Method for detecting TA repetitive sequence polymorphism of UGT1A1 gene based on nucleic acid mass spectrometry technology and application

Abstract

The invention discloses a method for detecting the polymorphism of a TA repetitive sequence of a UGT1A1 gene based on a nucleic acid mass spectrometry technology and application, and belongs to the technical field of biology. In the method, a primer group with sequences shown as SEQ ID NO.1-24, 26-36 and 38 is used, the SEQ ID NO.1-24 is an amplification primer sequence of each mutation site, and the other primers are single-base extension primers. Multiple detection is carried out on irinotecan medication related gene polymorphic sites on the basis of a nucleic acid mass spectrum platform, detection of 12 polymorphic sites is realized in one hole, the detection cost is low, and the use amount of samples is small. In addition, the nucleic acid mass spectrometry technology also has the advantages of simplicity and convenience in operation, high sensitivity, high specificity, high accuracy and the like, and also overcomes the defects of insufficient qPCR flux and high sequencing technology cost.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method and application for detecting UGT1A1 gene TA repeat sequence polymorphism based on nucleic acid mass spectrometry technology. Background Art

[0002] Irinotecan (CPT-11) is an important anticancer drug, commonly used to treat metastatic colorectal cancer and other solid tumors. Irinotecan belongs to the class of topoisomerase inhibitors and is hydrolyzed into an active metabolite, SN-38, in the body. SN-38 inhibits the activity of topoisomerase I by binding to topoisomerase I, thereby interfering with the DNA replication and repair of cancer cells, making it impossible for cancer cells to divide and proliferate normally, and ultimately leading to cancer cell death. SN-38 is then inactivated by UGT1A1-mediated production of glucuronidated SN-38 (SN-38G), thereby protecting healthy cells from the toxic effects of irinotecan. The most common toxic side effects of irinotecan are delayed diarrhea and neutropenia, which can lead to death in severe cases.

[0003] UGT1A1 is the key enzyme that converts the active product SN-38 of irinotecan into the inactive product SN-38G. Therefore, the genetic polymorphism of UGT1A1 is closely related to the adverse reactions of irinotecan. The most common polymorphic sites are UGT1A1*28 and UGT1A1*6. A large number of studies have shown that they can be used to predict the toxic and side effects caused by irinotecan. Other studies have also shown that other polymorphic sites of UGT1A1, such as UGT1A1*27, UGT1A1*60 and UGT1A1*93, also have the significance of predicting the toxic and side effects of irinotecan. As early as 2005, the US FDA required the addition of a warning to the irinotecan drug instructions, suggesting that patients undergo UGT1A1*28 testing before using the drug and carefully consider the dosage according to the mutation type. In addition, some reports also show that genetic polymorphisms of transporters involved in the uptake and efflux of irinotecan and its metabolites are also one of the reasons for the individual differences in irinotecan toxicity, such as OATP1B1 (SLCO1B1), ABC transporters, including ABCC2, ABCB1 and ABCG2. Therefore, in addition to the detection of UGT1A1 mutation types, polymorphic sites of other related genes also need to be detected to better assist in guiding the use of irinotecan.

[0004] At present, the main methods for UGT1A1 and other gene polymorphisms include qPCR, Sanger sequencing, PCR-capillary electrophoresis, gene chips, etc. Among these polymorphic sites, since UGT1A1*28 is 7 TA repeat sequences and its wild type (UGT1A1*1) is 6 TA repeat sequences, this special mutation type has certain difficulties for conventional qPCR detection methods. The qPCR method requires the design of specific probes and primers. According to the traditional design ideas, whether the probe or primer is placed on the TA repeat region, due to the large number of TA repeats and the difference between the wild type and the mutant type is only 1 TA, during the amplification process, the primer or probe is easy to mismatch with the TA repeat region or form primer dimers and hairpin structures, resulting in poor typing effect. In addition, the qPCR method has low throughput and cannot detect multiple sites simultaneously in a single well. Although Sanger sequencing can better distinguish TA repeat sequences, this method is cumbersome to operate, has low throughput and high cost. PCR-capillary electrophoresis is also recommended for the detection of UGT1A1*28 polymorphism, but it is difficult to determine the exact site of the mutation for point mutations, and the detection effect is poor. It generally needs to be combined with other technologies, such as ASA. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology is often used for the detection of SNP sites. It has the characteristics of high throughput, simple operation, high sensitivity, and simple result interpretation. The primer design is also relatively simple, and no fluorescent probes and dyes are required. Summary of the invention

[0005] The present invention designs a method for (TA)n repeat typing in the promoter region of the UGT1A1 gene based on single base extension technology and nucleic acid mass spectrometry platform, which can accurately distinguish (TA)5, (TA)6 and (TA)7 while avoiding the formation of hairpin structures and dimers between primers. Moreover, the design concept is not limited to the detection of this type of polymorphism, and is also applicable to the detection of repeated polymorphisms of the same type with slight adjustments.

[0006] The nucleic acid mass spectrometry experiment is mainly divided into four parts: enrichment, digestion, extension and on-machine detection. The extension reaction refers to the process in which the single base extension primer (UEP) is annealed and combined with the target gene and then only extends one base and then terminates. Four ddNTPs without 3'-OH are generally added to the reaction system, namely acyATP, acyCTP, acyGTP and modified acyTTP. In the present invention, only two termination extension bases, acyCTP and acyGTP, are added to the extension reaction system, while ordinary dATP and dTTP are added to the A and T bases. Therefore, after the UEP is combined with the target gene, if the next base of the template is C or G, the extension is terminated by one base. If the next base is A or T, the extension will not be terminated after extending T or A, and the extension will be terminated when the G or C base is encountered. For the detection of (TA)n repeat polymorphism in the promoter region of UGT1A1 gene, in order to avoid nonspecific extension caused by primer dimers, the UEP sequence designed by the present invention only contains 3 TAs in the (TA)n repeat sequence, and introduces a locked nucleic acid to improve sequence specificity. If it is wild type (TA)6, UEP will first extend 7 A and T bases during the extension process, and finally terminate at G base (such as Figure 1 ); if it is mutant type (TA)7, 9 A and T bases are extended first during the extension process, and finally terminate at the G base; if it is mutant type (TA)5, 5 A and T bases are extended first during the extension process, and finally terminate at the G base. The molecular weight difference between them is one TA, so they can be accurately distinguished.

[0007] Furthermore, when using the above detection method, in order to completely convert UEP and reduce intermediate products, the present invention also provides an optimized extension reaction procedure, and the specific reaction conditions are shown in the following table:

[0008]

[0009] The present invention also provides a kit for detecting polymorphic sites of genes related to irinotecan administration, which can detect multiple site mutations of multiple genes in one well, has high sensitivity and is easy to operate, and its technical scheme is as follows:

[0010] By consulting a large amount of data, 12 genetic polymorphism sites of irinotecan-related genes were finally screened out, including UGT1A1*28 (rs3064744), UGT1A1*6 (rs4148323), UGT1A1*27 (rs35350960), UGT1A1*60 (rs4124874), UGT1A1*93 (rs10929302), ABCC2

[0011] 3972C>T(rs3740066), ABCC21249G>A(rs2273697), ABCC2-24C>T(rs717620), ABCB11236C>T(rs1 128503), SLCO1B1388A>G (rs2306283), SLCO1B1521T>C (rs4149056) and ABCG2421C>A (rs2231142).

[0012] The amplification primers and UEPs for these 12 sites were designed using the new design ideas described above in the present invention. Considering the large number of primers and the ease of dimerization between primers, the Multiple Primer Analyzer website was used to analyze the primer interactions of all designed primers, and primers with serious primer dimers or non-specific binding at the 3' end of the primers were removed and redesigned. Several sets of amplification primers and UEPs for each mutation site can be designed to facilitate subsequent screening and verification.

[0013] The designed amplification primers and UEP were screened and verified using DNA extracted from whole blood samples as templates. The quality of the amplification primers was verified using capillary electrophoresis technology to detect whether there were target amplification fragments in the amplification products, whether there were obvious non-specific products, and the primer amplification efficiency; UEP used nucleic acid mass spectrometry technology as a detection method to detect whether the target extension products were generated and the extension conversion efficiency, as well as whether there were non-specific extension products; after combining all the above tests, the final primer sequences were determined as follows:

[0014]

[0015]

[0016]

[0017] In the primer set, SEQ ID NO.1 to 24 are the amplification primer sequences of each mutation site, and SEQ ID NO.25 to 36 are the UEP sequences of each site, wherein the "C+" in the UGT1A1*28_U2_LNA (SEQ ID NO.25) primer indicates that the C base is modified with LNA.

[0018] The irinotecan medication-related gene polymorphism site detection kit provided by the present invention comprises all the above primers.

[0019] In addition to the above primer sets, the kit also includes reagents required for three rounds of reactions, including a premix for enrichment reaction, namely, PCR buffer, dNTPs, MgCl2 and Taq DNA polymerase; digestion buffer and SAP enzyme for digestion reaction; extension buffer, UEP enzyme, acyCTP, acyGTP, dATP and dTTP for extension reaction; and nuclease-free water required for three rounds of reactions.

[0020] The present invention also provides an experimental method for detecting irinotecan medication-related gene polymorphism sites based on nucleic acid mass spectrometry technology, which specifically comprises the following steps:

[0021] (1) Using the sample DNA to be tested as a template, a first round of enrichment reaction amplification is performed, which contains all the above-mentioned amplification primers, i.e., SEQ ID NOs. 1 to 24;

[0022] (2) digesting the enriched product with SAP enzyme to remove excess dNTPs;

[0023] (3) performing a single base extension reaction on the digestion product, which contains all of the above-mentioned UEPs, i.e., SEQ ID NOs. 25 to 36;

[0024] (4) purifying the extension product with resin to remove salt ions;

[0025] (5) Time-of-flight mass spectrometry on-board detection and analysis.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) A method for typing the (TA)n repeats in the promoter region of the UGT1A1 gene was designed based on single base extension technology and a nucleic acid mass spectrometry platform. For this special mutation type, the primers obtained according to the traditional nucleic acid mass spectrometry primer design ideas are very likely to produce non-specific extensions in the experiment. The present invention cleverly adjusts the base type and composition in the extension reaction to achieve accurate typing of the (TA)n repeat sequence in the promoter region of the UGT1A1 gene. Moreover, this design idea is not limited to the detection of this type of polymorphism. For the detection of the same type of repeated polymorphism, it is also applicable by slightly adjusting the raw bases in the extension reaction.

[0028] (2) In addition to the two common polymorphic sites of UGT1A1*28 and UGT1A1*6, which are related to irinotecan medication, the present invention also provides detection of other polymorphic sites of UGT1A1 and polymorphic sites of ABCC2, ABCB1, ABCG2 and SLCO1B1 genes, providing more references for irinotecan medication guidance.

[0029] (3) The present invention performs multiple detection of irinotecan-related gene polymorphic sites based on a nucleic acid mass spectrometry platform, and detects 12 polymorphic sites in one well, with low detection cost and small sample usage. In addition, nucleic acid mass spectrometry technology also has the advantages of simple operation, high sensitivity, high specificity and high accuracy, and also makes up for the shortcomings of insufficient qPCR throughput and high cost of sequencing technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the method for (TA)n repeat typing of the UGT1A1 gene promoter region of the present invention.

[0031] Figure 2 This is the mass spectrum peak diagram of the extension primer UGT1A1*28_U3 using nuclease-free water as the sample in Example 1.

[0032] Figure 3 This is the mass spectrometry peak diagram of the primer UGT1A1*28_U4 extended using human genomic DNA as the sample in Example 1.

[0033] Figure 4 This is the mass spectrometry peak diagram of the primer UGT1A1*28_U2 extended using human genomic DNA as the sample in Example 1.

[0034] Figure 5 This is the mass spectrometry detection peak diagram of the wild-type UGT1A1*1 / *1 sample in Example 2.

[0035] Figure 6 This is the mass spectrometry detection peak diagram of the homozygous mutant UGT1A1*28 / *28 sample in Example 2.

[0036] Figure 7 This is the mass spectrometry detection peak diagram of the heterozygous mutant UGT1A1*1 / *28 sample in Example 2. DETAILED DESCRIPTION

[0037] Example 1

[0038] 1. Primer design

[0039] Aiming at detecting the (TA)n repeat polymorphism in the promoter region of UGT1A1 gene, corresponding enrichment amplification primers and extension primers were designed to preliminarily investigate the feasibility of the scheme and screen suitable single-base extension primers.

[0040] Primer name Primer sequences SEQ ID NO. UGT1A1*28_F1 acgttggatgAACATTAACTTGGTGTATCGATTGGT 1 UGT1A1*28_R1 acgttggatgAGCAGGCCCAGGACAAGT 2 UGT1A1*28_U1 CCTCTCCTACTTATATA 37 UGT1A1*28_U2 CCTCTCCTACTTATATATA 38 UGT1A1*28_U3 CCTCTCCTACTTATATATATA 39 UGT1A1*28_U4 CCTCTCCTACTTATTTATATA 40

[0041] 2. Preparation of reaction solution

[0042] The enrichment reaction solution, digestion reaction solution and extension reaction solution were prepared according to the following formula table, wherein the corresponding extension reaction solutions were prepared according to the four UEPs, and U1, U2, U3 and U4 were prepared into reaction system 1, reaction system 2, reaction system 3 and reaction system 4 respectively; the PCR buffer (pH 7.5) contained 100mM (NH4)2SO4, 500mM KCl, 200mM HEPES, and the pH value was 7.5; the digestion buffer contained 200mM Tris-HCl, 100mM MgCl2, and the pH value was 8.0; the extension buffer contained 200mM Tris-HCl, 100mM (NH4)2SO4, 100mM KCl, 20mM MgSO4, 1% Triton-X, and the pH value was 8.8.

[0043] Table 1 Enrichment reaction solution formula

[0044]

[0045] Table 2 Digestion reaction solution formula

[0046]

[0047] Table 3 Extension reaction solution formula

[0048]

[0049] 3. Enrichment and amplification

[0050] The enrichment reaction system was prepared according to the ratio of "3 μL of enrichment reaction solution + 0.2 μL of Taq enzyme". After mixing and centrifugation, the mixture was dispensed into eight tubes at a volume of 3.2 μL per person. 2 μL of human genomic DNA (10 ng / μL) was added to reaction wells 1, 3, 5, and 7, and 2 μL of nuclease-free water was added to reaction wells 2, 4, 6, and 8. The tubes were carefully capped and PCR amplification was performed after rapid centrifugation. The PCR amplification program is shown in Table 4.

[0051] Table 4 Enrichment reaction PCR amplification program

[0052]

[0053] 4. Digestive reaction

[0054] The digestion reaction system was prepared according to the ratio of "1.7 μL digestion reaction solution + 0.3 μL SAP enzyme". After mixing and centrifugation, 2 μL of the solution was added to the eight-tube series after the above reaction was completed. The tubes were carefully covered. After rapid centrifugation, the digestion reaction was carried out according to the PCR program in Table 5.

[0055] Table 5 Digestion reaction PCR amplification program

[0056]

[0057] 5. Extension reaction

[0058] Four different extension reaction systems were prepared according to the ratio of "3 μL extension reaction solution + 0.04 μL UEP enzyme". After mixing and centrifugation, extension reaction system 1 was added to reaction wells 1 and 2 of the eight-tube strip after the above reaction was completed at a volume of 3 μL per well. Correspondingly, extension reaction system 2 was added to reaction wells 3 and 4, extension reaction system 3 was added to reaction wells 5 and 6, and extension reaction system 4 was added to reaction wells 7 and 8. Carefully cover the tubes, quickly centrifuge, and perform extension reactions according to the PCR program in Table 6.

[0059] Table 6 Extension reaction PCR amplification program

[0060]

[0061] 6. On-machine testing

[0062] After the reaction is completed, take out the eight-tube strip, add 40 μL of nuclease-free water to each reaction well in turn and transfer to a 96-well plate, taking care to avoid bubbles; transfer the 96-well plate to the DR MassARRAY fully automated system for on-machine detection and analysis; after the run is completed, check the generated mass spectrometry peak diagram.

[0063] 7. Results Analysis

[0064] Checking the test results of nuclease-free water, it was found that non-specific extension products appeared in the extension reaction system 3 ( Figure 2 ), indicating that primer dimers were generated during the reaction of the extension primer UGT1A1*28_U3, and A product peaks and AG product peaks were extended, which was not applicable; checking the test results of human genomic DNA, it was found that the extension reaction system 4 had no corresponding extension product peak ( Figure 3 ), indicating that the extension primer UGT1A1*28_U4 does not produce primer dimers when introducing artificial mutant bases, but cannot extend the target base normally and is not applicable; UGT1A1*28_U1 and UGT1A1*28_U2 do not produce primer dimers and have extension products, but the incomplete extension of both leads to more intermediate products ( Figure 4 ), considering that UGT1A1*28_U1 would produce more intermediate products than UGT1A1*28_U2 during extension, UGT1A1*28_U2 was finally selected as the extension primer for subsequent system optimization to improve the extension efficiency of the target product.

[0065] Example 2

[0066] 1. Optimization ideas

[0067] In order to improve the extension efficiency of the extension primer UGT1A1*28_U2 during the extension reaction and avoid the appearance of incompletely extended intermediate extension products, on the one hand, the present invention adds LNA modification on the basis of the extension primer UGT1A1*28_U2 (primer sequence is shown in the table below) to adapt to a higher annealing temperature; on the other hand, a high-fidelity Taq enzyme is used in the enrichment reaction to improve the accuracy of amplification; at the same time, the extension reaction PCR amplification program is adjusted, including gradiently increasing the annealing temperature and extending the annealing reaction time to achieve the purpose of complete extension.

[0068]

[0069]

[0070] 2. Sample processing

[0071] In this example, 3 human genomic DNA samples were collected and sequenced to confirm the genotypes of UGT1A1 gene *1 / *1, *1 / *28 and *28 / *28. Each sample was diluted to 10 ng / μL according to the sample concentration for detection in this example.

[0072] 3. Amplification reaction

[0073] The enrichment reaction solution was prepared according to the formula table in Table 7; the digestion reaction solution and the extension reaction solution were prepared according to the formula table in Example 1, wherein the extension primer was replaced with UGT1A1*28_U2_LNA (SEQ ID NO.25).

[0074] Table 7 Enrichment reaction solution formula (after optimization)

[0075]

[0076] Take 3 μL of the enrichment reaction solution, add 2 μL of the above sample respectively, set the amplification program according to Table 4 in Example 1, and perform enrichment amplification.

[0077] The digestion reaction systems were prepared according to the ratio of "1.7 μL of digestion reaction solution + 0.3 μL of SAP enzyme", 2 μL of each was added to the enriched amplification product, and the amplification program was set according to Table 5 in Example 1 to perform the digestion reaction.

[0078] The extension reaction system was configured according to the ratio of "3 μL of extension reaction solution + 0.04 μL of UEP enzyme", and 3 μL was added to the digestion product respectively. The amplification program was set according to Table 8 to perform a single base extension reaction.

[0079] Table 8 Extension reaction PCR amplification program (after optimization)

[0080]

[0081]

[0082] 4. On-machine testing and analysis

[0083] The on-machine test was performed according to the method in Example 1, and the generated mass spectrometry peak graph was checked after the operation was completed. The test results showed that after optimization and adjustment, the extension primer UGT1A1*28_U2_LNA was completely converted into the corresponding extension product, and there was no incomplete extension intermediate product. The extension products of different types were analyzed, and the mass spectrometry test results were interpreted with a conversion efficiency of 0.1 as the threshold. The extension product of the wild-type *1 / *1 sample only contained the UGT1A1*1 product peak ( Figure 5 ); The main extension product of the homozygous mutant *28 / *28 sample is the UGT1A1*28 product peak, and there is a very small amount of UGT1A1*1 product peak, which was excluded because its conversion rate was lower than 0.1 ( Figure 6 ); heterozygous mutant *1 / *28 samples contain both UGT1A1*1 and UGT1A1*28 extension product peaks ( Figure 7 ). The above results show that after the optimization of primers and enrichment and extension conditions, the design method of the present invention can complete the accurate typing detection of the (TA)n repeat sequence polymorphism in the promoter region of the UGT1A1 gene.

[0084] Example 3

[0085] A kit for detecting irinotecan-related gene polymorphic sites, the method used is based on the method for detecting the polymorphism of the (TA)n repeat sequence in the promoter region of the UGT1A1 gene described in Example 2 of the present invention, the primers include SEQ ID NO.1-36, and a total of 12 irinotecan-related gene polymorphic sites including the UGT1A1*28 polymorphic site are detected. The performance of the kit is investigated in combination with the examples below.

[0086] 1. Sample processing

[0087] Twenty whole blood samples were collected and sequenced to determine the mutation types of 12 mutation sites, including UGT1A1*28 (rs3064744), UGT1A1*6 (rs4148323), UGT1A1*27 (rs35350960), UGT1A1*60 (rs4124874), UGT1A1*93 (rs10929302), ABCC23972C>T (rs3740066), ABCC21249G>A (rs2273697), ABCC2-24C>T (rs717620), ABCB1 1236C>T (rs1128503), and SLCO1B1 388A>G (rs2306283), SLCO1B1521T>C (rs4149056) and ABCG2421C>A (rs2231142). Each sample was diluted to 10 ng / μL according to the sample concentration for detection in this example.

[0088] 2. Preparation of reaction solution

[0089] Prepare the enrichment reaction solution, digestion reaction solution (same as Table 2) and extension reaction solution according to the following formula table.

[0090] Table 9 Enrichment reaction solution formula

[0091]

[0092]

[0093] Table 10 Extension reaction solution formula

[0094]

[0095]

[0096] 3. Amplification reaction

[0097] Take 3 μL of the enrichment reaction solution and add 2 μL of the above sample, set the amplification program according to Table 4 in Example 1, and perform enrichment amplification.

[0098] The digestion reaction systems were prepared according to the ratio of "1.7 μL of digestion reaction solution + 0.3 μL of SAP enzyme", 2 μL of each was added to the enriched amplification product, and the amplification program was set according to Table 5 in Example 1 to perform the digestion reaction.

[0099] The extension reaction system was configured according to the ratio of "3 μL of extension reaction solution + 0.04 μL of UEP enzyme", and 3 μL was added to the digestion product respectively. The amplification program was set according to Table 8 in Example 2 to perform a single base extension reaction.

[0100] 4. Computer testing and result analysis

[0101] The on-machine detection was performed according to the method in Example 1. After the operation was completed, the generated mass spectrometry peak graph was checked and the extension product conversion rate was calculated. If a single-base extension primer had a product peak and the conversion rate was greater than 0.2, it was judged as positive for the corresponding type, otherwise it was judged as negative for the corresponding type. Table 11 shows the detection results.

[0102] Table 11 Results of nucleic acid mass spectrometry testing of 20 samples

[0103]

[0104] The above 20 whole blood samples were all verified by NGS sequencing, and the sequencing results were consistent with the nucleic acid mass spectrometry detection results of the kit of the present invention, indicating that the irinotecan medication-related gene polymorphism site detection kit of the present invention has high accuracy.

[0105] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for detecting TA repeat sequence polymorphism of UGT1A1 gene, characterized in that: The sequences of the primer set are shown in SEQ ID NOs. 1-24, 26-36, and 38, wherein SEQ ID NOs. 1-24 are amplification primer sequences for each mutation site, and the remaining primers are single-base extension primers.

2. The primer set according to claim 1, characterized in that The C base at position 10 of the primer with the sequence shown in SEQ ID NO. 38 was modified with LNA.

3. A reagent, characterized in that The reagent includes the primer set according to claim 1 or 2.

4. The reagent according to claim 3, characterized in that The reagents also include acceptable auxiliary materials or adjuvants.

5. A kit, characterized in that: The kit contains the primer set according to claim 1 or 2.

6. Use of the primer set according to claim 1 or 2 in preparing a product for detecting polymorphism of TA repeat sequence of UGT1A1 gene.

7. The use according to claim 6, characterized in that: The product is a reagent or a kit.

8. The use according to claim 6 or 7, characterized in that: The method of using the reagent or kit is as follows: (1) Using the sample DNA to be tested as a template, PCR was performed using the amplification primers shown in SEQ ID NO. 1-24 to obtain enriched products; (2) digesting the enriched product with SAP enzyme to obtain a digestion product; (3) performing a single base extension reaction on the digestion product using a single base extension primer to obtain an extension product; (4) removing salt ions from the extension product; (5) Time-of-flight mass spectrometry on-board detection and analysis; In the step (3), an extension reaction reagent is used, and the extension reaction reagent contains acyGTP and acyCTP.

9. The use according to claim 8, characterized in that: The extension reaction reagents include the following components:

Images