Molecular marker and application of molecular marker in detection of A4 character of wing vein corner of bee

Abstract

The invention relates to the technical field of bee breeding, in particular to a molecular marker and application of the molecular marker to detection of the character of beewing corner A4. The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, the 179th site of the sequence has polymorphism, and the polymorphism is C / T. According to the invention, the molecular marker related to the character of the wing vein corner A4 of the honeybees is obtained through research and screening, the identification of the character of the wing vein corner A4 of the honeybees can be realized by virtue of the polymorphism of the molecular marker, and the molecular marker provided by the invention can be used for breeding the honeybees with high flight ability and honey collecting ability and is beneficial to breeding high-quality honeybees.

Description

Technical Field

[0001] The invention relates to the technical field of bee breeding, and in particular to a molecular marker and application thereof in detecting the trait of bee wing vein angle A4. Background Art

[0002] Chinese honey bee ( Apis cerana , referred to as "Chinese honey bees") is a bee resource with important ecological and economic value. It has the advantages of strong adaptability, strong swarming, strong disease resistance, cold and heat resistance, and good at building honeycombs. The nectar collection efficiency of Chinese honey bees is affected by many factors, such as the structure of the bees' mouthparts, collection skills, nectar viscosity and corolla depth, as well as the flight time and distance of the bees. Improving the flight efficiency of bees can shorten the time it takes for the bees to reach their destination and improve the collection efficiency of the bees.

[0003] The flight efficiency of bees is affected by many factors. In addition to climate factors (such as temperature), nectar flow intensity, bee colony strength and other factors, the physiological structure of the bees themselves is also one of the key factors. The bee wing vein angle A4 trait is a specific wing vein structure on the bee's wings. It is a characteristic mark on the wings of insects. On the wings of insects, the veins (vein) support the surface of the wings. The size of the bee wing vein angle A4 is closely related to its flight efficiency. A smaller bee wing vein angle A4 trait may lead to a decrease in the flight efficiency of the bee. Therefore, the study of the bee wing vein angle A4 trait is of great value in bee breeding. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a molecular marker and its application in detecting the trait of honey bee wing vein angle A4.

[0005] In a first aspect, the present invention provides a molecular marker, which includes a nucleotide sequence as shown in SEQ ID NO.1, wherein the 179th position of the sequence has a polymorphism, and the polymorphism is C / T.

[0006] The nucleotide sequence shown in SEQ ID NO.1 is as follows: TTTCCCACCTCCCAATTTTCGATATTGCAATTTGCAAATTGCCGATTAATTAAGCCGATTAATTTTGGCTCGTTTAAATTGCACTTTATCGGTTAGCGTTAATTATCGACTAAAGTGGCATTAGAACGAAATACGTTTCGAGAAACGTA CATTAATTAATATTATCCTTTAAAGATACCATTAGGAATAATATATATCGAATTATCTCGTTTTATTAGAATACTTGTGGATTTTTTTCGAATCTCGCACATTAGTCTAAAGATAGAAGGAACCGCGTATCTCATCACCGGAAGAAGCAT In a second aspect, the present invention provides a KASP primer combination, wherein the KASP primer combination is used to amplify the aforementioned molecular marker; the KASP primer combination comprises: F1: CGTACATTAATTAATATTATCCTTTAAAGATAC, F2: CGTACATTAATTAATATTATCCTTTAAAGATAT, R:AAAACGAGATAATTCGATATATATTATTCCT.

[0007] The sequences of the primers above are from 5' to 3'.

[0008] Furthermore, F1 and F2 carry different fluorescent markers respectively, and the fluorescent markers include: one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0009] For example, GAAGGTGACCAAGTTCATGCT (FAM) was linked to the 5' end of F1, and GAAGGTCGGAGTCAACGGATT (HEX) was linked to the 5' end of F2.

[0010] In a third aspect, the present invention provides a kit, comprising the aforementioned molecular marker, or the aforementioned KASP primer combination.

[0011] In a fourth aspect, the present invention provides the use of the molecular marker, or the KASP primer combination, or the kit in detecting the wing vein angle A4 trait of honey bees.

[0012] The present invention further provides the use of the molecular marker, the KASP primer combination, or the kit in any of the following: i) Breeding transgenic bees with high flight efficiency; ii) flight efficiency improvement of honey bee germplasm; iii) Molecular marker-assisted breeding of honey bees.

[0013] Furthermore, the bee is an oriental honey bee, preferably a cerana cerana cerana.

[0014] In a fifth aspect, the present invention provides a method for detecting the flight efficiency of honey bees, comprising: detecting the polymorphism of the molecular markers of the honey bees to be tested, and determining the wing vein angle A4 trait of the honey bees to be tested based on the detection results.

[0015] Furthermore, the method includes: extracting genomic DNA of the bees to be tested, performing PCR amplification using the aforementioned KASP primer combination, and determining the flight efficiency of the bees to be tested according to the amplification result.

[0016] Further, based on a total system of 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×TaqBuffer 2~4μL, Taq enzyme 0.2~0.4μL, and the balance is water.

[0017] The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-60s, annealing at 62-65°C for 30-60s, extension at 70-74°C for 30-60s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 93-96°C for 30-60s, annealing at 56-60°C for 30-60s, extension at 70-74°C for 30-60s, cycle 25-35 times; Repair was extended at 70~74℃ for 10~15min.

[0018] Furthermore, a gene sequencing method was used to detect the nucleotide polymorphism at position 179 of the amplified product, and the detection result showed that bees with the TT genotype had a smaller wing vein angle A4 trait than bees with the CT genotype.

[0019] The present invention has the following beneficial effects: The present invention uses the physiological traits and genome data of multiple bees for association analysis, screens out multiple SNP sites related to the physiological traits, and uses one of the SNP sites related to the wing vein angle A4 trait of the bee as a molecular marker to develop corresponding detection primers. Through the polymorphism detection of the SNP site, the wing vein angle A4 trait of the bee can be reflected, and then it can be used to breed bees with larger wing vein angle A4 traits, thereby improving the flight efficiency of the bees, which is of great significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 These are the statistics and typing results of the wing vein angle A4 trait of 107 Chinese honey bee samples provided in Example 2 of the present invention.

[0022] Figure 2 This is the amplification result of the primer pair provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0025] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0026] Example 1 The present invention obtains a SNP site related to the wing vein angle A4 trait through honey bee trait and genome association analysis, which specifically includes the following process: 1. The present invention measures the wing vein angle A4 based on samples of 110 groups of Chinese honey bees. For the above-mentioned dissected worker bees, the genomic DNA of the worker bee chest tissue is extracted and then the library is constructed using the Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly broken into 350bp fragments, and the DNA library is obtained through end repair, ployA tailing, sequencing adapter, amplification, purification and other steps. The insert size of the library is quality checked using Agilent 2100, and the effective concentration of the library is accurately quantified using the qPCR method. The DNA library construction is completed after the quality meets the standard.

[0027] 2. Genome sequencing, alignment and SNPs identification: After the sample library was successfully constructed, the sample library was sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). During the sequencing process, low-quality reads were deleted to ensure the quality of the results (quality control standards: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads with low quality (phred quality <5) base content exceeding 50% of the length in the sequencing), and finally a single bee sample generated more than 4.5G high-quality paired-end clean reads, with Q20 and Q30 above 90% and 85%, respectively.

[0028] 3. The obtained high-quality paired-end clean reads were aligned to the reference genome using BWA 0.7.8 software Apis cerana (Genbank accession number: PRJNA738447). The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, and the average sequencing depth of the genome was above 20X.

[0029] 4. The Bayesian model in SAMTOOLS 1.15 software was used to detect group SNPs, and high-quality SNPs were screened according to the quality control standards (deleting SNPs with a sequencing error rate of >1% (Q20 quality control), deleting SNPs with a base number of <5 between adjacent SNP sites, and deleting SNPs with a coverage depth that exceeded the average depth by 1 / 3 to 5 times). ANNOVAR 20130520 software was used to annotate the detected SNPs, identify exon regions, intron regions, variable splicing sites, upstream and downstream regions of genes, and intergenic regions, and distinguish between synonymous mutation SNPs and non-synonymous mutation SNPs.

[0030] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted based on mrMLM 1.3 software to clarify the association between the wing vein angle A4 trait and SNPs loci. The SNPs quality control standard referred to MAF>5%, and the multi-locus random mixed linear model was selected as the model.

[0031] Table 1 Association between honey bee wing vein angle A4 phenotype and SNP

[0032] Through the above method, the present invention screened and obtained multiple SNP sites related to the physical and chemical traits of honey bees (wing vein angle A4). Experimental verification showed that one of them was closely related to the wing vein angle A4 trait of honey bees. The SNP site (Chr6_12953016) was located at position 12953016 of chromosome 6 of honey bees, and the polymorphism was C / T.

[0033] Example 2 The present invention uses 107 Chinese honey bee samples to carry out verification work, verifying the association between the SNP site and the honey bee wing vein angle A4 trait involved in Example 1, specifically sequencing these 107 Chinese honey bees, and using a microscopic measurement system to measure the wing vein angle A4 of the 107 honey bees, and obtaining the wing vein angle A4 data and SNP data of the 107 honey bees.

[0034] The present invention groups the genotypes of the SNP sites, and uses SPSS 16.0 software to perform a significant difference analysis on the wing vein angle A4 data of different genotype groups, so as to compare the differences of different genotypes in the wing vein angle A4.

[0035] The analysis results showed that 18 Chinese bees showed C / C genotype, 57 Chinese bees showed C / T genotype, and 32 Chinese bees showed T / T genotype. Figure 1 ), C / T genotype and T / T genotype showed significant difference ( P <0.05), it can be seen from the figure that the wing vein angle A4 of the C / T genotype Chinese bee is significantly greater than that of the T / T genotype Chinese bee. In addition, it can be seen from Table 2 that genotype 1 (C / T) shows a larger wing vein angle A4 trait than genotype 2 (T / T), and the P <0.05.

[0036] Table 2 Comparison of wing vein angle A4 in individuals with different genotypes at Chr6_12953016 locus in A. cerana

[0037] * express P <0.05, the difference is significant.

[0038] Example 3 The present invention further uses three Chinese honey bee samples to amplify the SNP site (Chr6_12953016) involved in Example 1, specifically including: 1. Primer pairs are as follows: Upstream primer: 5'-TTTCCCACCTCCCAATTTTC-3', Downstream primer: 5′-ATGCTTCTTCCGGTGATGAG-3′.

[0039] 2. The PCR system is as follows: Table 3 PCR system

[0040] Table 4 PCR program

[0041] 3. Test results The results are as follows Figure 2 As shown, it can be seen from the results that the electrophoresis bands of the amplified DNA fragments are clear and bright, without any mixed bands, indicating that the primers, amplification system and program have strong specificity.

[0042] Based on the amplified product, the polymorphism of the 179th nucleotide sequence can be detected by gene sequencing. If the detection result is C / T, it means that it has a larger wing vein angle A4 trait. Based on this method, the present invention can be used to select and breed bees with a larger wing vein angle A4 trait, for example, genotype detection is performed during breeding, and the bee colony with a C / T detection result at the Chr6_12953016 site is retained.

[0043] 4. The present invention further provides a KASP primer combination for detecting the SNP site, comprising F1: GAAGGTGACCAAGTTCATGCTcgtacattaattaatattatcctttaaagataC, F2:GAAGGTCGGAGTCAACGGATTcgtacattaattaatattatcctttaaagataT, R:aaaacgagataattcgatatatattattcct.

[0044] Among them, F1 carries FAM and F2 carries HEX. In actual situations, the KASP primer combination can be used to detect the sample to be tested, and at the same time, the detection can be carried out through the existing fluorescence equipment in the prior art, and the detection results of the FAM and HEX fluorescence channels can be used to determine whether the genotype of the sample to be tested is T / T (HEX fluorescence signal exceeds the threshold), C / T (both FAM and HEX fluorescence signals exceed the threshold) or C / C (FAM fluorescence signal exceeds the threshold).

[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker, characterized in that The molecular marker includes a nucleotide sequence as shown in SEQ ID NO.1, and the 179th position of the sequence has a polymorphism, and the polymorphism is C / T.

2. A KASP primer combination, characterized in that: The KASP primer combination includes: F1: CGTACATTAATTAATATTATCCTTTAAAGATAC, F2: CGTACATTAATTAATATTATCCTTTAAAGATAT, R:AAAACGAGATAATTCGATATATATTATTCCT.

3. A kit, characterized in that: It comprises the molecular marker according to claim 1, or the KASP primer combination according to claim 2.

4. Use of the molecular marker according to claim 1, or the KASP primer combination according to claim 2, or the kit according to claim 3 in detecting the wing vein angle A4 trait of honey bees.

5. Use of the molecular marker according to claim 1, or the KASP primer combination according to claim 2, or the kit according to claim 3 in any of the following: i) Breeding transgenic bees with high flight efficiency; ii) flight efficiency improvement of honey bee germplasm; iii) Molecular marker-assisted breeding of honey bees.

6. The use according to claim 4 or 5, characterized in that: The honey bee is an oriental honey bee, preferably a cerana ....

7. A method for detecting the flight efficiency of bees, characterized in that: include: Detect the polymorphism of the molecular marker as claimed in claim 1 of the bee to be tested, and determine the wing vein angle A4 trait of the bee to be tested based on the detection result.

8. The method according to claim 7, characterized in that include: The genomic DNA of the bee to be tested is extracted, and PCR amplification is performed using the KASP primer combination described in claim 2, and the flight efficiency of the bee to be tested is determined according to the amplification result.

9. The method according to claim 8, characterized in that Taking the total system as 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×Taq Buffer 2~4μL, Taq enzyme 0.2~0.4μL, and the balance is water. The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-60s, annealing at 62-65°C for 30-60s, extension at 70-74°C for 30-60s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 93-96°C for 30-60s, annealing at 56-60°C for 30-60s, extension at 70-74°C for 30-60s, cycle 25-35 times; Repair was extended at 70~74℃ for 10~15min.

10. The method according to claim 8 or 9, characterized in that: The gene sequencing method was used to detect the nucleotide polymorphism at position 179 of the amplified product, and the detection result showed that bees with TT genotype had a smaller wing vein angle A4 trait than bees with CT genotype.

Images