Application of substance related to SLC38A2-AS1 gene in preparation of product for treating, screening and / or diagnosing acute kidney injury

Abstract

The invention discloses an application of a substance related to an SLC38A2-AS1 gene in preparation of a product for treating, screening and / or diagnosing acute kidney injury. By comparing LncRNA differential expression in serum of a CI-AKI patient and serum of a non-CI-AKI patient, it is found for the first time that SLC38A2-AS1 highly expresses (Fcgt; 1.5, Plt; the CI-AKI prediction efficiency of the SLC38A2-AS1 is further evaluated by drawing a working characteristic curve of a subject, the result shows that the AUC value reaches 0.8507, it is indicated that the SLC38A2-AS1 can serve as a novel CI-AKI sensitive and accurate biomarker, and a new strategy can be provided for early diagnosis and treatment of acute kidney injury.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the use of substances related to the SLC38A2-AS1 gene in the preparation of acute kidney injury treatment, screening and / or diagnosis products. Background Art

[0002] Acute kidney injury (AKI) is a clinical syndrome caused by a variety of etiologies and characterized by a sharp decline in renal function. The occurrence of iodine-induced acute kidney injury (CI-AKI) prolongs the patient's hospitalization time and increases medical expenses, bringing a huge economic burden to the family and society. Therefore, how to alleviate iodine-induced AKI and provide new theoretical basis, potential diagnostic markers and intervention targets for the prevention and treatment of AKI are of great significance for clinical treatment.

[0003] CI-AKI is usually diagnosed when the serum creatinine value increases by 26.5 μmol / L or rises to more than 1.5 times the baseline value within 48-72 hours, or the urine volume is less than 0.5 mL / (kg•h) for more than 6 hours. However, the specificity of serum creatinine in the definition is poor because serum creatinine fluctuates due to fluid shift and drug effects. In addition, the insensitivity and delay of serum creatinine and the lack of accurate new biomarkers also pose great challenges to the early detection of CI-AKI.

[0004] In related technologies, renal tubular epithelial cells are the key target cells for the occurrence of AKI, renal tubular epithelial cell damage is the main pathological basis of AKI, and cell death is the main form of renal tubular epithelial cell damage. Classical cell death modes, including regulated apoptosis and non-regulated cell necrosis, have been proven to exist and promote the occurrence and development of AKI. With the progress of scientific research in recent years, a variety of new types of programmed cell death have been discovered, including pyroptosis and ferroptosis, which have also been confirmed by scholars to play an important role in the occurrence and development of AKI to varying degrees. However, given the many causes of AKI, the complex signaling pathways, and the different mechanisms, its molecular regulatory mechanism has not yet been fully elucidated.

[0005] LncRNA is a group of nucleotide transcripts with a length of more than 200 base pairs. With the development of second-generation sequencing technology, more and more new LncRNAs have been discovered. In recent years, scientists have found that many LncRNAs play an important role in the occurrence and development of diseases, including acute kidney injury. A study discovered and identified two new LncRNAs (lnc-PRND and lnc-HILPDA) in mice with acute kidney injury after contrast agent treatment, and explored their use as markers for iodine contrast agent-induced acute kidney injury. However, LncRNA is poorly conserved among species, and mouse-derived LncRNA has certain limitations in the diagnosis of humans.

[0006] Based on this, there is an urgent need to seek a serological early diagnostic marker that can reflect the different biological processes in acute kidney injury, and to provide new ideas for the clinical diagnosis and treatment targets of CI-AKI by exploring its specific pathogenesis in CI-AKI. Summary of the invention

[0007] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes the use of a substance for detecting the SLC38A2-AS1 (Solute Carrier Family 38 Member 2 - antisense RNA 1) gene in the preparation of a product for screening, diagnosing and / or evaluating the prognosis of acute kidney injury.

[0008] The present invention also proposes the use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury.

[0009] The invention also provides an acute kidney injury diagnosis kit.

[0010] The present invention also provides a system for diagnosing and / or evaluating the prognosis of acute kidney injury.

[0011] The invention also provides a medicine for treating acute kidney injury.

[0012] In a first aspect, the present invention provides the use of a substance for detecting the SLC38A2-AS1 gene in the preparation of a product for screening, diagnosing and / or evaluating prognosis of acute kidney injury.

[0013] The application of the embodiments of the present invention has at least the following beneficial effects: The present invention uses human lncRNA chip detection technology to compare the differential expression of LncRNA in the serum of CI-AKI patients and non-CI-AKI patients, and for the first time found that the long non-coding RNA SLC38A2-AS1 is highly expressed in CI-AKI compared with the serum of non-CI-AKI patients (normal group) (Fc>1.5, P<0.05). In order to explore its diagnostic value, the present invention uses qPCR and FISH technology to detect the expression level of SLC38A2-AS1 gene in the serum of CI-AKI patients, acute tubular injury renal tissue and CI-AKI in vitro cell model, and draws the receiver operating characteristic curve to evaluate the predictive efficacy of SLC38A2-AS1 for CI-AKI. The results show that SLC38A2-AS1 is upregulated in the serum of patients with acute kidney injury caused by iodine contrast agents, renal tissue with acute tubular injury, and renal tubular epithelial cells treated with iodine contrast agents. The area under the receiver operating characteristic (ROC) curve of SLC38A2-AS1 was 0.8507, indicating high predictive efficacy, and the Youden index of SLC38A2-AS1 was 0.5417 (sensitivity was 75%, specificity was 79.17%), indicating that the screened SLC38A2-AS1 can be used as a sensitive and accurate new biomarker for CI-AKI.

[0014] In some embodiments of the present invention, the substance for detecting the SLC38A2-AS1 gene includes a probe having a sequence complementary to the SLC38A2-AS1 gene, and / or a primer for detecting the SLC38A2-AS1 gene.

[0015] In some embodiments of the present invention, the probe comprises a probe having a nucleotide sequence as shown in any one of SEQ ID NO.3 to SEQ ID NO.5.

[0016] In some embodiments of the present invention, the primers for detecting the SLC38A2-AS1 gene include reverse transcription primers and / or quantitative PCR primers.

[0017] In some embodiments of the present invention, the quantitative PCR primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO.6, and / or a reverse primer having a nucleotide sequence as shown in SEQ ID NO.7.

[0018] In some embodiments of the present invention, the SLC38A2-AS1 gene is a long non-coding RNA, and the cDNA sequence of the SLC38A2-AS1 gene is shown in SEQ ID NO.1.

[0019] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury, or sepsis-induced acute kidney injury.

[0020] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodine contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0021] In some preferred embodiments of the present invention, the acute kidney injury is acute kidney injury caused by iodine contrast agent.

[0022] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test paper, a system and a chip.

[0023] In some embodiments of the present invention, the test sample of the acute kidney injury screening, diagnosis and / or prognosis evaluation product is a urine sample, a blood sample or a kidney tissue sample.

[0024] The second aspect of the present invention provides the use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury.

[0025] The application of the embodiments of the present invention has at least the following beneficial effects: This study explored the role of SLC38A2-AS1 in the pathogenesis of CI-AKI and found that knocking down the expression level of the SLC38A2-AS1 gene can alleviate the loss of cell activity in human renal tubular epithelial cells (HK-2) treated with iodine contrast agents. More specifically, knocking down SLC38A2-AS1 can reduce the degree of HK-2 apoptosis and ferroptosis caused by iodine contrast agents, indicating that knocking down SLC38A2-AS1 has a protective effect on acute kidney injury caused by iodine contrast agents, providing a theoretical basis for studying therapeutic targets for acute kidney injury.

[0026] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene includes at least one of the following: A) siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene; B) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide targeting the SLC38A2-AS1 gene as described in A); C) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in B).

[0027] In some embodiments of the present invention, the siRNA targeting the SLC38A2-AS1 gene comprises a nucleotide sequence as shown in any one of SEQ ID NO.8 to SEQ ID NO.10.

[0028] In some embodiments of the present invention, the antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene comprises a nucleotide sequence as shown in any one of SEQ ID NO.11 to SEQ ID NO.13.

[0029] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene further comprises a small molecule compound that specifically targets the SLC38A2-AS1 gene.

[0030] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury, or sepsis-induced acute kidney injury.

[0031] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodine contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0032] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodine contrast agent.

[0033] In a third aspect, the present invention provides an acute kidney injury diagnostic kit, comprising a probe, primer or gene chip for specifically detecting the SLC38A2-AS1 gene.

[0034] The diagnostic kit according to the embodiment of the present invention has at least the following beneficial effects: the acute kidney injury diagnostic kit of the present invention can achieve early diagnosis by rapidly detecting a specific biomarker (SLC38A2-AS1 gene), thereby shortening the diagnostic cycle. In addition, the acute kidney injury diagnostic kit of the present invention has good detection accuracy, high sensitivity, and low cost, and is suitable for promotion.

[0035] In some embodiments of the present invention, the probe for specifically detecting the SLC38A2-AS1 gene comprises a SLC38A2-AS1 fluorescence in situ hybridization (FISH) probe.

[0036] Preferably, the SLC38A2-AS1 fluorescent in situ hybridization probe comprises a probe having a nucleotide sequence as shown in any one of SEQ ID NO.3 to SEQ ID NO.5.

[0037] In some embodiments of the present invention, the primers for specifically detecting the SLC38A2-AS1 gene include a forward primer having a nucleotide sequence as shown in SEQ ID NO.6, and / or a reverse primer having a nucleotide sequence as shown in SEQ ID NO.7.

[0038] In some embodiments of the present invention, the diagnostic kit further comprises at least one of a reverse transcriptase, a standard, a DNA polymerase, a fluorescent dye, a dNTP, a buffer, and a negative control solution.

[0039] In some embodiments of the present invention, the standard substance is a recombinant plasmid carrying the SLC38A2-AS1 gene. The negative control solution is a blank control solution that does not contain any standard substance.

[0040] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury, or sepsis-induced acute kidney injury.

[0041] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodine contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0042] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodine contrast agent.

[0043] A fourth aspect of the present invention provides a system for diagnosing and / or evaluating the prognosis of acute kidney injury, comprising: A data acquisition module, used to obtain the SLC38A2-AS1 gene expression level of the patient; A data analysis module is used to input the SLC38A2-AS1 gene expression level into a risk scoring model to evaluate the diagnosis and / or prognosis of acute kidney injury in the patient.

[0044] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury, or sepsis-induced acute kidney injury.

[0045] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodine contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0046] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodine contrast agent.

[0047] In a fifth aspect, the present invention provides a drug for treating acute kidney injury, wherein the active substance of the drug comprises a substance that specifically reduces the expression level of the SLC38A2-AS1 gene.

[0048] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene includes at least one of the following: A) siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene; B) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide targeting the SLC38A2-AS1 gene as described in A); C) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in B).

[0049] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene further comprises a small molecule compound that specifically targets the SLC38A2-AS1 gene.

[0050] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury, or sepsis-induced acute kidney injury.

[0051] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodine contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0052] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodine contrast agent.

[0053] Other features and advantages of the present invention will be set forth in the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The serum human differential LncRNA profile of patients with acute kidney injury caused by iodine contrast agents of the present invention; Figure 2 The expression level of SLC38A2-AS1 in 24 patients of the present invention, Note: "**" indicates P <0.01; Figure 3 The expression levels of TCONS_00013515 in 24 patients of the present invention, Note: "ns" means no significant statistical difference; Figure 4 The ROC curve of SLC38A2-AS1 as a serological diagnostic marker for CI-AKI in the present invention; Figure 5 The expression of SLC38A2-AS1 in the renal tissue of acute tubular injury and the CI-AKI in vitro cell model of the present invention, wherein A is the expression of SLC38A2-AS1 in the renal tissue of acute tubular injury after FISH staining, B is the expression of SLC38A2-AS1 in the CI-AKI in vitro cell model after FISH staining, and C is the qPCR statistical result of SLC38A2-AS1 in the CI-AKI in vitro model. Note: "**" indicates P <0.01; Figure 6 Figure 2 shows the effect of knocking down SLC38A2-AS1 on the activity and lipid peroxidation level of HK-2 cells treated with iodine contrast agents. A shows the expression level of SLC38A2-AS1 before and after knocking down, B shows the statistical results of HK-2 cell activity, and C shows the statistical results of HK-2 lipid peroxidation level. Note: “*” indicates P <0.05, “**” indicates P <0.01, "***" indicates P <0.001, “****” indicates P <0.0001; Figure 7 The results of knocking down SLC38A2-AS1 on the ferroptosis markers of HK-2 cells treated with iodine contrast agents, where A is the Western Blot result, B is the statistical result of NCOA4 expression level, C is the statistical result of GPX4 expression level, and D is the statistical result of FTH1 expression level. Note: "*" indicates P <0.05, “**” indicates P <0.01, "***" indicates P <0.001, “****” indicates P <0.0001; Figure 8 The results show the effect of knocking down SLC38A2-AS1 on the level of reactive oxygen species in HK-2 cells treated with iodine contrast agents; Fig. 9 Western Blot results of the effect of knockdown of SLC38A2-AS1 on apoptosis markers in HK-2 cells treated with iodine contrast agents; Fig.10Figure 3 Effects of overexpression of SLC38A2-AS1 on the activity, lipid peroxidation level, ferroptosis markers and reactive oxygen species level of HK-2 cells treated with iodine contrast agents. A is the expression level of SLC38A2-AS1 before and after overexpression, B is the statistical result of HK-2 cell activity, C is the statistical result of HK-2 lipid peroxidation level, D is the Western Blot result, E is the statistical result of GPX4 expression level, F is the statistical result of FTH1 expression level, G is the detection result of ROS level in HK-2 cells, Note: “*” indicates P <0.05, “**” indicates P <0.01, "***" indicates P <0.001, “****” indicates P <0.0001; Fig.11 The expression of SLC38A2 in HK-2 treated with iodine contrast agent, wherein A is the Western Blot result of SLC38A2, B is the statistical result of SLC38A2 expression level, and C is the cell immunofluorescence detection diagram of SLC38A2; Fig.12 The expression results of SLC38A2 after knockdown or overexpression of SLC38A2-AS1 are shown in Figure 1, where A is the Western Blot result of SLC38A2 after knockdown of SLC38A2-AS1, B is the statistical result of SLC38A2 expression level after knockdown of SLC38A2-AS1, C is the Western Blot result of SLC38A2 after overexpression of SLC38A2-AS1, and D is the statistical result of SLC38A2 expression level after overexpression of SLC38A2-AS1. Note: “*” indicates P <0.05, “****” means P <0.0001; Fig.13 Figure 3 shows the effect of knocking down SLC38A2 on the activity, ferroptosis markers and reactive oxygen species levels of HK-2 cells treated with iodine contrast agents, where A is the result of SLC38A2 protein expression after knocking down by siRNA, B is the statistical result of SLC38A2 expression level after knocking down, C is the statistical result of HK-2 cell activity, D is the Western Blot result, E is the statistical result of SLC38A2 expression level, F is the statistical result of GPX4 expression level, G is the detection result of ROS level in HK-2 cells, Note: “*” indicates P <0.05, “**” indicates P <0.01, "***" indicates P <0.001, “****” indicates P <0.0001. DETAILED DESCRIPTION

[0055] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0056] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0057] In the description of the present invention, SLC38A2 (Solute Carrier Family 38 Member 2) is a gene that can encode proteins, and SLC38A2-AS1 (also called ENST00000550319) is a long non-coding RNA located on the antisense strand of this coding gene. Its naming is based on the coding gene SLC38A2 (according to the nomenclature of LncRNA), and they are two different genes.

[0058] Example 1: Screening of diagnostic biomarkers for acute kidney injury induced by iodine contrast agents This example provides a diagnostic biomarker SLC38A2-AS1 for acute kidney injury induced by iodine contrast agents, and the screening process is as follows: 1. Collection of blood samples from CI-AKI patients (1) Identification of CI-AKI population: If the patient's serum creatinine increases to 26.5 μmol / L or more within 48 h to 72 h after injection of iodinated contrast agent, or if the serum creatinine increases to 1.5 times or more of the baseline value within 7 days, it indicates that iodinated contrast agent-induced acute kidney injury has occurred.

[0059] (2) Blood sample collection and mixing: This study selected patients who were hospitalized in the Department of Cardiology, Xiangya Second Hospital, Central South University, and had chronic kidney disease and underwent coronary angiography (CAG) or percutaneous coronary intervention (PCI). Since the increase in serum creatinine lags behind the actual damage to renal function, and previous studies have shown that although the creatinine of CI-AKI patients increased within 48 hours, the level of increase could not reach the diagnostic criteria of CI-AKI. Therefore, in order to find an early diagnostic biomarker, the present invention collected 12 patients with acute kidney injury after CAG / PCI surgery (i.e., CI-AKI patients) 12-30 hours after surgery, and then selected patients who did not develop acute kidney injury (i.e., control group patients) from the department in a 1:1 pairing manner, and collected their plasma 12-30 hours after surgery. Due to the heterogeneity between different patients, in order to minimize the individual differences between patients, the plasma of 4 patients with similar clinical characteristics was mixed, and 3 groups of CI-AKI patient mixed plasma and 3 groups of control patient mixed plasma were obtained.

[0060] 2. Detection of LncRNA differential expression profiles in serum of CI-AKI patients using chip technology The three groups of CI-AKI plasma samples and three groups of non-CI-AKI control group plasma samples were used for subsequent human serum lncRNA differential expression profiling experiments. The analysis of lncRNA expression was outsourced to Aksomics (formerly Kangcheng Bio, China) using the Rapid Amperometric Labeling Kit, Single Color (Agilent p / n5190-0442) and the Agilent Gene Expression Hybridization Kit (Agilent p / n 5188-5242). The specific steps are as follows: (1) Extraction and purification of RNA: A portion of the plasma sample was taken to extract RNA using Trizol. After liquid separation, RNA precipitation, elution and dissolution, the collected RNA solution was subsequently subjected to quality inspection.

[0061] (2) RNA quality inspection: It is divided into two steps. The first step is RNA purification and quantitative analysis, and the second step is the purification of labeled / amplified RNA and cRNA quality control. After ensuring that the RNA purity, quality and chip labeling efficiency meet the standards, follow-up research is carried out on the plasma RNA that needs to be scanned by the chip.

[0062] (3) Using chips to construct libraries: RNA was hybridized to the chip using Agilent's gene expression hybridization kit, and after microarray washing and scanning, data was extracted using Agilent feature extraction software to complete library construction.

[0063] (4) Analysis of sequencing results: The sequencing results were analyzed to obtain differential human LncRNA expression profiles. A total of 24,416 LncRNAs were detected in the plasma samples of the CI-AKI group and the control group (Control), and 89 LncRNAs were different (FC>1.5, P <0.05), of which 51 were up-regulated LncRNAs and 38 were down-regulated LncRNAs. The cluster analysis of the above 89 differentially expressed LncRNAs is shown in Figure 1 shown.

[0064] 3. LncRNA screening Since serum LncRNA levels are low, it is difficult to detect it using the qPCR method. In order to find detectable LncRNA, the candidate LncRNA obtained in step 2 was detected by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). The screening criteria are as follows: (1) Molecular weight between 200-2000 bp; (2) Difference multiple ranking 10; (3) The CT value of serum qPCR is stable below 35; (4) The results obtained by serum qPCR have a smooth melting curve and a correct amplification curve; (5) Confirm that the product sequence amplified by the primers is correct: Send the original DNA solution after serum qPCR amplification to Sanger sequencing, compare the sequencing results with the theoretical qPCR product fragments, and confirm that the product sequence amplified by the primers is correct.

[0065] The screening results showed that SLC38A2-AS1 and TCONS_00013515 met the above conditions, indicating that SLC38A2-AS1 and TCONS_00013515 can be detected in serum using the qPCR method.

[0066] The nucleotide sequence (cDNA) information of SLC38A2-AS1 is shown in SEQ ID NO.1: CACGTGACGCCGCCCGGAGGCGCAGCGCGGCTGATTCATCCCAGGCCAGGCGAGTGGAAAAGTACCAGCCGCGCGCGAGGGGCGGGGGCGCGCCGAGGGGCGGAAAAGTACAGACGGCGGAGCCGCGGGGAGAACAAAGATGATGCCACCGCTGTGTTGCGGCCGTCGAGGCCCCCTACTCCGGCAGATTTCAACCTGCTTTCACTCTTCAAAACTAGCCGGAGGTCGGCGAGCAGCTCCTTTTCGGGATGTGCTTTTTGTACGGCCATGGAAACTGGACTAGCGGAAAGGCTACCTTTTGGCCAGCAAGCCAGGCCCCTTAGAAAGAGGCCCCAGTGGGGAGCCCGGCGCTCCTAAGGCCGTTTGGGAGTCCCCAGTTTTCCACTCGCTGACACGTTGCTTCTCTTATCCCACCACCGCCGCCCCGGGCAAAGGCACTGCCTTGTCTGAATGCGGGTCTGAGGCGCTTTCTGCGGAGCCTGGTCCTTTCCCTTCAATGGTGATGTGTGTGGTCTTGCTGAGCCAGGCAACTAGGGGGACCCTTCGCTGTGGAAAAATTGGTGCTGCGGGAAAGGCAAGACTCACTCCCTTGCAGGAAACAAAGACCCCTTAGGAGAGAGAAATGTTCATGGAATGAATGAATAAACAAGTTTGACCTACT (SEQ ID NO.1).

[0067] The nucleotide sequence (cDNA) information of TCONS_00013515 is shown in SEQ ID NO.2: CATCCACTCTGGTCTGCATCCTCTTGACCGCGTCTGAGTCTCCTTTGGGGCTGGATGTCTGCTTCAGCATTAGGAAATGGACACATCTATAGAATCTCTCATGGCAACACACCAAGTATTGTAAACTTCGTCCTTTCAACAAGTTATATTACTAAAAATCGACAAACTGAACTCACATGAATGTGTACTTACAGAGTTGTGGCTCCTGATTCTATTTAAGGTATGTTAAAGTAAAAGCAGTTAGAATATGGAATATTTTTTTCCCTTGACTATGCCAAAGAAATATTGGTGAGGAATGTTGTGGCTTATTTTTTGTTCTTTCTACATTTTATTTTGTAAAAATTTAAATATTTAATCATGCTCTTCAGTCCTTTACCCATTTTAAGTCTTTTAGTAAGGTTTTATAACTTTAAACATACAGATACTGCATATTATGTATTAGGTTTATTTTAACATTTAACAGAGATTTGTGACTGACTATTATGAGTATGAATATATAATAAATTATTACAAATTCTAATCAGTTACGCTGATGTGGAATATTTTCAAGTGTTGATCTTGTACCCAGTTATCTTATCCAATAATCTATACTTTCAGTGAGCTCTAATTGATTTCTTGTAAGATAATATTATAAAATGACAAATTTGTAACCCTTCCAAGTCACTGATTTCCAATATTTATATCTCCTTTTATTTTTAATTTTTCTTGTTCTTCAAAACTGTTTAAGACTTGGCGTACATTTTAAATAAATATGGTGATAATGAATGGAG (SEQ ID NO.2).

[0068] 4. Expression of SLC38A2-AS1 in the serum of CI-AKI patients The above test results show that TCONS_00013515 and SLC38A2-AS1 are abnormally upregulated in CI-AKI and can be detected using the qPCR method. In order to explore whether TCONS_00013515 and SLC38A2-AS1 can be used as early markers of acute kidney injury caused by iodine contrast agents, the present invention uses the qPCR method to verify the above 12 CI-AKI patients and 12 non-CI-AKI patients. Specifically, taking SLC38A2-AS1 as an example, the verification method is described, and the specific steps are as follows: (1) Construction of SLC38A2-AS1 qPCR absolute quantification standard: The qPCR amplification products were sequenced to confirm that the sequences were correct. The sequences corresponding to the products were added to the Puc57 vector plasmid (Shanghai Biotechnology Co., Ltd.) to obtain the recombinant plasmid containing the SLC38A2-AS1 fragment as a standard. The constructed standard was stored in a -80° refrigerator.

[0069] Plasma RNA was extracted using the BioG serum plasma free RNA extraction kit (51027), and the purity and concentration of the extracted RNA were tested using nanodrop 2000 according to the kit instructions.

[0070] After removing gDNA using the extracted RNA using the Acryl Reverse Transcription Kit (AG11728), all RNA was reversed into DNA.

[0071] (2) Gradient dilution of standard: The recombinant plasmid containing the SLC38A2-AS1 fragment was used as the standard. The standard was first tested using Nanodrop2000 to determine the concentration of the standard. The standard stock solution was 5 ng / μL. The standard was continuously diluted 10 times to obtain 6 samples with a ten-fold difference in concentration. The copy number of each standard at the corresponding concentration was calculated using the following formula: .

[0072] (3) qPCR reaction: For the six dilution gradient standards and serum reverse transcribed DNA mentioned above, the samples were mixed using Acryl Amplification Reagent (AG11701), and then PCR detection was performed using the LightCycler 96 Real-Time PCR System. The specific sample addition system and reaction conditions are shown in Tables 1 and 2 below.

[0073] Table 1: qPCR reaction conditions

[0074] Table 2: qPCR reaction system

[0075] With the CT value of the standard as the ordinate (Y) and the logarithm of the copy number as the abscissa (X), a standard curve is drawn on the coordinate paper. The formula of the standard curve obtained in this experiment is: y=-3.3655x+37.155, R2= 0.996. The corresponding logarithm of the copy number is found from the standard curve according to the CT value of the sample.

[0076] Note: Y is the CT value, and x is the logarithm of the sample copy number. So far, the specific copy number of SLC38A2-AS1 in the serum of each patient with acute kidney injury induced by iodine contrast agent and the serum of the control group has been obtained.

[0077] (4) Statistical test: Statistical analysis was performed using Prism software and paired t-test.

[0078] The analysis results are as follows Figure 2 and Figure 3 As shown, Figure 2 This is the SLC38A2-AS1 detection result. Figure 3 The results of TCONS_00013515 showed that SLC38A2-AS1 was significantly increased in the contrast agent group compared with the control group ( n = 12, p <0.001), TCONS_00013515 had no significant difference in the contrast agent group. Therefore, SLC38A2-AS1 gene was selected as the preferred marker.

[0079] Example 2: Receiver Operating Characteristic Curve Verification In addition, 24 cases of CI-AKI and 24 cases of non-CI-AKI were collected as subjects (all samples were from the Second Xiangya Hospital of Central South University). Then, GraphPad Prism 10 software was used to perform receiver operating characteristic curve (ROC curve) analysis based on the SLC38A2-AS1 gene. The receiver operating characteristic curve was drawn and the area under the curve (AUC) was calculated. The Youden index (sensitivity + specificity - 1) was used to determine the optimal critical point, and the sensitivity and specificity of this experiment were determined according to the point corresponding to the Youden index.

[0080] The results are as follows Figure 4As shown, the AUC of SLC38A2-AS1 is 0.8507, and the cutoff value of SLC38A2-AS1 is selected as 443 copies as the optimal critical point. At this time, the Youden index is 0.5417 (sensitivity is 75%, specificity is 79.17%). When the expression of SLC38A2-AS1 in the patient exceeds 443 copies, CI-AKI is diagnosed. Therefore, SLC38A2-AS1 can be used as a new and effective biomarker for detecting CI-AKI in CAG / PCI patients.

[0081] Example 3: A diagnostic kit for acute kidney injury caused by iodine contrast agents This example prepares a diagnostic kit for acute kidney injury induced by iodine contrast agents. The preparation of the CI-AKI diagnostic kit is mainly based on RT-qPCR.

[0082] The CI-AKI diagnostic kit of this embodiment includes: a recombinant plasmid with the SLC38A2-AS1 target sequence, as well as reverse transcriptase, a standard, a DNA polymerase, SYBR Green I fluorescent dye, primers, dNTPs, a buffer, a negative control solution, and other salt ions.

[0083] Among them, the primer related information is shown in Table 3: Table 3: CI-AKI diagnostic kit sequence information

[0084] The negative control solution is a blank control solution (such as normal saline) that does not contain any standard substance. The CI-AKI diagnostic kit can be used to detect the expression level of SLC38A2-AS1 in plasma, thereby diagnosing CI-AKI disease more quickly, simply and accurately.

[0085] Example 4: Changes of SLC38A2-AS1 in renal tissue of patients with acute renal tubular injury In clinical practice, it is impossible to obtain kidney sections of CI-AKI patients, and acute tubular injury includes common pathological manifestations of AKI including CI-AKI. In this example, the CI-AKI diagnostic kit described above is used in combination with the FISH staining method to explore the expression of SLC38A2-AS1 in patients with acute tubular injury. The specific method is as follows: The renal tissue paraffin blocks of patients with acute tubular necrosis were embedded and 4 μm thick paraffin blocks were cut for subsequent renal tissue FISH experiments. The experiment was performed using the paraffin section RNA FISH kit (F11301) of Genema Gene, which specifically included: ① Dewaxing: preheat the paraffin sections in a 60ºC oven for 30 min; immerse the sections in xylene I and II for 10 min each; incubate in gradient alcohol (100%, 95%, 90%, 80%, 70%) at room temperature for 1 min each; wash the sections twice with PBS, 2 min each time.

[0086] ②Protease treatment: Preheat the proteinase K dilution solution to 37ºC; add 100 μL of proteinase K dilution solution to each slice and incubate at 37ºC for 20 min; add 100 μL of 2×Buffer C solution to each slice and wash the slices 3 times at room temperature, each time for 1 min; dehydrate with gradient alcohol 70%, 80%, 90%, and 100%, each time for 2 min, and dry in air.

[0087] ③ Denaturation: Preheat the denaturation solution at 78 ºC; add 100 μL of preheated denaturation solution to each slice and incubate at 78 ºC for 8 min; dehydrate with gradient alcohol 70%, 80%, 90%, and 100%, each for 2 min, and dry in air.

[0088] ④ Hybridization: Incubate Buffer E in a 73ºC water bath for 30 min in advance until it becomes clear and translucent; prepare the probe mixture (i.e., SLC38A2-AS1 FISH staining probe, sequence information is shown in Table 3): taking 100 μL of 8 μM probe mixture as an example, add 8 μL of probe to 92 μL of Buffer E, total system 100 μL, and denature at 73 ºC for 5 min; prepare a wet box, place the slices horizontally, add 10 μL of denatured probe mixture to each slice, cover with a coverslip, and seal the slice with sealing glue; place in the in situ hybridization instrument and incubate at 37 ºC for 12-16 h.

[0089] ⑤ Post-hybridization washing: Preheat the post-hybridization washing solution at 43 ºC; gently remove the coverslip, aspirate and discard the probe mixture, add 100 μL of preheated post-hybridization washing solution to each slice and wash the slice for 15 min; add 100 μL of 2×Buffer C (preheated to 37 ºC) to each slice and wash twice, each time for 10 min; wash the slice once with PBS for 10 min.

[0090] ⑥Nuclear staining: Add 100 μL of diluted DAPI working solution to each slice and incubate in the dark at room temperature for 20 min; discard the DAPI working solution, wash the slices twice with PBS, 2 min each time; add glycerol or antifade agent, cover with a coverslip, seal the slice with sealing glue, and observe under a fluorescence microscope.

[0091] Fluorescence staining results Figure 5As shown in A, compared with the control group, the expression of SLC38A2-AS1 in the kidneys of patients with acute tubular injury was upregulated and was mainly expressed in the renal tubules.

[0092] Example 5: Changes of SLC38A2-AS1 in an in vitro CI-AKI cell model In this example, the above CI-AKI diagnostic kit was used in combination with the cell FISH staining method to detect the changes of SLC38A2-AS1 in an in vitro CI-AKI cell model, wherein the in vitro CI-AKI cell model preparation method comprises: 4 The adherent cells were seeded in a 48-well plate (with a cover glass for 48-well plates) at a density of 1.5 cells / well and cultured overnight in a 37°C, 5% CO2 incubator. After 12 hours, the HK-2 cells in the iodine contrast agent group were treated with 200 mg I / mL iohexol for 6 hours, and the control group was treated with the same dose of culture medium.

[0093] The specific steps of cell FISH staining are as follows: (1) Paraformaldehyde fixation: Aspirate the culture medium and wash twice with PBS, 5 min each time. Aspirate the PBS and add 100 μL 4% paraformaldehyde to each well and fix at room temperature for 15 min. (2) Buffer A treatment: Aspirate and discard 4% paraformaldehyde, add 100 μL 0.1% Buffer A (prepared immediately before use) to each well and treat the cells at room temperature for 15 min. Aspirate and discard 0.1% Buffer A, and wash twice with PBS, 5 min each time. (3) Buffer C treatment: Aspirate and discard PBS, add 100 μL 2× Buffer C to each well, and place in a 37ºC incubator for 30 min. (4) Preparation of probe mixture: Incubate Buffer E in a 73°C water bath for 30 min until it becomes clear and translucent. Prepare a probe mixture with a concentration of 8 μM and a volume of 100 μL, and denature at 73°C for 5 min. (5) Hybridization: Aspirate and discard 2× Buffer C, add 100 μL of denatured probe mixture to each well, and place in a 37°C incubator for hybridization overnight after protecting from light.

[0094] (6) Washing: On the day after hybridization, remove the samples from the 37ºC incubator, aspirate the probe mixture, add 100 μL of 0.1% Buffer F preheated at 42ºC to each well and wash for 5 min. Aspirate 0.1% Buffer F, add 100 μL of 2× Buffer C preheated at 42ºC to each well and wash for 5 min. Aspirate 2× Buffer C, add 100 μL of 1× Buffer C preheated at 42ºC to each well and wash for 5 min, then aspirate the wash solution.

[0095] (7) DAPI staining: Add 100 μL of diluted DAPI working solution to each well and stain for 20 min in the dark. Aspirate the DAPI working solution and wash twice with PBS, 5 min each time. (8) Sealing: Add glycerol or antifade agent to a clean glass slide, place the cell slide face down on the slide, and observe under a fluorescence microscope.

[0096] Test results such as Figure 5 As shown in Figures B and C, in vitro, SLC38A2-AS1 FISH fluorescence staining found that the expression of HK-2 cells after iodine contrast agent intervention was significantly increased ( Figure 5 As shown in B). qPCR test was further performed on it, and the test results ( Figure 5 The results of FISH staining were consistent with those of FISH staining.

[0097] The above results show that the serological marker SLC38A2-AS1 is a newly discovered kidney-derived LncRNA, which is upregulated in the plasma of CI-AKI patients, renal tissue of acute tubular injury and in vitro models, and can be used as a diagnostic marker for CI-AKI.

[0098] Example 6: Expression inhibitor of SLC38A2-AS1 molecule This embodiment provides an expression inhibitor of SLC38A2-AS1 molecule, which is a designed reagent Smart silencer specifically for knocking down SLC38A2-AS1, which consists of 3 siRNAs and 3 ASOs, synthesized by Ruibo, and the specific ASO target sequences and siRNA target sequences are shown in Table 4 below.

[0099] Table 4: Sequence information of expression inhibitors of SLC38A2-AS1 molecules

[0100] Example 7: Use of an expression inhibitor of the SLC38A2-AS1 molecule in the preparation of a product for treating CI-AKI This example provides the use of the above-mentioned SLC38A2-AS1 molecule expression inhibitor in the preparation of a product for treating iodine contrast agent-induced acute kidney injury, and verifies that knocking down SLC38A2-AS1 can alleviate the decrease in activity of HK-2 cells treated with iodine contrast agents, and at the same time reduce apoptosis and ferroptosis of HK-2 cells treated with iodine contrast agents. The specific experimental process is as follows: 1. Cell culture and transfection: (1) Cell plating and reagent treatment: Seeding cells in 6-well plates: Take a dish of cells, digest and centrifuge, add 1 mL of culture medium to resuspend, pipette thoroughly and evenly, then add an additional 2 mL of culture medium to dilute, take 2 mL of the diluted cell suspension and evenly seed it in a 6-well plate, and culture in an incubator.

[0101] 96-well plate cell seeding: Take the remaining 1 mL of cell suspension, count the cells in this 1 mL using a counting plate and microscope, and calculate the number of cells and total liquid volume required for the 96-well plate. Seed the cells in the 96-well plate at a density of 5000 cells / 100 μL per well.

[0102] (2) Transfection: When the cell density of the above volume reached 40%-50%, 100 μM Smart silencer was used in combination with Ribo transfection reagent for transfection. The medium was changed after 24 hours. At 48 hours after transfection, 200 mg I / mL iohexol was added to treat HK-2 cells for 6 hours. The control group was treated with the same dose of culture medium.

[0103] 2. Cell viability detection: CCK8 experiment (cell viability detection) in 96-well plate: add CCK8 reagent to serum-free and dual antibody-free culture medium (the amount of reagent added is: add 10 μL CC8 reagent to every 100 μL culture medium). After the stimulation is completed, add the culture medium containing CCK8 reagent configured above to the 96-well plate, and the volume added to each well is 100 μL.

[0104] 3. WB experiment: After stimulation, the six-well plate was washed three times with PBS, and RIPA lysis buffer containing protease inhibitors was added. After lysis on ice for half an hour, cells were collected using a cell scraper. The collected cells were sonicated, and the supernatant was extracted by centrifugation. The protein concentration of the supernatant was determined, and loading buffer was added after the determination. The prepared protein was subjected to electrophoresis, transfer, blocking, incubation with primary antibody, incubation with secondary antibody, and exposure. Gray value analysis was performed on the exposed bands.

[0105] 4. MDA experiment: Lipid peroxidation assay was performed according to the instructions of the malondialdehyde (MDA) assay kit (S0131, Beyotime).

[0106] 5. DHE experiment: Reactive oxygen species (ROS) were detected by DHE staining (USEVERBRIGHT, Cat#: D1008).

[0107] Based on the above method, the knockdown efficiency of SLC38A2-AS1 smart silencer was first tested. The qPCR results showed that SLC38A2-AS1 was successfully knocked down (e.g. Figure 6 The CCK8 results showed that knocking down SL38A2-AS1 could alleviate the decrease in HK-2 cell activity induced by iodine contrast agents (as shown in Figure 2A). Figure 6 In addition, MDA results showed that knockdown of SLC38A2-AS1 alleviated the level of lipid peroxidation in HK-2 cells treated with iodine contrast agents (as shown in Figure 2B). Figure 6 C in the figure); WB results showed that knocking down SLC38A2-AS1 alleviated the decrease of ferroptosis markers GPX4, FTH1, and NCOA4 (as shown in Figure 7 The results of DHE staining showed that knocking down SLC38A2-AS1 would reduce the production of ROS in HK-2 cells treated with iodine contrast agents (as shown in A to D in Figure 3). Figure 8 as shown).

[0108] In addition, WB results showed that knockdown of SLC38A2-AS1 decreased the level of apoptosis marker Cleaved caspase-3 in HK-2 cells treated with iodine contrast agents, increased the ratio of Bcl-2 / BAX, and alleviated the occurrence of apoptosis induced by iodine contrast agents (e.g. Fig. 9 as shown).

[0109] In summary, knockdown of SLC38A2-AS1 alleviates the decrease in HK-2 cell viability induced by iodine contrast agents, and reduces the occurrence of cell apoptosis and ferroptosis.

[0110] Example 8: Overexpression of SLC38A2-AS1 aggravates ferroptosis in HK-2 cells treated with iodine contrast agents The above examples have proved that knocking down SLC38A2-AS1 can alleviate HK-2 ferroptosis treated with iodine contrast agents. In order to verify whether overexpression of SLC38A2-AS1 has the opposite effect to knocking down SLC38A2-AS1, this example used an overexpression plasmid of SLC38A2-AS1, and conducted cell activity experiments, MDA experiments, WB experiments and ROS experiments. The nucleotide sequence information of the SLC38A2-AS1 overexpression plasmid is as follows: (SEQ ID NO.14).

[0111] The cell activity experiment, MDA experiment, WB experiment and ROS experiment methods refer to the above examples, where there are differences in the cell transfection process. When the cell density reaches about 70%, prepare for transfection, specifically including: prepare two 1.5 ml ep tubes, marked as A and B tubes, add 250 μL Opti-MEM to each tube, add 2.5 μg plasmid to A tube, and add 5 μL lip3000 to B tube. After standing for 5 min, mix the liquids in A and B tubes and stand for 10 min to obtain a plasmid and lip3000 transfection mixture. Remove the culture medium in the culture dish, rinse once with PBS, add 1.5 mL serum-free and double-antibody-free culture medium, and add the above 500 μL transfection mixture to the culture dish for transfection.

[0112] Verification results such as Fig.10 As shown, Fig.10 Figure A shows that the overexpression efficiency of the SLC38A2-AS1 plasmid is high, indicating that the plasmid was successfully constructed. The verification results showed that overexpression of SLC38A2-AS1 further reduced the cell activity of HK-2 cells treated with iodine contrast agents ( Fig.10 ), and increased the production of lipid peroxidation product malondialdehyde (MDA) ( Fig.10 As shown in C), the levels of ferroptosis markers GPX4 and FTH1 further decreased ( Fig.10 As shown in D-F in Figure ), the level of intracellular reactive oxygen species (ROS) further increased ( Fig.10 ).

[0113] The above results show that overexpression of SLC38A2-AS1 will further reduce the cell activity of HK-2 cells treated with iodine contrast agents, and aggravate the ferroptosis of HK-2 cells treated with iodine contrast agents.

[0114] Example 9: Application of SLC38A2-AS1 in regulating the expression of its adjacent gene SLC38A2 Based on relevant research reports, LncRNA can regulate its adjacent genes to play corresponding functions. The adjacent gene of SLC38A2-AS1 is SLC38A2, which is a solute amino acid transport receptor that can play a protective role in the ferroptosis of the collecting duct cells of the renal medulla under hypertonic conditions. Therefore, the present invention speculates that SLC38A2-AS1 may regulate ferroptosis through SLC38A2. Based on this, the following studies were conducted: First, the expression level of SLC38A2 was detected by WB and cell immunofluorescence detection (e.g. Fig.11As shown in A to C in Figure 1, it was found that SLC38A2 was upregulated in HK-2 treated with iodine contrast agent. Then, in this example, SLC38A2-AS1 smart silencer and SLC38A2-AS1 plasmid were used to knock down or overexpress SLC38A2-AS1 with reference to the above example. The WB results showed that knocking down SLC38A2-AS1 would increase the expression of SLC38A2 (as shown in Figure 1). Fig.12 As shown in A and B in Figure 3, overexpression of SLC38A2-AS1 downregulated the expression of SLC38A2 (as shown in Fig.12 C and D in Figure ).

[0115] In summary, SLC38A2 is upregulated in HK-2 cells treated with iodinated contrast agents and is negatively regulated by SLC38A2-AS1.

[0116] Example 10: Knockdown of SLC38A2 aggravates iodine contrast agent-induced HK-2 ferroptosis In order to explore the role of SLC38A2 in iodine contrast agent-induced HK-2 ferroptosis, this example used SLC38A2 siRNA to perform a knockdown experiment, where the siRNA sequence information is as follows: SLC38A2-Homo-siRNA1:GUGGUCAUUUGCAAGAAAUTTAUUUCUUGCAAAUGACCACTT (SEQ.IDNO.15); SLC38A2-Homo-siRNA2: GUACCUGCUUUGUCACAUATTUAUGUGACAAAGCAGGUACTT (SEQ.ID NO.16); SLC38A2-Homo-siRNA3:GUGUCUAUCUUGGCAUUUATTUAAAUGCCAAGAUAGACACTT (SEQ.IDNO.17); SLC38A2-Homo-siRNA4: GGCUAAUACUGGAAUUGCUTTAGCAAUUCCAGUAUUAGCCTT (SEQ. IDNO.18).

[0117] Note: The "TT" in the above siRNA is a pendant structure, which is a specific structure that increases the stability of siRNA.

[0118] WB, CCK8 and DHE staining experiments were performed on HK-2 cells after SLC38A2 knockdown. The WB results showed that the four siRNAs of SLC38A2 successfully knocked down the protein expression of SLC38A2 (e.g. Fig.13The results of CCK8 showed that knocking down SLC38A2 aggravated the decrease in HK-2 cell viability induced by iodine contrast agents (as shown in A and B in Figure 1). Fig.13 As shown in C), WB results showed that knocking down SLC38A2 further decreased GPX4 in HK-2 cells treated with iodine contrast agents (as shown in Fig.13 DHE staining results showed that knockdown of SLC38A2 increased the production of reactive oxygen species in HK-2 cells treated with iodine contrast agents (as shown in Figure 5A). Fig.13 ).

[0119] The above results show that SLC38A2 is a protective factor, and knocking down SLC38A2 will aggravate iodine contrast agent-induced HK-2 ferroptosis.

[0120] In summary, the present invention provides the use of SLC38A2-AS1 as a diagnostic biomarker for acute kidney injury caused by iodine contrast agents. The present invention experimentally proves that SLC38A2-AS1 is upregulated in the serum of patients with acute kidney injury caused by iodine contrast agents, renal tissue with acute tubular injury, and renal tubular epithelial cells treated with iodine contrast agents, and has excellent early diagnostic performance. At the same time, knocking down SLC38A2-AS1 alleviates the decrease in cell activity of human tubular epithelial cells (HK-2) induced by iodine contrast agents. More specifically, knocking down SLC38A2-AS1 reduces the degree of apoptosis and ferroptosis caused by iodine contrast agents in HK-2, indicating that knocking down SLC38A2-AS1 has a protective effect on acute kidney injury caused by iodine contrast agents, and can provide new ideas for the diagnosis and treatment of CI-AKI.

[0121] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a substance for detecting the SLC38A2-AS1 gene in the preparation of a screening and / or diagnostic product for acute kidney injury.

2. The use according to claim 1, characterized in that: The substance for detecting the SLC38A2-AS1 gene includes a probe having a sequence complementary to the SLC38A2-AS1 gene, and / or a primer for detecting the SLC38A2-AS1 gene.

3. The use according to claim 1, characterized in that: The acute kidney injury includes nephrotoxic acute kidney injury, ischemia-reperfusion-induced acute kidney injury or sepsis-induced acute kidney injury.

4. The use according to any one of claims 1 to 3, characterized in that: The product includes at least one of a reagent, a test kit, a test paper, a system and a chip.

5. Use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury, characterized in that: The substance that specifically reduces the expression level of the SLC38A2-AS1 gene comprises the nucleotide sequences shown in SEQ ID NO.8 to SEQ ID NO.

13.

6. A drug for treating acute kidney injury, characterized in that: The active substance of the drug includes a substance that specifically reduces the expression level of the SLC38A2-AS1 gene, wherein the substance that specifically reduces the expression level of the SLC38A2-AS1 gene contains the nucleotide sequence shown in SEQ ID NO.8 to SEQ ID NO.13.

Images