYP2B6, CYP2C9, CYP2C19, and CYP2D6 genes are the main drug metabolizing enzyme genes in the liver, and their single nucleotide polymorphisms are related to adverse reactions to antipsychotic drugs.

[0005] At present, similar products and related patents on the market involve a total of 16 methodologies, most of which are PCR-fluorescent probe method and fluorescent PCR melting curve method. A few products use time-of-flight mass spectrometry, PCR-gold magnetic particle chromatography, DNA microarray chip method, capillary electrophoresis, pyrophosphate sequencing, PCR-electrochemical gene chip method, flow cytometry method-FITC / PerCP, PCR-SSP method, etc., which have disadvantages such as expensive supporting equipment, cumbersome operation, long detection cycle, and easy contamination. Therefore, it is very necessary to develop a detection method or detection product that is simple to operate, fast, low-cost, and not easy to contaminate multiple genes and multiple sites simultaneously to meet market and clinical needs. In view of this, the present invention provides a primer set, a kit, and an application for detecting antipsychotic drug genes. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a primer set, a kit and an application for detecting antipsychotic drug genes. The purpose is to be used for genotyping detection of 47 alleles of four drug metabolizing enzyme genes, CYP2B6 (NG_007929.1), CYP2C9 (NG_008385.2), CYP2C19 (NG_008384.3) and CYP2D6 (NG_008376.4), so as to facilitate the guidance of clinical individualized medication.

[0007] The present invention targets the published authoritative guidelines, relevant databases and professional literature such as FDA, NMPA, PharmGKB and CPIC, and according to their clinical significance and gene frequencies, screens out 4 genes (CYP2B6 (NG_007929.1), CYP2C9 (NG_008385.2), CYP2C19 (NG_008384.3) and CYP2D6 (NG_008376.4)) with a total of 38 target sites, designs primers according to their relevant genetic information, and realizes genotyping by using a microfluidic chip combined with competitive allele-specific amplification technology.

[0008] The technical solution of the present invention to solve the above technical problems is as follows:

[0009] In a first aspect, a primer set for detecting antipsychotic drug genes is provided, wherein the primer set comprises 39 sets, and the sequences of the 39 sets of primer sets are shown in SEQ ID NOs: 1-117.

[0010] Furthermore, the primer set is used for genotyping detection of a total of 47 alleles of four genes, namely CYP2B6, CYP2C9, CYP2C19 and CYP2D6.

[0011] Further, the first set of primers is shown in the sequence listing SEQ ID NO: 1-3, and is used to detect the c.64 (rs8192709, C>T) site of the CYP2B6 gene;

[0012] The second set of primers are shown in SEQ ID NO: 4-6 in the sequence listing, and are used to detect the c.516 (rs3745274, G>T) site of the CYP2B6 gene;

[0013] The third set of primers is shown in the sequence listing as SEQ ID NO: 7-9, and is used to detect the c.785 (rs2279343, A>G) site of the CYP2B6 gene;

[0014] The fourth set of primers are shown in the sequence listing as SEQ ID NOs: 10-12, and are used to detect the c.1459 (rs3211371, C>T) site of the CYP2B6 gene;

[0015] The fifth set of primers is shown in the sequence listing as SEQ ID NO: 13-15, and is used to detect the c.269 (rs72558187, T>C) site of the CYP2C9 gene;

[0016] The sixth set of primers is shown in the sequence listing as SEQ ID NO: 16-18, and is used to detect the c.353_362 (rs1304490498, AGAAATGGAA>-) site of the CYP2C9 gene;

[0017] The seventh set of primers is shown in the sequence listing as SEQ ID NO: 19-21, and is used to detect the c.371 (rs12414460, G>A) site of the CYP2C9 gene;

[0018] The eighth set of primers is shown in the sequence listing as SEQ ID NOs: 22-24, and is used to detect the c.389 (rs200965026, C>G) site of the CYP2C9 gene;

[0019] The ninth set of primers is shown in the sequence listing as SEQ ID NOs: 25-27, and is used to detect the c.430 (rs1799853, C>T) site of the CYP2C9 gene;

[0020] The tenth set of primers is shown in the sequence listing as SEQ ID NO: 28-30, and is used to detect the c.449 (rs7900194, G>A) site of the CYP2C9 gene;

[0021] The eleventh set of primers is shown in the sequence listing as SEQ ID NOs: 31-33, and is used to detect the c.449 (rs7900194, G>T) site of the CYP2C9 gene;

[0022] The twelfth set of primers is shown in the sequence listing as SEQ ID NOs: 34-36, and is used to detect the c.641 (rs2031531005, A>T) site of the CYP2C9 gene;

[0023] The thirteenth set of primers is shown in the sequence listing as SEQ ID NOs: 37-39, and is used to detect the c.835 (rs182132442, C>A) site of the CYP2C9 gene;

[0024] The fourteenth set of primers is shown in the sequence listing as SEQ ID NOs: 40-42, and is used to detect the c.895 (rs72558192, A>G) site of the CYP2C9 gene;

[0025] The fifteenth set of primers is shown in the sequence listing as SEQ ID NOs: 43-45, and is used to detect the c.980 (rs57505750, T>C) site of the CYP2C9 gene;

[0026] The sixteenth set of primers is shown in the sequence listing as SEQ ID NOs: 46-48, and is used to detect the c.1075 (rs1057910, A>C) site of the CYP2C9 gene;

[0027] The seventeenth set of primers is shown in the sequence listing as SEQ ID NO: 49-51, and is used to detect the c.1081 (rs1250577724, C>A) site of the CYP2C9 gene;

[0028] The eighteenth set of primers is shown in the sequence listing as SEQ ID NOs: 52-54, and is used to detect the c.1429 (rs781583846, G>A) site of the CYP2C9 gene;

[0029] The nineteenth set of primers is shown in the sequence listing as SEQ ID NOs: 55-57, and is used to detect the c.-806 (rs12248560, C>T) site of the CYP2C19 gene;

[0030] The twentieth set of primers is shown in the sequence listing as SEQ ID NO: 58-60, and is used to detect the c.55 (rs17882687, A>C) site of the CYP2C19 gene;

[0031] The twenty-first set of primers is shown in the sequence listing as SEQ ID NOs: 61-63, and is used to detect the c.332-23 (rs12769205, A>G) site of the CYP2C19 gene;

[0032] The twenty-second set of primers is shown in the sequence listing as SEQ ID NOs: 64-66, and is used to detect the c.636 (rs4986893, G>A) site of the CYP2C19 gene;

[0033] The twenty-third set of primers is shown in the sequence listing as SEQ ID NOs: 67-69, and is used to detect the c.681 (rs4244285, G>A) site of the CYP2C19 gene;

[0034] The twenty-fourth set of primers is shown in the sequence listing as SEQ ID NOs: 70-72, and is used to detect the c.986 (rs138142612, G>A) site of the CYP2C19 gene;

[0035] The twenty-fifth set of primers is shown in the sequence listing as SEQ ID NOs: 73-75, and is used to detect the c.991 (rs3758581, A>G) site of the CYP2C19 gene;

[0036] The twenty-sixth set of primers is shown in the sequence listing as SEQ ID NOs: 76-78, and is used to detect the c.1297 (rs56337013, C>T) site of the CYP2C19 gene;

[0037] The twenty-seventh set of primers is shown in the sequence listing as SEQ ID NOs: 79-81, and is used to detect the c.100 (rs1065852, C>T) site of the CYP2D6 gene;

[0038] The twenty-eighth set of primers is shown in the sequence listing as SEQ ID NOs: 82-84, and is used to detect the c.358 (rs1135822, T>A) site of the CYP2D6 gene;

[0039] The twenty-ninth set of primers is shown in the sequence listing as SEQ ID NOs: 85-87, and is used to detect the c.505 (rs5030865, G>T) site of the CYP2D6 gene;

[0040] The 30th set of primers is shown in the sequence listing as SEQ ID NOs: 88-90, and is used to detect the c.506-1 (rs3892097, G>A) site of the CYP2D6 gene;

[0041] The thirty-first set of primers is shown in the sequence listing as SEQ ID NOs: 91-93, and is used to detect the c.547 (A>insTA) site of the CYP2D6 gene;

[0042] The 32nd set of primers is shown in the sequence listing as SEQ ID NO: 94-96, and is used to detect the c.806 (rs72549352, G>insG) site of the CYP2D6 gene;

[0043] The 33rd set of primers is shown in the sequence listing as SEQ ID NOs: 97-99, and is used to detect the c.841_843 (rs5030656, AAG>-) site of the CYP2D6 gene;

[0044] The thirty-fourth set of primers is shown in the sequence listing as SEQ ID NO: 100-102, and is used to detect the c.886 (rs16947, C>T) site of the CYP2D6 gene;

[0045] The thirty-fifth set of primers is shown in the sequence listing as SEQ ID NOs: 103-105, and is used to detect the c.985+39 (rs28371725, G>A) site of the CYP2D6 gene;

[0046] The thirty-sixth set of primers is shown in the sequence listing as SEQ ID NOs: 106-108, and is used to detect the c.1252 (rs28371733, G>A) site of the CYP2D6 gene;

[0047] The thirty-seventh set of primers is shown in the sequence listing as SEQ ID NO: 109-111, and is used to detect E9-conw of the CYP2D6 gene;

[0048] The thirty-eighth set of primers is shown in the sequence listing as SEQ ID NOs: 112-114, and is used to detect the c.1412 (rs765776661, G>insTGCCCACTG) site of the CYP2D6 gene;

[0049] The thirty-ninth set of primers is shown in the sequence listing as SEQ ID NO: 115-117, and is used to detect the c.1457 (rs1135840, G>C) site of the CYP2D6 gene.

[0050] Furthermore, the 39 primer sets are respectively composed of two forward primers designed based on gene sequence differences and one reverse common primer.

[0051] Further, among the 39 sets of primer sets, SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 52, SEQ ID NO: 55, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, SEQ ID NO: 85, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 97, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 106, SEQ ID NO: 109, SEQ ID NO: 112, SEQ ID NO: 115 carry the common sequence tag GAAGGTCGGAGTCAACGGATT;

[0052] Among the 39 primer sets, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 92, SEQ ID NO: 95, SEQ ID NO: 98, SEQ ID NO: 101, SEQ SEQ ID NO: 104, SEQ ID NO: 107, SEQ ID NO: 110, SEQ ID NO: 113, SEQ ID NO: 116 carry the universal sequence tag GAAGGTGACCAAGTTCATGCT.

[0053] In a second aspect, a kit for detecting antipsychotic drug genes is provided, the kit comprising at least one primer set among the primer sets for detecting antipsychotic drug genes.

[0054] Further, the kit includes primer sets of groups 1-4, and / or primer sets of groups 5-18, and / or primer sets of groups 19-26, and / or primer sets of groups 27-39.

[0055] Furthermore, the kit includes at least 42 chip reaction pools and at least 4 positioning points; the chip reaction pools include at least 1 internal reference quality control reaction pool, at least 1 negative quality control reaction pool, and at least 1 positive quality control reaction pool, and each of the remaining chip reaction pools is respectively coated with one of the primer sets for detecting antipsychotic drug genes.

[0056] In a third aspect, the kit for detecting antipsychotic drug genes comprises the following steps:

[0057] (1) selecting a primer set for detecting an antipsychotic drug gene, formulating a well position table for the selected primer set, and coating the primer sets in reaction pools of a chip substrate according to the well position table to obtain a semi-finished chip;

[0058] (2) preparing a PCR amplification reagent, wherein the PCR amplification reagent includes a PCR reaction solution and a PCR buffer;

[0059] (3) Assembling the chip semi-finished product, the PCR amplification reagent, the sealing film, and the quality control product into a kit for detecting antipsychotic drug genes.

[0060] In a fourth aspect, a reagent for detecting antipsychotic drug genes comprises the primer set for detecting antipsychotic drug genes or the kit for detecting antipsychotic drug genes.

[0061] The present invention provides a primer set for detecting antipsychotic drug genes, the primer set comprising 39 primer sets. The primers have been optimized and designed, have similar annealing temperatures, can be amplified under the same PCR amplification conditions, and simultaneously detect the genetic information of 38 target sites of 4 genes; the primer sets are respectively composed of two forward primers designed based on gene sequence differences and a common reverse primer.

[0062] Using human genomic DNA as a template, a microfluidic chip combined with competitive allele-specific amplification technology is used to detect the target SNP site, which can place each detection indicator in a separate reaction pool for detection; in each reaction pool, site-specific primers and fluorescent probes with universal Tag sequences are used to amplify and fluorescently label the fragments where the relevant sites are located. After the reaction is completed, the information of each mutation site is obtained by reading the fluorescent signal.

[0063] The beneficial effects of the present invention are:

[0064] (1) The 39 primer sets of the present invention correspond to 38 detection sites of 4 drug metabolizing enzyme genes respectively. The established detection method can effectively detect the mutation status of 38 SNP sites and realize the polymorphism detection of 4 drug metabolizing enzyme genes.

[0065] (2) The primer sets included in the present invention have similar annealing temperatures, which can enable all primers to react simultaneously under the same PCR conditions; thus, the detection efficiency and reaction sensitivity are increased; and the use of the primer sets for detection has the advantages of fast speed, low cost, high sensitivity, and easy realization of multi-gene multi-site joint detection.

[0066] (3) The kit for detecting antipsychotic drug genes of the present invention can not only achieve uniform distribution of samples in different reaction chambers and prevent cross-contamination between different reaction wells, but also greatly reduce the amount of sample used and save experimental costs, thereby achieving high-throughput, high-sensitivity, stable and efficient simultaneous detection of multiple gene sites, making the detection of drug metabolizing enzyme gene polymorphism more efficient and accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The 39 detection site information and corresponding fluorescence signal diagrams of the present invention;

[0068] Figure 2 This is a structural diagram of the chip substrate of the test kit of the present invention;

[0069] Figure 3 This is an example diagram of the fluorescence and interpretation results of the antipsychotic drug gene detection chip of sample 01 of the present invention;

[0070] Figure 4 This is an example diagram of the fluorescence and interpretation results of the antipsychotic drug gene detection chip of sample 02 of the present invention;

[0071] Figure 5 This is an example diagram of the fluorescence and interpretation results of the antipsychotic drug gene detection chip of sample 03 of the present invention;

[0072] Figure 6 This is an example diagram of the fluorescence and interpretation results of the antipsychotic drug gene detection chip of sample 04 of the present invention;

[0073] Figure 7 This is an example diagram of the fluorescence and interpretation results of the antipsychotic drug gene detection chip of sample 05 of the present invention;

[0074] Figure 8 The genotyping and sequencing results of psychotropic drug metabolizing enzymes corresponding to the sample of the present invention are Figure I ;

[0075] Fig. 9 The genotyping and sequencing results of psychotropic drug metabolizing enzymes corresponding to the sample of the present invention are Figure II ;

[0076] Fig.10 The genotyping and sequencing results of psychotropic drug metabolizing enzymes corresponding to the sample of the present invention are Figure III ;

[0077] Fig.11 The genotyping and sequencing results of psychotropic drug metabolizing enzymes corresponding to the sample of the present invention are Figure IV . DETAILED DESCRIPTION

[0078] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0079] Example

[0080] 1. Primer design

[0081] The reference sequence of each allele is determined based on public data from FDA, NMPA, PharmGKB, CPIC, etc. The metabolic type and site information of each allele are determined by consulting a large amount of relevant literature, clinical data, and accumulating experimental data. Primers are designed based on the above genetic information.

[0082] Based on the principle of competitive allele-specific PCR, accurate double allele judgment was performed on SNPs or DNA fragment deletion (Del) or insertion (Ins) at specific sites. 39 primer sets were designed for simultaneous detection of 38 sites of 4 genes. Each primer set contained two primers designed based on allele sequence site differences and a common paired primer. The gene sequences of the primer sets are shown in SEQ ID NO: 1-117.

[0083] 2. Kit Preparation

[0084] On the basis of the above, 39 primer sets were selected to prepare a kit for detecting antipsychotic drug genes to illustrate the kit of the present invention and its preparation method. Each primer set in the kit consists of three primers, and the primer set is pre-coated in the chip reaction pool ( Figure 2 ); sample DNA, PCR reaction solution (KASP Master Mix, LGC) and TE buffer constitute the PCR reaction system, wherein the sample genomic DNA must meet the concentration of not less than 10 ng / μL, and the OD value (260 / 280) is 1.7-2.0; the PCR reaction solution includes probe, enzyme, and dNTPs; the main component of the PCR buffer is 1×TE, which is used to complete the PCR reaction system.

[0085] After competitive allele-specific PCR amplification, the PCR product is tested for fluorescence signals, and the sample can be genotyped according to the fluorescence signal value of each detection site. These primer sets can be used to detect multiple genes and multiple sites simultaneously, and can achieve high-accuracy and high-throughput gene detection of antipsychotic drugs ( Figure 1 ).

[0086] The kit is based on the principle of competitive allele-specific PCR for SNP typing. The PCR reaction is carried out on a microfluidic chip substrate (Beijing Bio-Jingdian Biotechnology Co., Ltd., product number G020010, Figure 2 ), the preparation method steps are:

[0087] (1) 39 primer sets for detecting antipsychotic drug genes (SEQ ID NO: 1-117) are coated into 39 reaction pools of a chip substrate according to the well position table (as shown in Table 1) to prepare a chip semi-finished product in the kit. Each chip can detect 2 samples, and for each sample, 2 internal control quality controls (IC), 2 negative quality controls (NC) and 2 positive quality controls (PC) are provided, and the remaining reaction pools are blank (BC).

[0088] (2) The PCR reaction solution is a mixture of probes, enzymes, dNTPs and other chemical reagents in a certain ratio, and the reagents are packaged according to the specifications of the kit.

[0089] According to the number of people to be tested in the kit, a corresponding number of sealing films (12 pieces / sheet) and positive quality control products (human genomic DNA with known genotype, 50 μL / tube / 12 people) are provided.

[0090] (3) The chip semi-finished product, reagent semi-finished product, sealing film, and positive quality control product prepared in the above steps are assembled into a kit for detecting antipsychotic drug genes according to the number of people to be tested.

[0091] Table 1 Chip reaction pool corresponding detection indicators

[0092]

[0093] 3. Genetic testing for antipsychotic drugs

[0094] Based on the prepared kit, antipsychotic drug gene detection is carried out:

[0095] (1) Blood sample collection

[0096] Blood samples were collected from 150 unrelated individuals and genomic DNA was extracted. The requirements for the samples to be tested in this kit are: (1) human genomic DNA extracted from whole blood; (2) concentration not less than 10 ng / μL; (3) purity (260 / 280nm) of 1.7-2.0.

[0097] Use the kit prepared above to detect 39 sets of genetic information for 150 people, and perform the following operations according to the operating procedures:

[0098] ① Preparation of sample reaction system:

[0099] Take out the PCR reaction solution from -20℃, place it at room temperature until it is completely thawed, vortex and centrifuge to mix the liquid completely and concentrate it at the bottom of the tube. DNA samples are processed in the same way. Prepare the components as shown in Table 2. The reaction system required for each person is 80μL.

[0100] ②Chip sample loading:

[0101] Take out the chip of the kit from the 2-8℃ refrigerator and place it to return to room temperature, then open the package in the clean bench. When adding samples, place the chip horizontally with the missing corner facing the lower left. Use a manual pipette to draw 38μL of the PCR amplification system prepared in 1.1 above for each sample addition channel, and vertically inject the liquid from the injection hole on the right side of the chip. After the addition is completed, wipe the residual liquid in the injection hole and the sample outlet hole with dust-free paper, and seal the inlet and outlet holes with sealing film.

[0102] Table 2 Reaction system

[0103] Reactant ingredients Sample volume (μL) PCR reaction solution 40 PCR Buffer 20 DNA template 20 Total volume (μL) 80

[0104] ③Chip centrifugal heat sealing

[0105] Turn on the centrifugal heat-sealing machine, press the cover-opening button to open the centrifuge cover, insert the chip (pay attention to balancing), the chip corner position corresponds to the centrifuge tray corner position, close the centrifuge cover, and click the centrifuge button to start centrifugation. After the centrifugation is completed, open the centrifuge cover and take out the chip. If there are still bubbles in the chip reaction pool, increase the number of centrifugation until the bubbles disappear.

[0106] Open the chip box door and insert the chip into the chip box. The chip corner direction should be consistent with the chip direction on the display. After the chip is inserted, the display shows that the chip has been inserted. Close the chip box door. Click the heat seal button, the chip box automatically enters the warehouse, and the chip is heat sealed. After the chip is heat sealed, it automatically exits the warehouse and the chip is taken out.

[0107] ④Chip amplification

[0108] The chip sealed by centrifugal heat sealing is placed with the film surface facing downward in a PCR amplification instrument, and the PCR reaction program is set according to Table 3 to perform PCR amplification reaction.

[0109] Table 3 Nucleic acid amplification reaction procedure

[0110]

[0111] (2) Chip scanning

[0112] The signal was read using the microarray chip scanner Luxscan10K / D and analysis software.

[0113] Turn on the computer, scanner, and analysis system in turn, click the "Turn on laser" button in the software, and preheat for 10 minutes. Click the "Eject bracket" button, place the chip into the chip compartment with the chip corner facing the upper right, and click the "Reset bracket" button to put the chip into the scanner. Follow the instrument manual to start chip image scanning and signal acquisition. After the chip scan is completed, name and save the lsr format file and tif format image according to the information of the test sample.

[0114] (3) Reading and analyzing test results

[0115] Import the above saved lsr format file into Excel and extract the detection signal values ​​obtained under the FAM channel and HEX channel. Determine the quality control and target detection results based on the positive judgment value. Combine the detection results and the genotyping table to determine the gene detection results of the sample ( Figures 3 to 7 ). In addition, 150 samples were sequenced and compared with the chip results ( Figures 8 to 11 ), the result compliance rate is 100%.

[0116] In summary, the 39 primer sets of the present invention correspond to 38 detection sites of 4 drug metabolizing enzyme genes, respectively. The established detection method can effectively detect the polymorphism of multiple genes and multiple sites at the same time, and realize the polymorphism detection of multiple drug metabolizing enzyme genes. Compared with the existing detection technology, it can realize the simultaneous detection of multiple genes and multiple sites, increase the detection efficiency and reaction sensitivity, and the volume of the PCR reaction system required for each site is only 1.15μL, and the DNA template only needs 3.6~10ng, which overcomes the defects of the existing detection method such as complex operation and cumbersome process, and has significant clinical application value.

[0117] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A primer set for detecting antipsychotic drug genes, characterized in that: The primer sets include 39 sets, and the sequences of the 39 primer sets are shown as SEQ ID NOs: 1-117.

2. A primer set for detecting antipsychotic drug genes according to claim 1, characterized in that: The primer set is used for typing detection of a total of 47 alleles of four genes, CYP2B6, CYP2C9, CYP2C19 and CYP2D6.

3. A primer set for detecting antipsychotic drug genes according to claim 1, characterized in that: The first set of primers is shown in SEQ ID NO: 1-3 in the sequence listing, and is used to detect the c.64 (rs8192709, C>T) site of the CYP2B6 gene; The second set of primers are shown in SEQ ID NO: 4-6 in the sequence listing, and are used to detect the c.516 (rs3745274, G>T) site of the CYP2B6 gene; The third set of primers is shown in the sequence listing as SEQ ID NO: 7-9, and is used to detect the c.785 (rs2279343, A>G) site of the CYP2B6 gene; The fourth set of primers are shown in the sequence listing as SEQ ID NOs: 10-12, and are used to detect the c.1459 (rs3211371, C>T) site of the CYP2B6 gene; The fifth set of primers is shown in the sequence listing as SEQ ID NO: 13-15, and is used to detect the c.269 (rs72558187, T>C) site of the CYP2C9 gene; The sixth set of primers is shown in the sequence listing as SEQ ID NO: 16-18, and is used to detect the c.353_362 (rs1304490498, AGAAATGGAA>-) site of the CYP2C9 gene; The seventh set of primers is shown in the sequence listing as SEQ ID NO: 19-21, and is used to detect the c.371 (rs12414460, G>A) site of the CYP2C9 gene; The eighth set of primers is shown in the sequence listing as SEQ ID NOs: 22-24, and is used to detect the c.389 (rs200965026, C>G) site of the CYP2C9 gene; The ninth set of primers is shown in the sequence listing as SEQ ID NOs: 25-27, and is used to detect the c.430 (rs1799853, C>T) site of the CYP2C9 gene; The tenth set of primers is shown in the sequence listing as SEQ ID NO: 28-30, and is used to detect the c.449 (rs7900194, G>A) site of the CYP2C9 gene; The eleventh set of primers is shown in the sequence listing as SEQ ID NOs: 31-33, and is used to detect the c.449 (rs7900194, G>T) site of the CYP2C9 gene; The twelfth set of primers is shown in the sequence listing as SEQ ID NOs: 34-36, and is used to detect the c.641 (rs2031531005, A>T) site of the CYP2C9 gene; The thirteenth set of primers is shown in the sequence listing as SEQ ID NOs: 37-39, and is used to detect the c.835 (rs182132442, C>A) site of the CYP2C9 gene; The fourteenth set of primers is shown in the sequence listing as SEQ ID NOs: 40-42, and is used to detect the c.895 (rs72558192, A>G) site of the CYP2C9 gene; The fifteenth set of primers is shown in the sequence listing as SEQ ID NOs: 43-45, and is used to detect the c.980 (rs57505750, T>C) site of the CYP2C9 gene; The sixteenth set of primers is shown in the sequence listing as SEQ ID NOs: 46-48, and is used to detect the c.1075 (rs1057910, A>C) site of the CYP2C9 gene; The seventeenth set of primers is shown in the sequence listing as SEQ ID NO: 49-51, and is used to detect the c.1081 (rs1250577724, C>A) site of the CYP2C9 gene; The eighteenth set of primers is shown in the sequence listing as SEQ ID NOs: 52-54, and is used to detect the c.1429 (rs781583846, G>A) site of the CYP2C9 gene; The nineteenth set of primers is shown in the sequence listing as SEQ ID NOs: 55-57, and is used to detect the c.-806 (rs12248560, C>T) site of the CYP2C19 gene; The twentieth set of primers is shown in the sequence listing as SEQ ID NO: 58-60, and is used to detect the c.55 (rs17882687, A>C) site of the CYP2C19 gene; The twenty-first set of primers is shown in the sequence listing as SEQ ID NOs: 61-63, and is used to detect the c.332-23 (rs12769205, A>G) site of the CYP2C19 gene; The twenty-second set of primers is shown in the sequence listing as SEQ ID NOs: 64-66, and is used to detect the c.636 (rs4986893, G>A) site of the CYP2C19 gene; The twenty-third set of primers is shown in the sequence listing as SEQ ID NOs: 67-69, and is used to detect the c.681 (rs4244285, G>A) site of the CYP2C19 gene; The twenty-fourth set of primers is shown in the sequence listing as SEQ ID NOs: 70-72, and is used to detect the c.986 (rs138142612, G>A) site of the CYP2C19 gene; The twenty-fifth set of primers is shown in the sequence listing as SEQ ID NOs: 73-75, and is used to detect the c.991 (rs3758581, A>G) site of the CYP2C19 gene; The twenty-sixth set of primers is shown in the sequence listing as SEQ ID NOs: 76-78, and is used to detect the c.1297 (rs56337013, C>T) site of the CYP2C19 gene; The twenty-seventh set of primers is shown in the sequence listing as SEQ ID NOs: 79-81, and is used to detect the c.100 (rs1065852, C>T) site of the CYP2D6 gene; The twenty-eighth set of primers is shown in the sequence listing as SEQ ID NOs: 82-84, and is used to detect the c.358 (rs1135822, T>A) site of the CYP2D6 gene; The twenty-ninth set of primers is shown in the sequence listing as SEQ ID NOs: 85-87, and is used to detect the c.505 (rs5030865, G>T) site of the CYP2D6 gene; The 30th set of primers is shown in the sequence listing as SEQ ID NOs: 88-90, and is used to detect the c.506-1 (rs3892097, G>A) site of the CYP2D6 gene; The thirty-first set of primers is shown in the sequence listing as SEQ ID NOs: 91-93, and is used to detect the c.547 (A>insTA) site of the CYP2D6 gene; The 32nd set of primers is shown in the sequence listing as SEQ ID NO: 94-96, and is used to detect the c.806 (rs72549352, G>insG) site of the CYP2D6 gene; The 33rd set of primers is shown in the sequence listing as SEQ ID NOs: 97-99, and is used to detect the c.841_843 (rs5030656, AAG>-) site of the CYP2D6 gene; The thirty-fourth set of primers is shown in the sequence listing as SEQ ID NO: 100-102, and is used to detect the c.886 (rs16947, C>T) site of the CYP2D6 gene; The thirty-fifth set of primers is shown in the sequence listing as SEQ ID NOs: 103-105, and is used to detect the c.985+39 (rs28371725, G>A) site of the CYP2D6 gene; The thirty-sixth set of primers is shown in the sequence listing as SEQ ID NOs: 106-108, and is used to detect the c.1252 (rs28371733, G>A) site of the CYP2D6 gene; The thirty-seventh set of primers is shown in the sequence listing as SEQ ID NO: 109-111, and is used to detect E9-conw of the CYP2D6 gene; The thirty-eighth set of primers is shown in the sequence listing as SEQ ID NOs: 112-114, and is used to detect the c.1412 (rs765776661, G>insTGCCCACTG) site of the CYP2D6 gene; The thirty-ninth set of primers is shown in the sequence listing as SEQ ID NO: 115-117, and is used to detect the c.1457 (rs1135840, G>C) site of the CYP2D6 gene.

4. A primer set for detecting antipsychotic drug genes according to claim 1, characterized in that: The 39 primer sets are respectively composed of two forward primers designed based on gene sequence differences and one reverse common primer.

5. A primer set for detecting antipsychotic drug genes according to claim 1, characterized in that: Among the 39 sets of said primer sets, SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 52, SEQ ID NO: 55, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, SEQ ID NO: 85, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 97, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 106, SEQ ID NO: 109, SEQ ID NO: 112, SEQ ID NO: 115 carry the universal sequence tag GAAGGTCGGAGTCAACGGATT; Among the 39 primer sets, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 92, SEQ ID NO: 95, SEQ ID NO: 98, SEQ ID NO: 101, SEQ ID NO: 104, SEQ ID NO: 107, SEQ ID NO: 110, SEQ ID NO: 113, SEQ ID NO: 116 carry the universal sequence tag GAAGGTGACCAAGTTCATGCT.

6. A kit for detecting antipsychotic drug genes, characterized in that: The kit comprises at least one primer set of the primer set for detecting antipsychotic drug genes according to any one of claims 1 to 5.

7. A kit for detecting antipsychotic drug genes according to claim 6, characterized in that: The kit includes primer sets of groups 1-4, and / or primer sets of groups 5-18, and / or primer sets of groups 19-26, and / or primer sets of groups 27-39.

8. A kit for detecting antipsychotic drug genes according to claim 6, characterized in that: The kit includes at least 42 chip reaction pools and at least 4 positioning points; the chip reaction pools include at least 1 internal reference quality control reaction pool, at least 1 negative quality control reaction pool, and at least 1 positive quality control reaction pool, and each of the remaining chip reaction pools is respectively coated with one of the primer sets for detecting antipsychotic drug genes.

9. A kit for detecting antipsychotic drug genes according to any one of claims 6 to 8, characterized in that: The steps include: (1) selecting a primer set for detecting an antipsychotic drug gene, formulating a well position table for the selected primer set, and coating the primer sets in reaction pools of a chip substrate according to the well position table to obtain a semi-finished chip; (2) preparing a PCR amplification reagent, wherein the PCR amplification reagent includes a PCR reaction solution and a PCR buffer; (3) Assembling the chip semi-finished product, the PCR amplification reagent, the sealing film, and the quality control product into a kit for detecting antipsychotic drug genes.

10. A reagent for detecting antipsychotic drug genes, characterized in that: The invention comprises a primer set for detecting antipsychotic drug genes as described in any one of claims 1 to 5 or a kit for detecting antipsychotic drug genes as described in any one of claims 6 to 8.

Images