Multiplex PCR (Polymerase Chain Reaction) primer probe combination and kit for human red blood cell RHD genetic typing detection

Abstract

The invention relates to a multiplex PCR (polymerase chain reaction) primer probe combination and a kit for human red blood cell RHD genetic typing detection, and belongs to the field of biomedicine clinical molecular detection. The multiplex PCR primer and probe combination for human red blood cell RHD genetic typing detection comprises 19 pairs of specific primers distributed in 8 reaction holes and corresponding probes. The invention also provides a kit containing the multiplex PCR primer probe combination for the human red blood cell RHD genetic typing detection. According to the invention, the RHD gene variation site specific primer and probe designed by combining ARMS with a homologous sequence specific base method are adopted, so that the specificity and the accuracy are higher; all high-frequency RHD gene variants, including DEL type (RHD * DEL1, c.1227Ggt; the kit can be used for detecting the D-negative phenotype RHD * D-CE (2-9), the D-negative phenotype RHD * D-CE (2-9), the D-negative phenotype RHD * 01N. 16 (c.711delC), the D-negative phenotype RHD * D-CE (2-9), the D-negative phenotype RHD * D-CE (2-9) and the D-negative phenotype RHD * 01N. 16 (c.711delC) which are common for people in China, and can also be used for detecting the normal RHD positive type (RHD * 01).

Description

Technical Field

[0001] The invention relates to a multiplex PCR primer probe combination and a kit for human red blood cell RHD gene typing detection, and belongs to the field of biomedical clinical molecular detection. Background Art

[0002] The Rh blood group system is the second largest blood group system after the ABO blood group system and has complex polymorphism. The Rh blood group system includes two main antigens: D antigen (Rh factor) and C, c, E, and e antigens. Among them, the D antigen is the main feature of the Rh blood group system. It exists on the surface of the human red blood cell membrane and has the strongest immune reactivity and the most significant clinical significance. Depending on whether the individual carries the D antigen, the Rh blood type can be divided into two types: Rh positive and Rh negative. In addition to the D antigen, due to the absence, recombination, mutation and other factors of the RhD gene, the amino acids in the extracellular, transmembrane and intracellular regions will also change, resulting in other different RHD genotypes, such as partial D, weak D and DEL types, which are collectively referred to as D variants.

[0003] RHD genotyping is very important for blood typing and transfusion medicine. During the transfusion process, knowing the specific type of the RHD gene of the recipient and the donor can avoid transfusion reactions caused by Rh blood type incompatibility, such as hemolytic reactions, and help ensure the safety of transfusion matching. At the same time, in prenatal screening of pregnant women, RHD genotyping can be used to detect the Rh-negative or Rh-positive blood type of pregnant women, thereby predicting the Rh blood type of the fetus, providing an important reference for the prenatal prevention of hemolytic disease in Rh-negative pregnant women. In addition, RHD genotyping also helps to understand the association between different RHD genotypes and Rh blood type-related diseases, such as the pathogenesis and clinical manifestations of genetic diseases such as autoimmune hemolytic anemia. At the same time, it also helps to evaluate the possible risks of certain specific RHD genotypes and transfusion reactions. Therefore, RHD genotyping has important application value in clinical transfusion, prenatal diagnosis, genetic disease research, transfusion reaction risk assessment, and personalized disease treatment. Through RHD genotyping, an individual's Rh blood type information can be more accurately understood, thereby providing more accurate guidance for medical diagnosis and treatment.

[0004] Traditional serological methods for RHD genotyping usually include direct antiglobulin test (DAT) and indirect antiglobulin test (IAT). DAT is a method for directly detecting antibodies on the surface of red blood cells. After the red blood cells react with antiglobulin reagents (usually anti-IgG and / or anti-C3d antibodies), the binding of antibodies or complement on the surface of red blood cells is observed under a microscope. IAT is a method for indirectly detecting antibodies in body fluids (such as serum or plasma). The serum reacts with known red blood cell antigens (usually RhD antigens), and then observes whether antibodies bind by adding antiglobulin reagents (such as anti-human globulin G or anti-human globulin A polyclonal antibodies). However, traditional serological methods have limitations. For example, due to the high polymorphism of the RHD gene and the many possible mutation types, traditional serological methods cannot accurately identify specific variants, resulting in false negative results. In addition, since the RHD gene is located in a chromosomal position adjacent to other genes, a locus linkage effect may occur, which means that mutations in other genes linked to the RHD gene may affect the expression of Rh protein, resulting in false positive results.

[0005] In addition, in terms of RHD genotyping, gene chip technology can also be applied. Gene chip technology is a high-throughput gene analysis technology that can detect the expression or polymorphism of thousands to millions of genes at the same time. Prepare a chip containing RHD gene-related DNA sequences, extract, label and hybridize the sample DNA to the chip, and after hybridization of the sample DNA, use a scanner to detect the intensity of the fluorescent signal to determine the genotype of each site. Compared with traditional methods, gene chip technology has the advantages of high throughput, accuracy, low sample requirements, high degree of automation, and rich data. However, gene chip technology may have disadvantages in genotyping research, such as high initial cost, complex data analysis, high technical threshold, and strict sample processing requirements. These factors may make gene chip technology inapplicable in some cases.

[0006] Real-time PCR is a technique for quantitatively detecting and analyzing DNA, RNA or genotypes by real-time monitoring of the fluorescent signal generated during the PCR reaction. The principle is as follows: First, a pair of specific primers are designed for the target DNA or RNA sequence. These two primers will bind to both ends of the target sequence and amplify it in the PCR reaction. In addition, a fluorescently labeled probe that specifically binds to the target sequence will be designed. This probe will have a fluorescent group and a fluorescent signal inhibition group. During the PCR reaction, the probe will bind to the PCR product and be recognized by the enzyme cleavage activity attached to the 3'-5' exonuclease (such as Taq polymerase). This will cause the fluorescent signal inhibition group on the probe to be removed, releasing the fluorescent group, thereby generating a fluorescent signal.

[0007] Real-time fluorescence PCR technology has many advantages over other methods in genotyping. First, it has high sensitivity and specificity, and can detect extremely low concentrations of DNA and accurately distinguish different alleles. Secondly, real-time fluorescence PCR technology has a fast analysis speed, and a batch of samples can usually be analyzed within a few hours, saving time and cost. In addition, it is also quantitative, and can perform quantitative analysis of target DNA, which helps to determine the copy number of genes, and is very important for genetic research on some diseases. Real-time fluorescence PCR technology can be used in combination with automated equipment to make the analysis process more efficient and accurate, while reducing human errors in experiments. In addition, this technology also has the ability of multiple analysis, which can detect multiple genes or multiple sites at the same time, and complete more information acquisition in one experiment, which is conducive to comprehensive analysis of genotyping. Finally, real-time fluorescence PCR technology has a wide range of applications and can be applied to various sample types, including blood, tissue, saliva, etc., and has broad application prospects in clinical and scientific research fields. In summary, real-time fluorescence PCR technology has higher sensitivity, faster analysis speed, higher degree of automation and more information acquisition capabilities in genotyping, making it one of the preferred methods for genotyping at present.

[0008] Chinese patent CN 115927646A, entitled "A primer probe set, kit and its application for detecting Rh blood type genotype in free DNA of human pedigrees and pregnant women and fetuses", provides a primer probe set kit for RHD genotyping. The kit is configured with specific primers and probes. After amplification, the RHD genotype can be identified by observing the probe melting curve, and then the RHD allele typing test can be completed. Its detection range includes two gene types: RHD whole gene deletion and RhD1227G>A mutation. However, the application scenarios of this kit are relatively limited and cannot meet the detection needs of other common RHD genotypes. Therefore, its scope of application has certain limitations.

[0009] Amplification Refractory Mutation System (ARMS) is a molecular biology technology used to detect single nucleotide polymorphisms (SNPs) or specific DNA mutations. Its principle is based on PCR amplification technology. By introducing specific primer designs, highly specific detection of base variations at specific sites is achieved. In the ARMS system, two pairs of primers are designed, one pair is used to amplify normal alleles, and the other pair is used to amplify mutant alleles. These primers are specific and can selectively bind to normal alleles or mutant alleles. In the PCR reaction, the DNA of the sample to be tested is placed in the reaction system together with the two pairs of primers, and then PCR amplification is performed. By analyzing the PCR amplification product, it is possible to directly determine whether a specific mutation exists in the sample. The ARMS system is highly specific and sensitive, and can quickly and accurately detect specific single nucleotide polymorphisms or DNA mutations, so it has been widely used in molecular diagnosis, research and clinical testing.

[0010] Therefore, in view of the limitations of existing technologies, there is an urgent need for a faster, more accurate, and simpler human red blood cell RHD genotyping detection method to meet clinical needs, improve accuracy, simplify operating procedures, reduce costs, and be able to respond to the needs of different fields. Summary of the invention

[0011] The purpose of the present invention is to improve the existing technology and provide a multiplex PCR primer probe combination and a kit for human red blood cell RHD genotyping detection to solve the deficiencies in the existing technology.

[0012] The principle of the present invention is to use real-time fluorescence PCR combined with Taqman probe technology to perform qualitative typing detection on human red blood cell RHD gene. According to the RHD gene sequence published in the GENBANK database, the RHD gene was designed by using the Amplification Refractory Mutation System (ARMS) analysis method combined with the homologous sequence specific base method. Exon1~10, DEL1227, weak D15, DVI.3, 711delC and other subtype-specific primers and probes are labeled with FAM / HEX / ROX and distributed in 8 reaction wells in sequence. 8 wells are reacted each time. The variation of 19 groups of RHD-specific positions can be detected at one time, and all high-frequency RHD gene variants in the Chinese population can be determined, including DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotypes RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC) in the Chinese population. At the same time, the normal RHD positive type (RHD*01) can also be detected. At the same time, a pair of internal standard primers and probes are added to each tube, labeled with CY5, to monitor false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample. The probe is an oligonucleotide including a 5'-end reporter group and a 3'-end quencher group. During the PCR amplification process, when the probe is intact, the quencher group is close to the reporter group, and the fluorescence emitted by the reporter group is absorbed by the quencher group, and no fluorescence signal is emitted. When the primer is extended, the probe bound to the template is cut by the Taq enzyme (5'→3' exonuclease activity), and the reporter group is separated from the quencher group to generate a fluorescence signal. The fluorescence quantitative PCR instrument automatically draws a real-time amplification curve based on the detected fluorescence signal, thereby realizing the qualitative typing detection of the RHD gene.

[0013] The Rh blood group system is one of the most important blood group systems in clinical practice, and it is also the most complex and polymorphic system in the human red blood cell blood group system. There are more than 50 known antigens in the Rh system, and 5 common antigens are C, c, D, E, and e, among which the D antigen has the strongest immunogenicity. The Rh blood group gene (RH) is located in the human chromosome 1P34.3-36.1 region, and is mainly composed of tightly linked RHD and RHCE genes arranged in tandem. The RHD gene includes 10 exons and 9 introns, encoding 417 amino acids and expressing all D antigens. The RHD and RHCE gene sequences are opposite, both consisting of 10 exons and 9 introns, each encoding 417 amino acids, and the 3' ends of the two are close to each other, with a spacing of about 30kb. The two gene structures are very similar, with a homology of more than 96%. Rh blood type has complex and rich genetic polymorphism. There are differences in the RHD molecular genetic background among different populations, and there are multiple D variants. The RHCE gene mainly encodes the CE antigen, and base substitution is the basis for the formation of RhCcEe polymorphism.

[0014] The high homology between RHD and RHCE makes it extremely difficult to accurately identify RHD subtypes. Common primer design methods have certain limitations in distinguishing RHD gene subtypes, with low accuracy or requiring the design of specific probes, which is costly.

[0015] Since the RHD gene is highly polymorphic and highly similar to the RHCE sequence, most of them differ by only one base. In actual detection, false positives are very likely to occur. In order to detect more accurately and avoid false positives, the inventors used the ARMS primer design method and improved it on the basis of traditional ARMS. ARMS combined with the homologous sequence-specific base method was used to design RHD gene variation site-specific primers and probes, thereby improving the accuracy of detection.

[0016] The real-time fluorescence PCR technology used in the present invention has high sensitivity and specificity compared with other traditional methods, can quickly and accurately perform RHD genotyping, can provide an important molecular biological detection tool for clinical blood typing and blood transfusion matching, and has broad application prospects in clinical transfusion and genetics research.

[0017] The main technical idea of ​​the present invention is to design RHD gene mutation site-specific primers and probes using the innovative ARMS combined with the homologous sequence-specific base method. One primer is designed using the identification position of RHD and RHCE, and bases with different degrees of mismatch are added based on the preliminary test results; the other primer uses the identification position bases of each subtype of RHD, and bases with different degrees of mismatch are added based on the preliminary test results; the test shows that the primer close to the 3' end is a strong mismatch primer, and the primer close to the 5' end is a weak mismatch primer; the Taqman probe is designed to be universal, which is suitable for both normal RHD gene detection and variant RHD gene detection. By combining specific primers with Taqman probes, the accuracy and sensitivity are improved while the cost is significantly reduced, making it more suitable for large-scale detection needs and has broad application prospects.

[0018] The present invention uses innovative ARMS combined with homologous sequence specific base method to design RHD gene mutation site specific primers and probes, combined with Taqman probe technology, and uses real-time fluorescence PCR technology for the first time to identify the deletion of all exons of the RHD gene, and for the first time develops a method for detecting RHD positive and DEL type

[0019] The multiplex PCR primer probe combination and kit for RHD*DEL1 (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotypes in the Chinese population RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC). Compared with traditional methods, it has higher sensitivity, faster experimental speed, higher accuracy and wider applicability, and has broad application prospects and clinical reference value.

[0020] In addition, the present invention adopts an innovative simple and fast drying technology to perform vacuum centrifugation concentration on the primer-probe mixture at the bottom of a 96-well plate, so that it is dried at the bottom of the 96-well plate, which significantly enhances the stability of the primer-probe. Compared with the previous freeze-drying technology, it is simpler, faster, and less costly, and has a higher practical application value.

[0021] The technical solution of the present invention is as follows:

[0022] In the first aspect of the present invention, a multiplex PCR primer-probe combination for human red blood cell RHD genotyping detection is provided, wherein the combination comprises 19 pairs of specific primers and corresponding probes, and the 19 pairs of specific primers and corresponding probes are distributed in 8 reaction wells, and the nucleotide sequences of the primer pairs and corresponding probes contained in each reaction well are shown in the following table:

[0023]

[0024] The nucleotide sequences of the 19 pairs of specific primers and the corresponding probes, as well as the 19 amplification sites targeted by the 19 pairs of specific primers and the corresponding probes are specifically shown in the following table:

[0025]

[0026]

[0027]

[0028] Each of the eight reaction wells further comprises a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID Nos. 44 to 46, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample;

[0029] The nucleotide sequences of SEQ ID No.44 to 46 are shown in the following table:

[0030] SEQ ID No Sequence 5'→3' 44 GCATCTGGACATGCTTGCT 45 ACACACATGGAAGACCACAGA 46 CY55'-CTGTGTTAAAGCTCTGAATAATGGTA-3'BHQ2 .

[0031] The reporter group at the 5' end of the Taqman probe is FAM, HEX, ROX or CY5, and the quencher group at the 3' end is BHQ-1 or BHQ-2.

[0032] In the second aspect of the present invention, a kit containing the multiplex PCR primer-probe combination as described in the first aspect is provided. The kit contains 19 pairs of specific primers and corresponding probes for 19 amplification sites, and these primer pairs and probes are distributed in 8 reaction wells, and each well can simultaneously amplify 2 to 3 different sites. The kit can be used to detect RHD positive, DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotypes in the Chinese population RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC). Each reaction well of the kit also contains an internal standard CY5 for internal quality control to monitor false negative results caused by factors such as instrument failure, reagent factors, polymerase activity or inhibitors in the sample.

[0033] Preferably, the kit further comprises a PCR reaction mixture, Taq enzyme and an optical sealing film.

[0034] Preferably, the PCR reaction mixture comprises: 0.18 mM deoxynucleotide dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide serve as PCR reaction enhancers and stabilizers at the same time.

[0035] Preferably, the kit comprises a 96-well plate, which can detect the RHD genotyping of 12 samples simultaneously, and the PCR amplification primer sets and Taqman probes of the 12 samples are dried on the bottom of the 96-well plate.

[0036] The technical effects of the present invention are as follows: the present invention adopts ARMS combined with homologous sequence specific base method to design RHD gene variation site specific primers and probes, which have higher specificity and accuracy; one experiment can detect all high-frequency RHD gene variants in the Chinese population, including DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotypes RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC) in the Chinese population, and can also detect the normal RHD positive type (RHD*01). It can also detect the deletion of each exon in RHD variant samples; multiplex fluorescence PCR combined with Taqman probe technology can be used to perform qualitative typing detection on human red blood cell RHD gene. Compared with traditional methods, it has higher sensitivity, faster experimental speed, higher accuracy and wider applicability, and has broad application prospects and clinical reference value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1-1 to Figure 1-8 These are the amplification curves of wells 1 to 8, respectively.

[0038] Figure 2 This is the S1 sequencing map.

[0039] Figure 3 S2 is the sequencing map.

[0040] Figure 4 This is the S3 sequencing map.

[0041] Figure 5 S4 is the sequencing map.

[0042] Figure 6 This is the S5 sequencing map.

[0043] Figure 7 This is the S6 sequencing map.

[0044] Figure 8 This is the S7 sequencing map.

[0045] Fig. 9 This is the S8 sequencing map. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. The raw materials used in the present invention are all commercially available products unless otherwise specified.

[0047] Example 1

[0048] 1. Raw materials and equipment

[0049] 1.1 Preparation of PCR reaction mixture: 0.18 mM deoxyribonucleotide (dNTP), 1.8 mM magnesium chloride (MgCl2), 60.3 mM potassium chloride (KCl), 18.9 mM tris-HCl, 0.6% (v / v) glycerol, 5% (v / v) dimethyl sulfoxide (DMSO) and 2.5% (v / v) formamide. Prepare 50 mL of 6*PCR reaction mixture according to the above proportions and store it at -20°C for long-term storage or at 4°C for temporary use.

[0050] Taq enzyme: The Taq enzyme used in this kit is purchased from Acori Biotechnology. It is used for the synthesis of DNA chains in the 5' to 3' direction guided by specific paired primers with the target sequence as a template, as well as 5'→3' exonuclease activity, which can cut off the fluorescent probe bound to the target DNA during PCR amplification, causing the fluorescent molecules of the fluorescent probe to emit fluorescence.

[0051] 1.2 Preparation of reaction plate:

[0052] 1.2.1 Preparation of primer-probe mixture: 0.54 OD / mL primer and 1.05 μM probe to make a 6*primer-probe mixture.

[0053] 1.2.2 Click the board according to the table below:

[0054]

[0055]

[0056] The above table contains 19 pairs of specific primers and corresponding probes, their nucleotide sequences, and the 19 amplification sites targeted by the 19 pairs of specific primers and corresponding probes are shown in the following table:

[0057]

[0058]

[0059] Each of the eight reaction wells further comprises a pair of internal control primers and a corresponding probe, and the nucleotide sequences are shown in SEQ ID No. 44 to 46:

[0060] SEQ ID No Sequence 5'→3' 44 GCATCTGGACATGCTTGCT 45 ACACACATGGAAGACCACAGA 46 CY55'-CTGTGTTAAAGCTCTGAATAATGGTA-3'BHQ2

[0061] 1.2.3 Drying of reaction plate: Centrifuge the reaction plate to dryness according to the following procedure. Concentration centrifuge conditions: 30℃, vacuum degree below -100kpa, speed above 1400rpm, time 60 minutes. Then seal into light-proof tin foil bag. Package in light-proof tin foil bag and store at -20℃.

[0062] 1.3 Source of samples

[0063] 1) Blood sample collection

[0064] When collecting blood samples, blood collection tubes containing anticoagulants such as sodium citrate, ethylenediaminetetraacetic acid (EDTA) or heparin should be used. In order to ensure the accuracy and reliability of the experimental results, it is recommended to use fresh or frozen whole blood samples that have not been repeatedly frozen and thawed as experimental samples.

[0065] 2) Nucleic acid sample extraction

[0066] Nucleic acid can be extracted from samples containing nuclear cells such as whole blood or buffy coat by precipitation, column or magnetic bead methods to obtain sufficient nucleic acid of qualified quality for polymerase chain reaction.

[0067] 3) Quantification of nucleic acid samples

[0068] The extracted nucleic acid sample needs to be dissolved in sterile water or other appropriate solution (such as TE Buffer) as the dissolution medium, and the concentration should be controlled within the range of 10-40ng / μl.

[0069] 4) Nucleic acid sample quality standards

[0070] The A260 / A280 ratio of nucleic acid samples should be between 1.6 and 2.1.

[0071] 1.4 Required experimental equipment

[0072] Fluorescence quantitative PCR instrument, pipettes of different ranges, small desktop centrifuge, 96-well plate centrifuge.

[0073] 2. Genotyping Process

[0074] 2.1 Configuration of the reaction system: Each sample needs to undergo 8 independent real-time fluorescence PCR reactions at the same time, and one reaction plate can be used to test 12 samples. Prepare the mixed master solution according to the following table:

[0075] Table 1: PCR reaction system

[0076] Component name Add μL / well Prepare 9 wells μL PCR reaction solution 3 27 Taq enzyme 0.4 3.6 DNA to be tested 2 18 Sterilized water 12.6 113.4 Total volume 18 162

[0077] Take 18 μL of the prepared mixed solution and dispense it into each well of the reaction plate, affix an optical sealing film, centrifuge briefly, and place it in the fluorescent PCR instrument.

[0078] 2.2 PCR reaction procedure: as shown in Table 2:

[0079] Table 2: PCR reaction program

[0080]

[0081]

[0082] Please set the program according to the operating manual of each model of automatic cycle temperature controller. Set the fluorescence signal collection point at 65℃; set the fluorescence signal collection wavelength to FAM, HEX, ROX, CY5.

[0083] 2.3 Experimental results analysis:

[0084] If the CY5Ct values ​​of the internal standard gene in all wells of the test sample are less than 35 and the amplification curve is normal, the result interpretation can continue. Output the ABI 7500 original result file as an Excel file and import it into the interpretation software. The software can directly analyze the RHD genotype of the sample to be tested. The results are as follows:

[0085]

[0086] Conclusion: The entire experimental process only takes about 2 hours, the experimental results are accurate, and the RHD genotype of the experimental sample can be accurately determined by the kit of the present invention.

[0087] Figure 1-1 to Figure 1-8 They are the amplification curves of wells 1 to 8. If the amplification curve of the labeled probe is normal and Ct < 35, the labeled probe is judged to be a positive reaction; if there is no amplification curve rise or Ct ≥ 35, the labeled probe is judged to be a negative reaction.

[0088] Figure 2 This is the S1 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0089] Figure 3 This is the S2 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0090] Figure 4 This is the S3 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0091] Figure 5 This is the S4 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0092] Figure 6 This is the S5 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0093] Figure 7 This is the S6 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0094] Figure 8 This is the S7 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0095] Fig. 9 This is the S8 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0096] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent modifications or changes made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A multiplex PCR primer-probe combination for human red blood cell RHD genotyping detection, characterized in that: The combination comprises 19 pairs of specific primers and corresponding probes, and the 19 pairs of specific primers and corresponding probes are distributed in 8 reaction wells. The nucleotide sequences of the primer pairs and corresponding probes contained in each reaction well are shown in the following table: The nucleotide sequences of the 19 pairs of specific primers and the corresponding probes, as well as the 19 amplification sites targeted by the 19 pairs of specific primers and the corresponding probes are specifically shown in the following table: Each of the eight reaction wells further comprises a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID Nos. 44 to 46, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample; The nucleotide sequences of SEQ ID No.44-046 are as follows: 。 2. A kit comprising the multiplex PCR primer-probe combination for human red blood cell RHD genotyping detection as claimed in claim 1.

3. The kit according to claim 2, characterized in that The test kit also includes a PCR reaction mixture, Taq enzyme and an optical sealing film.

4. The kit according to claim 3, characterized in that The PCR reaction mixture comprises: 0.18 mM deoxynucleotide dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM tris-hydroxymethylaminomethane hydrochloride Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide are simultaneously used as PCR reaction enhancers and stabilizers.

5. The kit according to claim 2, characterized in that The kit comprises a 96-well plate for simultaneously detecting the RHD genotyping of 12 samples, and the PCR amplification primer sets and Taqman probes of the 12 samples are dried on the bottom of the 96-well plate.

Images