Application of PPP1R3B gene in preparation of atherosclerosis detection reagent or therapeutic drug

Abstract

The invention discloses an application of a PPP1R3B gene in preparation of an atherosclerosis detection reagent or a therapeutic drug. According to the application, it is found for the first time that the PPP1R3B gene serves as a reliable target spot for atherosclerosis diagnosis and treatment, plaque inflammatory microenvironment can be relieved, glycolipid metabolism reprogramming can be promoted, energy load needed by cells can be supported, atherosclerotic plaque progress can be delayed, and the life quality of patients with cardiovascular diseases can be improved by externally up-regulating PPP1R3B expression and inducing M2 type M phi macrophage polarization; therefore, the compound can be applied to preparation of atherosclerosis diagnostic reagents and therapeutic drugs.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to the application of PPP1R3B gene in the preparation of atherosclerosis detection reagent or therapeutic drug. Background Art

[0002] Cardiovascular disease (CVD), as the "number one killer" threatening human life and health, is characterized by high morbidity and mortality. The latest data show that as of 2021, the number of CVD patients worldwide is approximately 523 million, and the number of deaths is 20.5 million, accounting for nearly one-third of the total number of deaths that year. Atherosclerotic cardiovascular disease (ASCVD) caused by atherosclerosis (AS) is the main cause of high morbidity and mortality in CVD patients. With the prevalence of obesity and cardiometabolic diseases, the incidence of ASCVD continues to rise, especially in adults under 65 years old. Therefore, in-depth research on the pathogenesis of ASCVD is the top priority to reduce the morbidity and mortality of CVD patients.

[0003] ASCVD is a chronic vascular inflammatory disease. The course of the disease involves intimal damage, inflammatory cell recruitment and lipid accumulation. End-stage calcification and plaque rupture can easily cause irreversible organ damage. The main reason for the continuous deterioration of ASCVD is that macrophages (MΦs) of various phenotypes in plaques form a complex inflammatory immune microenvironment of atherosclerosis. In this complex plaque environment, MΦs in the innate immune system are mainly polarized into pro-inflammatory M1 MΦs and anti-inflammatory M2 MΦs, and their metabolic imbalance is a key factor in the deterioration of AS. MΦs metabolic reprogramming mainly involves glycolysis, tricarboxylic acid (TCA) cycle, fatty acid and amino acid metabolism. Different metabolic pathways meet the energy metabolism needs of MΦs of different phenotypes. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an application of PPP1R3B gene in the preparation of an atherosclerosis detection reagent.

[0005] Another object of the present invention is to provide an application of PPP1R3B gene in the preparation of a drug for treating atherosclerosis.

[0006] The purpose of the present invention is achieved through the following technical solutions: Application of PPP1R3B gene in the preparation of atherosclerosis detection reagents.

[0007] The nucleotide sequence of the PPP1R3B gene is shown in SEQ ID NO.1.

[0008] A PPP1R3B gene is used to prepare an atherosclerosis detection reagent, including a reagent for detecting the expression level of the PPP1R3B gene.

[0009] Application of reagents for upregulating PPP1R3B gene expression levels in the preparation of drugs for treating atherosclerosis.

[0010] Application of reagents for upregulating PPP1R3B gene expression levels in the preparation of M2-type MΦ macrophage polarization inducers.

[0011] A drug for treating atherosclerosis, comprising an agent for upregulating the expression level of PPP1R3B gene.

[0012] The reagent for increasing the expression level of the PPP1R3B gene is a PPP1R3B overexpression vector.

[0013] The PPP1R3B overexpression vector is a vector obtained by inserting the PPP1R3B gene into a plasmid; preferably, it is a vector obtained by inserting a lentiviral overexpression plasmid; more preferably, it is a vector obtained by inserting a lentiviral overexpression plasmid PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro.

[0014] The preparation method of the PPP1R3B overexpression vector comprises the following steps: Using PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro as the starting plasmid, the PPP1R3B gene (SEQ ID NO.1) was inserted into the multiple cloning site to construct the PPP1R3B overexpression vector PGMLV-CMV-OvPPP1R3B-3×Flag-EF1-ZsGreen1-T2A-Puro. After expression sequencing verification, the PPP1R3B overexpression vector was extracted and obtained.

[0015] The reagent for upregulating the expression level of the PPP1R3B gene is a PPP1R3B overexpression lentivirus prepared by co-transfection of a PPP1R3B overexpression vector and a packaging plasmid.

[0016] The method for preparing the PPP1R3B overexpression lentivirus comprises the following steps: AAV Pro-293T cells were cultured in a culture dish, and the packaging plasmid and PPP1R3B overexpression vector were transfected into the cells using HG-TransGene transfection reagen transfection reagent. After culture, the PPP1R3B overexpression virus was collected by centrifugation.

[0017] The atherosclerosis treatment drug also includes STAT3 agonist 1.

[0018] The atherosclerosis treatment drug also includes pharmaceutically acceptable excipients.

[0019] Compared with the prior art, the present invention has the following advantages and effects: The present invention focuses on the key gene PPP1R3B as a reliable target for the diagnosis and treatment of atherosclerosis. By exogenously upregulating PPP1R3B expression, inducing polarization of M2-type MΦ macrophages, it can alleviate the inflammatory microenvironment of plaques, promote the reprogramming of glucose and lipid metabolism, support the energy load required by cells, delay the progression of atherosclerotic plaques, improve the quality of life of patients with cardiovascular diseases, and reduce the incidence of cardiovascular and cerebrovascular events. It can be used in the preparation of diagnostic reagents and therapeutic drugs for atherosclerosis. . BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a graph showing the expression of PPP1R3B in simple macrophages of different phenotypes and the efficiency of lentiviral knockdown and overexpression in Example 2.

[0021] Figure 2 This is the polarization situation after macrophage knockdown and overexpression induced stimulation in Example 2.

[0022] Figure 3 This is the glycogen accumulation of primary macrophages BMDM after PPP1R3B knockdown and overexpression in Example 2.

[0023] Figure 4 This is the Oil Red O staining result in Example 2.

[0024] Figure 5 This is a diagram showing the results of using the JC-1 mitochondrial membrane potential assay in Example 2 to detect the effect of PPP1R3B on mitochondrial function in MΦs.

[0025] Figure 6 This is an immunofluorescence staining image of aortic tissue sections in Example 2.

[0026] Figure 7 This is the expression of M2 macrophages in aortic plaques in vivo after overexpression of PPP1R3B in Example 3.

[0027] Figure 8 This is a representative image of aorta glycogen staining in Example 3.

[0028] Fig. 9 This is a representative oil red staining result of the aorta of atherosclerotic mice in Example 3.

[0029] Fig.10 This is a fluorescence result diagram of the aorta transfection with the overexpression virus in Example 3.

[0030] Fig.11 This is a graph showing the H&E staining results of the Ctrl, AAV-PPP1R3B, and AAV-PPP1R3B+STAT3 agonist 1 groups in Example 4.

[0031] Fig.12 This is a photograph of the general distribution of plaques in the aorta in Example 4. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0033] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0034] Example 1 Sequencing and bioinformatics analysis of human atherosclerotic plaques 1.1 Gene Set Enrichment Analysis (GSEA) GSEA was performed using GSEA software (version 3.0) and a molecular signature library. The GSEA pre-ranking function was first used. A ranking list file was then generated using the differential expression analysis output of DESeq2. The acquired data was then integrated and analyzed using the multiGSEA package. multiGSEA is publicly available under the GPL-3 license.

[0035] The Gene Expression Omnibus database was used to explore the key genes that regulate the immune microenvironment progression of human atherosclerotic plaques. Next generation sequencing (RNA-seq) data of 36 human plaques in the GSE57614 dataset identified 4283 differentially expressed genes (DGEs) in human M1 and M2 MΦs (|log2(FC)|>1 and adjusted p<0.05), of which 1959 were upregulated and 2324 were downregulated.

[0036] 1.2 Analysis of differentially expressed genes (DEGs) by WGCNA The R package WGCNA was used to analyze the DEG co-expression modules. Based on the precondition of approximate scale-free topology and the cutoff criterion of ≥30 genes, the WGCNA parameters of the soft threshold power of the adjacency matrix and the square of the correlation coefficient of the characteristic genes were defined. The adjacency matrix dissimilarity was 0.2. Then, the WGCNA modules (co-expression networks) of the characteristic genes were identified and the stability correlation was used to analyze the DEG co-expression modules. p ≤ 0.05 was used as the standard to identify the network related to M1 / M2 type MΦs polarization. The modules (Cd treatment, Cd accumulation and different tissue nodes) with significance (Pearson correlation coefficient) ≥ 0.6 of M1 / M2 type MΦs polarization genes were retained for further analysis.

[0037] 1.3 Metascape analysis To perform pathway enrichment analysis and gene network reconstruction, we used the Metscape tool with the default parameter set. As input, the gene sets obtained from the WGCNA analysis, pathway and enrichment analysis were performed by selecting the following genomic sources: KEGG pathways, GO biological processes, reactome gene sets, canonical pathways, and CORUM.

[0038] GO and KEEG analysis showed that the differentially expressed genes regulating MΦs polarization were mainly involved in immune recognition and inflammatory signaling pathways within plaques.

[0039] 1.4 Key gene PPP1R3B Through the GSE57614 dataset, we found that there were 4283 differentially expressed genes in M1 and M2 macrophages in plaques, of which 1959 were upregulated and 2324 were downregulated. Further GO and KEGG enrichment analysis showed that these differentially expressed genes were involved in regulating pathways related to macrophage polarization in plaques. Venn diagram and differential gene heat map analysis showed that PPP1R3B (Gene ID: 79660) was a target gene in the gene datasets of macrophages with different phenotypes.

[0040] Example 2 Cell experiment 2.1 MΦ lines and primary MΦ culture The model cells mainly include human and mouse MΦs (THP-1 and RAW264.7), and the cells are cultured in a constant temperature incubator (37°C; 5% CO2). The culture medium is RPMI 1640 complete medium containing 10% fetal bovine serum + 1% double antibiotics (penicillin, streptomycin).

[0041] Male C57BL / 6 mice, aged 6 to 8 weeks, were obtained from Shanghai Shrek Laboratory Animal Co., Ltd. (Shanghai, China) for the acquisition of bone marrow-derived macrophages (BMDMs). Bone marrow was removed from the femur and tibia of 6- to 8-week-old C57BL / 6 mice, and single-cell suspension was prepared after lysing red blood cells. Plate culture was performed, and 10 ng / mL M-CSF was added to the complete medium to induce the maturation of MΦs. The medium was changed every 3 days, and after 7 days, they were allowed to differentiate into mature MΦs attached to the wall. Then LPS (100 ng / mL) / IL-4 (20 ng / mL) were added to obtain M1 / M2 polarized MΦs.

[0042] 2.2 Preparation of PPP1R3B overexpression vector Using PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro as the starting plasmid, the PPP1R3B gene (SEQ ID NO.1) was inserted into the multiple cloning site to construct the PPP1R3B overexpression vector PGMLV-CMV-OvPPP1R3B-3×Flag-EF1-ZsGreen1-T2A-Puro. After expression sequencing verification, the plasmid containing the target gene was extracted.

[0043] 2.3 Preparation of PPP1R3B interference vector (1) Design and synthesize the shRNA oligo sequence based on the sequence of the PPP1R3B gene. The specific sequence is as follows: shRNA-F: GATCCGCCTAGTTATCTGGGATATGACTCGAGTCATATCCCAGATAACTAGGCTTTTTT; shRNA-R: AATTAAAAAAGCCTAGTTATCTGGGATATGACTCGAGTCATATCCCAGATAACTAGGCG; (2) The PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro vector was digested with enzymes, and the shRNA oligo designed in step (1) was annealed to form a double strand, which was then connected to the vector and transformed into competent cells DH5α. Positive clones were identified by sequencing, and the PPP1R3B interference vector PGMLV-hU6-ShPPP1R3B-CMV-ZsGreen1-PGK-Puro was constructed.

[0044] 2.4 Lentiviral packaging AAV Pro-293T cells were cultured in a culture dish, and the packaging plasmid and PPP1R3B overexpression vector / interference vector were transfected into the cells using HG-TransGene transfection reagen transfection reagent. After culture, the PPP1R3B overexpression / interference virus concentrate was collected by centrifugation, the titer was detected, and the concentrate was frozen for later use.

[0045] 2.5 Lentiviral transfection MΦs cells were seeded at an appropriate density in a 6-well plate, with a medium volume of 2 mL per well. PPP1R3B overexpression / interference virus concentrate (titer of 1×10 8 TU / mL, MOI = 20) and cells were incubated overnight. After 24 h, the medium was replaced by discarding the original medium and replacing it with 2 mL of fresh medium. Puromycin (2-5 μg / mL) was used to select transfected cells.

[0046] 2.6 Western blot experiment and grouping The transfection efficiency was analyzed by western blot experiment (including gel preparation / loading / electrophoresis / electrotransfer / blocking) to detect the expression of PPP1R3B protein. The relevant primary antibodies are as follows: anti-PPP1R3B antibody (ab235049, 1:1000; Abcam), anti-Arg-1 (16001-1-AP, 1:1000; Proteintech), anti-iNOS (ab178945, 1:1000; Abcam), anti-CD206 (18704-1-AP, 1:1000; Proteintech), and β-actin (sc-8432, 1:1000; SantaCruz Biotechnology). Then, the corresponding species secondary antibody (horseradish peroxidase labeled) was added and incubated for 30-60 minutes. Washed with TBST solution 3 times, and the expression of related proteins was determined by ImageJ after exposure.

[0047] The experimental results are as follows Figure 1 As shown, the knockdown efficiency of PPP1R3B interference virus (Group Ⅴ sh-PPP1R3B) was 55.44%; the overexpression efficiency of PPP1R3B overexpression virus (Group Ⅵ ov-PPP1R3B) was 71.36%, proving that lentiviral transfection can achieve the expected interference or overexpression effect.

[0048] Using β-actin as the control group, the expression of PPP1R3B in M2 MΦs was significantly different compared with M0 or M1 MΦs, and the expression of iNOS and CD206 macrophage markers determined different phenotypes of MΦs. According to the different polarization induced by lentivirus overexpression or interference and LPS (100 ng / mL) / IL-4 (20 ng / mL), they were divided into 9 groups, including Group Ⅰ M0, Group Ⅱ M1, Group Ⅲ M2, Group Ⅳ sh- M0, Group Ⅴ sh- M1, Group Ⅵ sh- M2, Group Ⅶ ov-M0, Group Ⅷ ov-M1, and Group Ⅸ ov-M2. Among them, groups Ⅰ, Ⅱ, and Ⅲ established different induced expressions of macrophages, and PPP1R3B expression was upregulated under M2 induction. Groups IV, V, and VI constructed PPP1R3B knockdown and overexpression cell models, and preliminarily verified that PPP1R3B overexpression contributes to the expression of M2-type MΦs.

[0049] 2.7 Cell line flow cytometry Obtain cell pellets according to the grouping in 2.6 and add FCR block (1 μg / test; 101319; BioLegend) for 5-10 min. Then stain with AF488 anti-mouse F4 / 80 (1 μg / test, 123119, BioLegend), PerCP-Cy5.5 anti-mouse CD11b (0.25 μg / test, 101227, BioLegend), and PE anti-mouse CD86 (1 μg / test, 105007, BioLegend) at 4 °C for 30 min. Wash cells 2-3 times with PBS and fix with cell fixation buffer (500 μL, 420801, BioLegend) in the dark at room temperature for 30 min. Centrifuge at 150 × g for 5 min to discard the fixative, add 2 mL 1× intracellular staining permeabilization wash buffer (421002, BioLegend) to resuspend the cells, centrifuge at 150 × g for 5 min to discard the supernatant, and repeat the above steps 2~3 times. Resuspend the cells with 100 μL 1× intracellular staining permeabilization wash buffer, add CD206 antibody (0.5 μg / tests, 141707, BioLegend), and incubate at room temperature in the dark for 30 min. After incubation, wash the cells 2~3 times with 2 mL 1× intracellular staining permeabilization wash buffer, resuspend the cells with 500 μL cell staining buffer, and place the cells on the flow cytometer. Finally, the data were analyzed using FlowJo software (TreeStar Inc.).

[0050] The experimental results are as follows Figure 2 As shown, flow cytometry confirmed that overexpression of PPP1R3B in MΦs significantly promoted M2 polarization but inhibited M1 polarization.

[0051] 2.8 Glycogen staining After cell transfection, add 70% ethanol to fix for 10 min. Add 500 μL of periodic acid solution to each well, react in a wet box in the dark for 10 min, remove the periodic acid solution, soak in distilled water and wash on a shaker for 5 min. Aspirate the washing solution, add 500 μL of Schiff reagent to each well, place in a wet box, and incubate at 37 ℃ in the dark for 1 h. Remove the staining solution, soak in distilled water and wash on a shaker for 5 min. Observe under an inverted fluorescence microscope.

[0052] The experimental results are as follows Figure 3 As shown, overexpression of PPP1R3B significantly depleted glycogen accumulation in MΦs, while knockdown of PPP1R3B significantly increased glycogen accumulation in MΦs.

[0053] 2.9 Cell Oil Red O Staining After the cells in different groups were incubated with human oxidized low-density lipoprotein (ox-LDL, Yeasen Biotechnology Co., Ltd., 25 μg / mL) for 24 h, Oil Red O staining was used to evaluate the changes in cell morphology and the formation of foam cells.

[0054] The cell seeding density in a 6-well culture plate was 5 × 10 4 Each well was plated, the supernatant was removed by suction, and the cells were rinsed three times with PBS. Then, 4% paraformaldehyde was added to fix the cells for 15 min, and the cells were rinsed twice with PBS. An appropriate amount of staining solution was added to cover the cells for 20 s. The staining solution was removed by suction, and 1 mL of Oil Red O staining solution was added to each well. The cells were stained for 10 to 20 min. The Oil Red O staining solution was removed, and an appropriate amount of staining solution was added. The cells were allowed to stand for 30 s, and then the staining solution was removed. The cells were washed with PBS for 20 s. An appropriate amount of PBS was added to evenly cover the cells, and the cells were observed and photographed under an inverted fluorescence microscope.

[0055] The experimental results are as follows Figure 4 As shown, Oil Red O (ORO) staining showed that overexpression of PPP1R3B significantly enhanced lipid efflux from foam cells, while knockdown of PPP1R3B had the opposite effect.

[0056] 2.10 Mitochondrial membrane potential staining experiment (JC-1) According to the density of about 5×10 4 Inoculate cells per well in a 6-well plate and wait for them to adhere to the wall. Remove the culture medium, wash the cells twice with PBS, add 1 mL of cell culture medium and 1 mL of JC-1 staining working solution (vortex, fully dissolve and mix). Incubate in a cell culture incubator at 37 ℃, 5% CO2 and saturated humidity for 20 minutes. After incubation, remove the supernatant and wash twice with JC-1 staining buffer. Add 2 mL of cell culture medium and observe under a laser confocal microscope.

[0057] The experimental results are as follows Figure 5 As shown, the JC-1 aggregation fluorescence (red) was enhanced in the M2-type MΦ polarization group and the PPP1R3B overexpression group, indicating that overexpression of PPP1R3B increased the mitochondrial membrane potential of M2-type MΦs. In contrast, knocking out PPP1R3B reduced the mitochondrial membrane potential of M1-type MΦs.

[0058] 2.11 Immunofluorescence staining of tissue sections The expression of related markers was detected by staining frozen sections of human atherosclerotic plaques and adjacent normal vascular tissues. The frozen sections were fixed with 4% paraformaldehyde, blocked with 5% BSA at room temperature for 30 min, and incubated with the primary antibody at 4 °C for 12 h. The negative control was the same IgG at the same concentration as the primary antibody. The sections were incubated with the fluorescent secondary antibody in a dark room at 37 °C for 30 min and finally stained with DAPI. The sections were observed under a laser confocal microscope.

[0059] The experimental results are as follows Figure 6 As shown in the figure, the expression and localization of PPP1R3B in human atherosclerotic plaques and adjacent normal vascular tissues were detected by tissue immunofluorescence staining. PPP1R3B was mainly co-localized with the M2 MΦs biomarker CD206, while there was little correlation with the endothelial cell biomarker CD31, the smooth muscle cell biomarker α-SMA and the M1 MΦs biomarker CD86.

[0060] Example 3 Animal Experiment 3.1 Animal culture All animal care and experimental procedures were approved by the Animal Policy and Welfare Committee of Wenzhou Medical University. All experimental animals used in this study were SPF (Specific Pathogen Free) grade male ApoE - / - C57BL / 6 mice were purchased from Shrek Animal Co., Ltd., Shanghai, China.

[0061] All mice were housed in a 12:12 h light-dark cycle with a constant room temperature and fed a standard rodent chow diet. The animals had been acclimated to the laboratory environment for at least 2 weeks before the start of the study. All animal experiments were conducted under a blinded principle. - / - The HFD diet formula for mice was: 40 kcal% fat, 20 kcal% protein, 40 kcal% carbohydrates and 1.25% cholesterol for 16 weeks. After the modeling was completed, the mice were randomly divided into groups, with 3 mice in each group, and the specific treatments were as follows: Experimental group: HFD + injection of PPP1R3B overexpression virus concentrate (dose = 5×10 11 vg, 150ul solution prepared with normal saline); Control group: HFD + injection of equal volume of normal saline; Injection method: tail vein injection (the virus is injected by tail vein, and the subsequent stat3 agonist is injected by intraperitoneal injection), single injection.

[0062] All mice were fed HFD for a total of 16 weeks. Body weight was recorded once a week. At week 16, all mice were sacrificed under sodium pentobarbital anesthesia and blood samples were collected. Aortas were fixed in 4% paraformaldehyde or snap-frozen in liquid nitrogen.

[0063] 3.2 Flow cytometry of aortic tissue suspension Aortic tissue suspension was prepared by crushing, digestion, separation, filtration and other steps. The aortic single cell suspension was centrifuged at 4°C and the supernatant was removed. FCR block (1 μg / test; 101319; BioLegend) was added for 5-10 min. Then, AF488 anti-mouse F4 / 80 (1 μg / test, 123119, BioLegend), PerCP-Cy5.5 anti-mouse CD11b (0.25 μg / test, 101227, BioLegend), and PE anti-mouse CD86 (1 μg / test, 105007, BioLegend) were used for staining at 4°C for 30 min. The cells were washed 2-3 times with PBS and fixed with cell fixation buffer (500 μL, 420801, BioLegend) in the dark at room temperature for 30 min. Centrifuge at 150 × g for 5 min to discard the fixative, add 2 mL 1× intracellular staining permeabilization wash buffer (421002, BioLegend) to resuspend the cells, centrifuge at 150 × g for 5 min to discard the supernatant, and repeat the above steps 2~3 times. Resuspend the cells with 100 μL 1× intracellular staining permeabilization wash buffer, add CD206 antibody (0.5 μg / tests, 141707, BioLegend), and incubate at room temperature in the dark for 30 minutes. After incubation, wash the cells 2~3 times with 2 mL 1× intracellular staining permeabilization wash buffer, resuspend the cells with 500 μL cell staining buffer, and place the cells on the flow cytometer. Finally, the data were analyzed using FlowJo software (Tree Star Inc.).

[0064] The experimental results are as follows Figure 7 As shown, plaque tissue flow cytometry of PPP1R3B-overexpressing mice showed a higher proportion of M2 MΦs (Ctrl = 27.367 ± 1.600%, AAV-PPP1R3B = 49.467 ± 5.254, p < 0.01).

[0065] 3.3 Oil Red O staining of isolated aorta The Oil Red O staining working solution was prepared with the ratio of Oil Red O solution to Oil Red O diluent of 3:2. After mixing and standing, the precipitate was filtered using a 0.45 µm syringe filter for later use. The aorta was cut longitudinally from the aortic arch to the iliac vessels, with the intima facing outward, and soaked in the Oil Red O staining working solution for 30 min, decolorized in 80% isopropanol at room temperature for 30 s, and finally washed with PBS for 5 min. The extent of aortic plaques was assessed by gross Oil Red staining. ImageJ software was used to quantify the lesion area of ​​the vascular intima.

[0066] The experimental results are as follows Figure 8 As shown in the figure, according to the representative oil red staining analysis of the aorta of atherosclerotic mice, the gross (Ctrl = 20.455 ± 2.797%, AAV-PPP1R3B= 9.059 ± 0.667%, p<0.01); cross-sectional (Ctrl =3.403 ± 0.394%, AAV-PPP1R3B = 0.385 ± 0.085% p<0.001), indicating that overexpression of PPP1R3B helps promote lipid excretion and inhibit foam cell formation. Compared with the control group, the plaque area of ​​the PPP1R3B overexpression group was reduced by about 55.71%.

[0067] 3.4 Glycogen staining of isolated aorta Take frozen sections of the aorta, wash with distilled water for 2 min, add 70% ethanol to fix for 10 min, and wash the fixative with distilled water. Add 500 μL of periodic acid solution to each sample, react in a wet box in the dark for 10 min, remove the periodic acid solution, soak in distilled water and wash on a shaker for 5 min. Aspirate the washing solution, add 500 μL of Schiff reagent to each well, put in a wet box, and incubate at 37 °C in the dark for 1 h. Remove the staining solution, soak in distilled water and wash on a shaker for 5 min.

[0068] The results are as follows Fig. 9 As shown, representative PAS staining images of aorta cross-sections of atherosclerotic mice (Ctrl =17.407 ± 0.966, AAV-PPP1R3B = 6.827 ± 0.627 p<0.0001), suggesting that overexpression of PPP1R3B helps promote glycogen consumption and enhance cell activity.

[0069] 3.5 Overexpression virus transfection Aorta samples with atherosclerotic plaques were selected for preparation of slices, and the slices were stained with DAPI according to the method in 2.11 of Example 2. The slices were observed under a laser confocal microscope.

[0070] The experimental results are as follows Fig.10As shown, the fluorescence of the aorta transfected with the overexpression virus showed successful transfection, and the PPP1R3B overexpression experimental group inhibited plaque formation.

[0071] 3.6 H&E staining All mice were euthanized at 16 weeks of age using sodium pentobarbital anesthesia. The entire aorta was excised, and the surrounding fat and connective tissue were carefully removed. Then, the cells were fixed with 4% PFA overnight at 4°C and then embedded in paraffin. Finally, 5-10 µm thick sections were prepared and stained with H&E for histological examination.

[0072] Example 4 Animal experiment on STAT3 agonist combined with PPP1R3B overexpression 4.1 Animal culture and experiments In order to further enhance the therapeutic effect of PPP1R3B overexpression on atherosclerotic plaques, a scheme of combining with STAT3 agonist was further designed to verify its effect. Animal modeling was performed with reference to the method of 3.1 in Example 3, and the specific treatment was as follows: Experimental group: HFD + injection of PPP1R3B overexpression virus concentrate (dose = 5×10 11 vg, 150ul solution prepared with normal saline); Combined experimental group: HFD + injection of PPP1R3B overexpression virus concentrate (dose = 5×10 11 vg) + STAT3agonist 1 intraperitoneal injection, the dosage is 20 mg / kg; Control group: HFD + injection of equal volume of normal saline; All mice were fed HFD for a total of 16 weeks. Body weight was recorded once a week. At week 16, all mice were sacrificed under sodium pentobarbital anesthesia and blood samples were collected. Aortas were fixed in 4% paraformaldehyde or snap-frozen in liquid nitrogen.

[0073] 4.2 H&E staining The aortic plaque samples were sliced ​​and stained according to the method in 3.6 of Example 3. The experimental results are as follows: Fig.11 As shown, the plaques in the AAV-PPP1R3B group were reduced by 73.5% compared with the control group. After adding STAT3 agonist, H&E results showed that the plaque area was reduced by about 85.2%.

[0074] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of PPP1R3B gene in the preparation of atherosclerosis detection reagents.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the PPP1R3B gene is shown in SEQ ID NO.

1.

3. A PPP1R3B gene for preparing an atherosclerosis detection reagent, characterized in that: The invention comprises reagents for detecting the expression level of PPP1R3B gene.

4. Application of reagents for upregulating PPP1R3B gene expression levels in the preparation of drugs for the treatment of atherosclerosis.

5. Application of reagents that upregulate PPP1R3B gene expression levels in the preparation of M2 MΦ macrophage polarization inducers.

6. A drug for treating atherosclerosis, characterized in that: Included are agents that upregulate the expression level of the PPP1R3B gene.

7. The atherosclerosis treatment drug according to claim 6, characterized in that: The reagent for increasing the expression level of the PPP1R3B gene is a PPP1R3B overexpression vector.

8. The atherosclerosis treatment drug according to claim 6, characterized in that: The reagent for upregulating the expression level of the PPP1R3B gene is a PPP1R3B overexpression lentivirus prepared by co-transfection of a PPP1R3B overexpression vector and a packaging plasmid.

9. The atherosclerosis treatment drug according to any one of claims 6 to 8, characterized in that: Also included is STAT3 agonist 1.

10. The atherosclerosis treatment drug according to any one of claims 6 to 8, characterized in that: Pharmaceutically acceptable excipients are also included.

Images