Biomarker for female asbestos-related lung adenocarcinoma and application thereof

Abstract

The invention discloses a biological marker for female asbestos-related lung adenocarcinoma and application of the biological marker, the biological marker comprises a serum marker CA199 and a combination of two methylation sites of an SLC40A1 gene, and the combination of the two methylation sites is a combination of the 189580781 methylation site in the 189580844 region to the 189580646 region of the SLC40A1 gene and the 189581152 methylation site in the 189581219 region to the 189581043 region of the SLC40A1 gene. CA199 can be used for identifying asbestos-related lung adenocarcinoma and other lung adenocarcinoma; furthermore, the detection of methylation levels of two sites is combined, so that the asbestos-related lung adenocarcinoma with major nodule chest medical imaging characteristics can be identified, and the CA199 combined with the detection of the two sites has a value in the identification of the asbestos-related lung adenocarcinoma and the progress of the asbestos-related lung adenocarcinoma.

Description

Technical Field

[0001] The present invention relates to the technical field of occupational exposure-related disease diagnosis, and in particular to a biomarker for female asbestos-related lung adenocarcinoma and an application thereof. Background Art

[0002] Asbestos is a confirmed human carcinogen. Its harm is not limited to occupational groups, but also brings a serious disease burden to the general public. Among them, asbestos-related lung cancer is the most common asbestos-related carcinogenic problem, and it is urgent to develop monitoring technology to meet the needs of improving diagnosis and treatment service capabilities.

[0003] Pleural plaques can be used as a characteristic medical imaging manifestation of asbestos exposure, and can objectively confirm asbestos exposure to a certain extent, especially when the history of asbestos exposure is unknown or quantitative data is insufficient. In addition, pleural plaques help identify high-risk groups for cancer and provide follow-up requirements, which has practical significance in assisting the determination of asbestos-related lung cancer. However, in the diagnosis and treatment of lung cancer, medical imaging examinations may have the risk of missing pleural plaques. For this reason, it is necessary to explore biological monitoring indicators for the accurate identification of pleural plaque-positive lung cancer, so as to improve the diagnosis and treatment capabilities of asbestos-related lung cancer. Summary of the invention

[0004] The present application provides a biomarker for asbestos-related lung adenocarcinoma in women and its application, which can identify asbestos-related lung adenocarcinoma with large nodule chest medical imaging characteristics, and is of great value in identifying asbestos-related lung adenocarcinoma and assessing its progression risk.

[0005] The present application provides a biomarker combination for asbestos-related lung adenocarcinoma in women, comprising a serum marker CA199 and a combination of two methylation sites of the SLC40A1 gene, wherein the two methylation site combinations are a combination of the 189580781st methylation site within the 189580844 to 189580646 region (SEQ ID NO.2) of the SLC40A1 gene and the 189581219 to 189581043 region (SEQ ID NO.3) of the methylation site 189581152.

[0006] The present application found in the study that CA199 can distinguish asbestos-related lung adenocarcinoma from other lung adenocarcinomas; further combined with the methylation level detection of two specific sites, it is helpful to identify asbestos-related lung adenocarcinoma with large nodules, suggesting that CA199 combined with the detection of two methylation sites is valuable in identifying asbestos-related lung adenocarcinoma and its progression.

[0007] The present application also provides a biomarker for asbestos-related lung adenocarcinoma in women, comprising a combination of the methylation site No. 189580781 in the region 189580844 to 189580646 and the methylation site No. 189581152 in the region 189581219 to 189581043 of the SLC40A1 gene.

[0008] This study also found that changes in the methylation levels of the two sites 189580781 and 189581152 of the SLC40A1 gene can also be used to identify the progression of asbestos-related lung adenocarcinoma in women. The methylation modification level of specific sites of the SLC40A1 gene decreased, which was closely related to the imaging size of female lung adenocarcinoma>10mm. Among them, the CpG site methylation detection of site 189580781 can be used as a monitoring indicator for identifying female patients with lung adenocarcinoma with imaging nodule size ≥10mm, and combined with the CpG site methylation detection of site 189581152, it can further identify female patients with pleural plaque-positive lung adenocarcinoma with imaging nodule size ≥10mm. The above indicators have good specificity and sensitivity.

[0009] It has been verified that when the methylation levels of the two sites 189580781 and 189581152 of the SLC40A1 gene decrease at the same time (189580781 <0.159% and 189581152 <1.114%), patients can be identified as asbestos-related lung adenocarcinoma with imaging nodule size ≥10mm, which can be used for the diagnosis, auxiliary diagnosis or progression evaluation of asbestos-related lung adenocarcinoma.

[0010] The present application also provides a use of the biomarker combination or the biomarker in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

[0011] The present application also provides a methylation site as a biomarker for the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women, wherein the methylation site is a combination of site 189580781 and site 189581152 of the SLC40A1 gene.

[0012] The present application also provides a reagent for detecting the methylation degree of the 189580781st site and the 189581152th site of the SLC40A1 gene for use in preparing a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

[0013] The present application also provides a nucleic acid composition for detecting methylation, comprising an amplification primer combination: designed for regions 189580844 to 189580646 and regions 189581219 to 189581043 of the SLC40A1 gene, the nucleotide sequence of the regions 189580844 to 189580646 is shown in SEQ ID NO.2, and the nucleotide sequence of the regions 189581219 to 189581043 is shown in SEQ ID NO.3.

[0014] Optionally, the amplification primer combination includes:

[0015] Upstream primer corresponding to the fragment sequence of 189580844 to 189580646:

[0016] GGAGGTYGTAGGGAGTTTYGTTTT(SEQ ID NO.4);

[0017] Downstream primers corresponding to the fragment sequence of 189580844 to 189580646:

[0018] TTTTTCCTTCTTTCCAAACTTAACTAACA(SEQ ID NO.5);

[0019] The upstream primer corresponding to the sequence of the fragment 189581219 to 189581043 is: TTTTTTTTTGAATTGYGGGGTAG (SEQ ID NO. 6);

[0020] Downstream primer corresponding to the sequence of fragment 189581219 to 189581043: AATTTTCCTACTCTCCRAAAAAC (SEQ ID NO. 7);

[0021] Among them, the degenerate bases Y and R represent C / T and A / G respectively.

[0022] The present application also provides a use of the nucleic acid composition in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

[0023] The present application also provides a kit for detecting methylation, comprising the nucleic acid composition.

[0024] The present application also provides a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women, comprising a reagent for specific detection of serum CA199 and the nucleic acid composition.

[0025] This application has the following beneficial effects:

[0026] Among the biomarkers of the present application, CA199 can distinguish asbestos-related lung adenocarcinoma from other lung adenocarcinomas; further combined with methylation detection of two sites, it is helpful to distinguish asbestos-related lung adenocarcinoma with large nodules, while combined with methylation detection of one site, it is helpful to distinguish other lung adenocarcinomas with large nodules, suggesting that CA199 combined with two-site detection is valuable in identifying asbestos-related lung adenocarcinoma and its progression.

[0027] When the methylation levels of the two sites 189580781 and 189581152 of the SLC40A1 gene decreased simultaneously (189580781 < 0.159%, 189581152 < 1.114%), the patient was identified as female asbestos-related lung adenocarcinoma with an imaging nodule size ≥ 10 mm, which can be used to evaluate the progression of female asbestos-related lung adenocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the CpG site map of the 189580844-189580646 fragment and the 189581219-189581043 fragment of the SLC40A1 gene.

[0029] Figure 2 This is a graph showing the results of serum indicators in patients with pleural plaque-positive lung adenocarcinoma and pleural plaque-negative lung adenocarcinoma.

[0030] Figure 3 The graph shows the methylation levels (%) of different SLC40A1 methylation sites between pleural plaque-positive lung adenocarcinoma tissues and pleural plaque-negative lung adenocarcinoma tissues.

[0031] Figure 4 The results graph shows the methylation level (%) of SLC40A1 methylation sites in pleural plaque-positive lung adenocarcinoma with different imaging nodule sizes.

[0032] Figure 5 The results of the methylation levels (%) of SLC40A1 methylation sites in pleural plaque-negative lung adenocarcinoma with different imaging nodule sizes are shown in the figure.

[0033] Figure 6 This is the ROC characteristic result diagram for identifying pleural plaque-positive lung adenocarcinoma with CA199.

[0034] Figure 7 ROC curves for the methylation levels at the 189580781 (A) and 1895811552 (B) gene locations for identifying radiographic nodules ≥10 mm in size.

[0035] Figure 8 ROC curve for the methylation level of the 189580781 gene position to identify radiographic nodules with a size ≥10 mm. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0038] Conventional serological indicators such as CA199, CA153 and CA125 have clinical value in the diagnosis, progression assessment, short-term efficacy and prognosis analysis of lung cancer. Except for sporadic reports of CA125 in pleural malignancies with pleural plaques, there is no clear evidence for the role of the above three serological cancer indicators in the identification of lung cancer with pleural plaques. In the study, this application found that on the basis of serological indicator monitoring, combined with gene methylation monitoring indicators, it is helpful to promote early molecular precision diagnosis and treatment and improve the application value of conventional cancer biochemical indicators. This application intends to combine the serological cancer indicator CA199 and the specific methylation sites of the SLC40A1 gene (iron transporter encoding gene) to explore its clinical value in pleural plaque-positive lung adenocarcinoma and its development degree, and provide objective monitoring indicators for the differential diagnosis and precise prevention and treatment of asbestos-related lung cancer.

[0039] The following is described with specific examples:

[0040] Research subjects: The medical record system of a tertiary hospital was used to retrieve cases of female lung adenocarcinoma who were first diagnosed between 2018 and 2020. First, female lung adenocarcinoma cases were selected based on the pathological diagnosis conclusion data. Then, the chest imaging manifestations of the whole-body X-ray computed tomography system (LightSpeed ​​VCT) were queried, and the medical imaging manifestations of pleural plaques were interpreted by clinical physicians to confirm the cases of pleural plaque-positive lung adenocarcinoma. Then, based on the principle of similar age, the cases of pleural plaque-negative lung adenocarcinoma were matched. According to the above inclusion criteria, 9 patients with pleural plaque-positive lung adenocarcinoma and 12 patients with pleural plaque-negative lung adenocarcinoma were finally determined as research subjects. The use of the above cases and their clinical data and specimens was approved by the Medical Ethics Committee.

[0041] Serum CA199, CA153 and CA125 test results: Query the results of serum tumor index tests measured by immunoturbidimetry using the Abbott IS2000 fully automatic biochemical immunoassay system on the day of the initial diagnosis, and collect CA199, CA153 and CA125 data.

[0042] SLC40A1 gene CpG site methylation detection and analysis:

[0043] (1) Genomic DNA extraction: The tissue sections preserved from the above cases were used as research objects, and the genomic DNA in the tissue sections was extracted using a paraffin-embedded tissue section DNA extraction kit (Omega Biotek).

[0044] (2) Genomic DNA quality control: Genomic DNA was detected by agarose electrophoresis, and the main band was required to be clear without obvious diffusion and tailing. The DNA concentration was determined by Nanodrop and met the requirements of ≥20 ng / μL, A260 / A280=1.7-1.9, and A260 / A230≥2.0.

[0045] (3) SLC40A1 gene methylation primer design: The region from 2K upstream of the transcription start point to 1K downstream of the first exon of the SLC40A1 gene (NM_014585.6) was selected as the target sequence (chr2:189579418-189582786 (hg38)), and Observed / Expected ratio>0.60, Percent C+Percent G>50.00%, Length>200bp were used as CpG island prediction parameters. Using EMBOSS Cpgplot (https: / / www.ebi.ac.uk / jdispatcher / seqstats / emboss_cpgplot), 1 CpG island was found. The above target sequence and its CpG island (underlined mark) are as follows:

[0046] SEQ ID NO.1:

[0047] aa tccccacccaccaagctcgcgctggagctttgcactgcgaccgtccggcggccgccctttccctgaactgcggggt agccggtgcgcagcgctttcttccagcacctgacgcttagtttcgcgcagaatctccctacgccgccccgccggct ccacgcgccttcctccttttcccagccccacggccgccccccgaggttgccctcgcggcttcccggagagcaggaa aacccggggagtggaacgcgtcgaggcgaaggtccccgcaagccgcgcagggtgtctgcggccggttggacgcttg cgcccggggtgggcgactcctccgggcaagggcgcggggacggcccggcgcgcaaggttgacgggagctcgtctcg cgccgcggggacgcccgggcggccctgaaggggacggggcggccccagtcggaggtcgcagggagctccgcccccg actcggtataagagctgggcccggcccacggcG

[0048] On this basis, sequencing primers were designed using Methylation FastTarget V4.1 (http: / / bioinfo.geneskybiotech.com / software / methylation_fasttarget / v4.1 / ) for two fragments of the SLC40A1 gene (189580844-189580646, SEQ ID NO.2) and the SLC40A1 gene (189581219-189581043, SEQ ID NO.3) (Table 1). The two fragments contain 15 CpG and 17 CpG sites, respectively. Figure 1 , red mark).

[0049] SEQ ID NO.2:

[0050] SLC40A1 gene 189580844~189580646 fragment sequence: GGAGGTCGCAGGGAGCTCCGCCCCCGACTCGGTATAAGAGCTGGGCCCGGCCCAcggcggcggcggcggcggcggAGAGAGCT GGCTCAGGGCGTCCGCTAGGCTCGGACGACCTGCTGAGCCTCCCAAACCGCTTCCATAAGGCTTTGCCTTTCCAACTTCAGCTACAGTGTTAGCTAAGTTTGGAAAGAAGGAAAAA

[0051] SEQ ID NO.3:

[0052] SLC40A1 gene 189581219~189581043 fragment sequence: CCTTTCCCTGAACTGCGGGGTAGCCGGTGCGCAGCGCTTCTCCAGCACCTGACGCTTAGTTTCGCGCAGAATCTCCCTACGCCGCCCCGCCGGCTCCACGCGCCTTCCTCCTTTTCCCAGCCCCACGGCCGCCCCCCGAGGTTGCCCTCGCGGCTTCCCGGAGAGCAGGAAAACC

[0053] Table 1

[0054]

[0055] (4)Use EZ DNA Methylation-Gold TMKit (Zymo Research), and the genomic DNA was treated with bisulfite according to the reagent manual. Bisulfite converts the unmethylated cytosine C in the genomic DNA into uracil U.

[0056] (5) CpG site methylation detection:

[0057] 1) Multiple PCR reaction of sample target fragments

[0058] Configure the reaction system (Table 2):

[0059] Table 2

[0060]

[0061] The multiplex PCR panel in Table 2 is the two pairs of primers in Table 1.

[0062] Set up the reaction conditions (Table 3):

[0063] Table 3

[0064]

[0065] 1.5% agarose gel electrophoresis confirmed the validity of PCR amplification of the sample:

[0066] The multiplex PCR products of each panel of the same sample are quantitatively mixed in equal proportions; the mixed multiplex PCR products are diluted 10 to 20 times and used as templates for the subsequent Index PCR step, i.e., specific tag sequences are added.

[0067] 2) Sample-specific tag sequence added

[0068] A. Use primers with index sequences to introduce specific tag sequences compatible with the Illumina platform to the ends of the library through PCR amplification.

[0069] B. Reaction system (Table 4):

[0070] Table 4

[0071]

[0072] Among them, 5×Reaction Buffer, NGMPCRF and NGMPCRR are from AmpFLSTR TM NGM SElect TM PCR amplification kit.

[0073] C reaction conditions (Table 5):

[0074] Table 5

[0075]

[0076] All sample IndexPCR products were mixed in equal proportions according to the amplification efficiency.

[0077] 3) Sample mixing and gel cutting and recovery Sample mixing and gel cutting and recovery:

[0078] A. Prepare 2% agarose gel, take 50μL of index PCR mixture, and perform electrophoresis at 120V for 35 minutes.

[0079] B. Refer to the commercial DNA Marker B and cut out the brighter band area near the size of the target product.

[0080] C. Refer to the instructions of TIANGEN Gel Extraction kit for gel recovery operation.

[0081] 4) Library quantification and sequencing Library quantification and sequencing:

[0082] A. The fragment length distribution of the library was verified by Agilent 2100 Bioanalyzer.

[0083] B. After the molar concentration of the library was accurately quantified, high-throughput sequencing was finally performed on the Illumina Novaseq6000 sequencing platform in a 2×150bp double-end sequencing mode to obtain FastQ data.

[0084] 5) CpG methylation detection data analysis:

[0085] Read the sequencing data, count the number of reads and sequencing quality of each sample, and splice the filtered R1 and R2 reads using the software FLASH (FLASH: Fastlength adjustment of short reads to improve genome assemblies.). Use FastX (http: / / hannonlab.cshl.edu / fastx_toolkit / index.html) to process the spliced ​​fastq file to obtain the fa format sequence. Then use blast+ to align all reads in the fa with the reference sequence of the target region (i.e., CpG island sequence). Screen reads that can cover 90% of the target sequence or have 90% of the bases that can completely cover the target sequence, record them as valid reads, and count them, and then count the efficiency of base C to T in the valid sequencing data of each sample after bisulfite treatment. Subsequently, calculate the methylation level of the CpG site in the amplicon and display it in the form of a bubble chart.

[0086] Data statistical processing:

[0087] Quantitative data were expressed as mean ± standard deviation or median (minimum to maximum). When the data conformed to normal distribution, t-test was used for intergroup comparison. If not, nonparametric test was used for intergroup comparison. Qualitative data were expressed as percentages and Fisher's exact probability method was used for intergroup comparison. The receiver operating characteristic curve (ROC) method was used to determine the effectiveness of the indicator for a specific target value, and the area under the curve (AUC) (95% confidence interval) was calculated. The optimal cutoff value, sensitivity and specificity of the indicator were selected based on the maximum Youden coefficient. The ROC comparison of the two indicators was performed using the paired sample area difference under the ROC curve. IBM SPSS statistics (version 26) or Graph Pad Prism (version 8.2.1.) was used as the statistical software. p < 0.05 was considered statistically significant.

[0088] result:

[0089] (1) General

[0090] The average age of the 21 female patients with lung adenocarcinoma was 64±6 years old, and the median size of the radiographic nodules (minimum to maximum) was 10 (6-34.8) mm. Among them, the average ages of the 9 patients with pleural plaque-positive lung adenocarcinoma and the 12 patients with pleural plaque-negative lung adenocarcinoma were 64±8 years old and 64±5 years old, respectively (p>0.05), and the median size of the radiographic nodules (minimum to maximum) were 10 (6-15) mm and 9.5 (6-34.8) mm, respectively (p>0.05). In pleural plaque-positive lung adenocarcinoma and pleural plaque-negative lung adenocarcinoma, the proportion of patients with radiographic nodules ≥10 mm was 55.5% (5 / 9) and 50% (6 / 12), respectively (p>0.05).

[0091] (2) Serological tumor indicators

[0092] The median values ​​(minimum to maximum) of serum CA199, CA153, and CA125 in 21 female patients with lung adenocarcinoma were 5.8 (2-28), 10.1 (4.3-36.2), and 10.1 (3-18.9), respectively. Among them, the median values ​​of serum CA199 in 9 patients with pleural plaque-positive lung adenocarcinoma and 12 patients with pleural plaque-negative lung adenocarcinoma were 17.8 and 3.6 (p<0.05), the median values ​​of CA153 were 10.1 and 8.1 (p>0.05), and the median values ​​of CA125 were 12.4 and 8.1 (p>0.05). The results are shown in Table 1. Figure 2 .

[0093] (3) Differential hotspot locations of SLC40A1 gene in cancer tissues

[0094] There was no significant difference in the methylation levels of SLC40A1 gene at different methylation positions between pleural plaque-positive lung adenocarcinoma and pleural plaque-negative lung adenocarcinoma tissues ( Figure 3 ).

[0095] For pleural plaque-positive lung adenocarcinoma, there were two SLC40A1 methylation differences between imaging nodules ≥10 mm and <10 mm, namely 189580781 and 189581152; the median methylation rates of position 189580781 were 0.102% and 1.418% (p<0.05), and the median methylation rates of position 189581152 were 0.638% and 3.140% (p<0.05) ( Figure 4 ).

[0096] For pleural plaque-negative lung adenocarcinoma, the SLC40A1 methylation difference between imaging nodules ≥10 mm and <10 mm was only at 189580781. The median methylation rates were 0.23% and 1.141%, respectively (p<0.05) ( Figure 5 ).

[0097] (4) ROC characteristics of CA199 in identifying pleural plaque-positive lung adenocarcinoma

[0098] The AUC of CA199 for screening pleural plaque-positive lung adenocarcinoma was 0.7685 (0.5633-0.9738) (p<0.05). When the optimal cutoff value was >5.3, its sensitivity and specificity were 77.8% and 66.7%, respectively ( Figure 6 ).

[0099] (5) ROC characteristics of SLC40A1 gene methylation for identifying lung adenocarcinoma with imaging nodules ≥10 mm

[0100] For pleural plaque-positive lung adenocarcinoma, when the methylation level of 189580781 or 189581152 gene position was <0.159% or <1.114%, the AUC for distinguishing radiographic nodules ≥10 mm was 1 and 0.95 (Table 6), but there was no significant difference between the two gene positions in distinguishing radiographic nodules ≥10 mm ( Figure 7 ).

[0101] For pleural plaque-negative lung adenocarcinoma, when the methylation level of the 189580781 gene position was <0.291%, the AUC for identifying radiographic nodules ≥10 mm in size was 0.861 (p<0.05) (Table 7).

[0102] Table 6

[0103]

[0104]

[0105] Table 7

[0106]

[0107] From the above results, we can at least know that:

[0108] (1) Serological CA199 testing can identify pleural plaque-positive and -negative lung adenocarcinoma in women. Combined with inquiries about asbestos exposure history, it provides objective tumor biochemical indicators for the identification of asbestos-related lung cancer with ideal sensitivity.

[0109] (2) The methylation modification level of specific sites of the SLC40A1 gene decreased, which was closely related to the radiographic size of female lung adenocarcinoma >10 mm. Among them, the CpG site methylation detection of site 189580781 can be used as a monitoring indicator to identify female lung adenocarcinoma with radiographic nodule size ≥10 mm, and combined with the CpG site methylation detection of site 189581152, it can further identify female pleural plaque-positive lung adenocarcinoma with radiographic nodule size ≥10 mm. The above indicators have good specificity and sensitivity.

[0110] (3) In the asbestos-exposed population with pleural plaques, methylation of CpG sites 189580781 and 189581152 can be used as an epigenetic monitoring indicator for risk assessment of lung adenocarcinoma.

[0111] (4) CA199 combined with methylation level detection of two specific sites can identify asbestos-related lung adenocarcinoma with large nodules, suggesting that CA199 combined with methylation level detection of two specific sites can not only identify asbestos-related lung adenocarcinoma, but also assess the risk of its progression.

[0112] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. A biomarker combination for asbestos-related lung adenocarcinoma in women, characterized in that: The invention comprises a combination of two methylation sites of serum marker CA199 and SLC40A1 gene, wherein the combination of the two methylation sites is a combination of the 189580781st methylation site in the 189580844-189580646 region of the SLC40A1 gene and the 189581152nd methylation site in the 189581219-189581043 region.

2. A biomarker for asbestos-related lung adenocarcinoma in women, characterized in that: It includes a combination of the 189580781st methylation site in the 189580844-189580646 region and the 189581152nd methylation site in the 189581219-189581043 region of the SLC40A1 gene.

3. Use of the biomarker combination according to claim 1 or the biomarker according to claim 2 in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

4. Use of methylation sites as biomarkers in the preparation of reagents or kits for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women, characterized in that: The methylation site is a combination of the 189580781st site and the 189581152th site of the SLC40A1 gene.

5. Use of a reagent for detecting the methylation degree of the 189580781st site and the 189581152th site of the SLC40A1 gene in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

6. A nucleic acid composition for detecting methylation, characterized in that: The invention comprises an amplification primer combination: the primers are designed for the 189580844-189580646 region and the 189581219-189581043 region of the SLC40A1 gene, the nucleotide sequence of the 189580844-189580646 region is shown in SEQ ID NO.2, and the nucleotide sequence of the 189581219-189581043 region is shown in SEQ ID NO.

3.

7. The nucleic acid composition according to claim 1, characterized in that The amplification primer combination includes: Upstream primer corresponding to the fragment sequence of 189580844 to 189580646: GGAGGTYGTAGGGAGTTTYGTTTT; Downstream primers corresponding to the fragment sequence of 189580844 to 189580646: TTTTTCCTTCTTTCCAAACTTAACTAACA; The upstream primer corresponding to the sequence of fragment 189581219 to 189581043: TTTTTTTTTGAATTGYGGGGTAG; The downstream primer corresponding to the sequence of fragment 189581219 to 189581043: AATTTTCCTACTCTCCRAAAAAC; Among them, the degenerate bases Y and R represent C / T and A / G respectively.

8. Use of the nucleic acid composition according to claim 6 or 7 in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women.

9. A reagent or kit for detecting methylation, characterized in that: Comprising the nucleic acid composition as claimed in claim 6 or 7.

10. A reagent or kit for diagnosis, auxiliary diagnosis or risk assessment of asbestos-related lung adenocarcinoma in women, characterized in that: It comprises a reagent for specifically detecting serum CA199 and a nucleic acid composition as claimed in claim 6 or 7.

Images