CNTN5 gene related to resistance character of host salmonella pullorum as well as SNP (Single Nucleotide Polymorphism) molecular marker and application of CNTN5 gene

Abstract

The invention relates to a CNTN5 gene related to the resistance character of host salmonella pullorum and an SNP molecular marker and application thereof, the CNTN5 gene and the SNP molecular marker thereof are used for breeding or auxiliary breeding of chicken varieties with high resistance to salmonella pullorum, the nucleotide sequence of the CNTN5 gene is as shown in SEQ ID NO.1, the SNP molecular marker of the CNTN5 gene is located in the intron region of the CNTN5 gene of the first chromosome of the chicken, and the SNP molecular marker of the CNTN5 gene is located in the intron region of the CNTN5 gene of the first chromosome of the chicken. At the site 185063016bp of the chromosome 1, the polymorphism is T or C; when the basic group at the SNP molecular marker of the CNTN5 gene is T, the chicken has high resistance to salmonella pullorum; when the basic group at the SNP molecular marker of the CNTN5 gene is C, the chicken has low resistance to salmonella pullorum. By utilizing the CNTN5 gene and the SNP molecular marker provided by the invention, a chicken variety with high resistance to salmonella pullorum can be quickly and effectively screened and bred.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a CNTN5 gene related to the resistance trait of host Salmonella pullorum and a SNP molecular marker and application thereof. Background Art

[0002] Pullorum is a bacterial disease caused by Salmonella pullorum, and is one of the animal diseases that my country prioritizes prevention and control and focuses on purification. As a specific pathogen of chickens, Salmonella pullorum often infects chicks under 20 days old, with a high morbidity and mortality rate, causing huge economic losses to the poultry industry. Salmonella pullorum is transmitted through two pathways: vertical and horizontal. At present, there are two main methods for prevention and control in actual production. One is to purify the breeder poultry according to the antibody test results of the whole blood plate agglutination test, so as to achieve the purpose of blocking vertical transmission. The other is to use antibiotics to prevent horizontal transmission, thereby controlling pullorum infection and morbidity. Although these two prevention and control methods effectively prevent the spread and spread of pullorum, they also have very serious problems. The first method has the problems of high purification cost and poor accuracy, while the second method has the problems of enhancing bacterial resistance and excessive use of antibiotics. In order to improve these problems, it is necessary to select and breed chicken varieties. The traditional breeding method mainly uses phenotypic information and pedigree information for hybridization and selection. For traits with low heritability and complex measurement, there are problems such as high measurement cost, long time and complex breeding process. Summary of the invention

[0003] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide a CNTN5 gene related to the resistance trait of host Salmonella pullorum and its SNP molecular marker and application.

[0004] The purpose of the present invention can be achieved by the following technical solutions:

[0005] One of the technical solutions of the present invention is to provide the use of the CNTN5 gene in breeding or auxiliary breeding of chicken breeds with high resistance to Salmonella pullorum, and the nucleotide sequence of the CNTN5 gene is shown in SEQ ID NO.1.

[0006] The second technical solution of the present invention is to provide the application of the CNTN5 gene SNP molecular marker in the selection or auxiliary selection of chicken breeds with high resistance to Salmonella pullorum. The CNTN5 gene SNP molecular marker is located at the 185063016bp site of chromosome 1 of the chicken, in the intron region of the CNTN5 gene, and the polymorphism of this site is T or C.

[0007] In some specific embodiments, the CNTN5 gene SNP molecular marker is used for breeding or auxiliary breeding of chickens with high resistance to Salmonella pullorum, and the breeding or auxiliary breeding criteria are: when the base at the CNTN5 gene SNP molecular marker is T, it corresponds to high resistance of chickens to Salmonella pullorum; when the base at the CNTN5 gene SNP molecular marker is C, it corresponds to low resistance of chickens to Salmonella pullorum.

[0008] The third technical solution of the present invention is to provide a method for screening chicken breeds with high / low resistance to Salmonella pullorum, characterized in that the CNTN5 gene SNP molecular marker as described in the second technical solution is used.

[0009] In some specific embodiments, the following steps are also included:

[0010] S1. Collect chicken tissue samples or blood samples and extract their genomic DNA;

[0011] S2. Detect the genotype at the SNP molecular marker of the CNTN5 gene.

[0012] In some specific embodiments, in step S2, the genomic DNA obtained in step S1 is amplified using primer pairs as shown in SEQ ID NOs. 2 to 3 to obtain a nucleotide fragment containing the CNTN5 gene, and the genotype at the SNP molecular marker of the CNTN5 gene is detected.

[0013] A fourth technical solution of the present invention is to provide a primer pair for amplifying the CNTN5 gene SNP molecular marker as described in the second technical solution above, and the nucleotide sequences thereof are shown in SEQ ID NOs. 2 to 3 respectively.

[0014] The fifth technical solution of the present invention is to provide a use of the primer pair as described in the fifth technical solution in the preparation of any of the following products:

[0015] Y1) Use in the preparation of a reagent for detecting or assisting in detecting the resistance of chickens to Salmonella pullorum;

[0016] Y2) Use in the preparation of a reagent for screening or identifying chicken breeds with high / low resistance to Salmonella pullorum;

[0017] Y3) is used in the preparation of early prediction reagents for chicken resistance to Salmonella pullorum.

[0018] The sixth technical solution of the present invention is to provide a reagent, including the primer pair as described in the fourth technical solution above.

[0019] The seventh technical solution of the present invention is to provide the use of the reagent described in the sixth technical solution in any of the following:

[0020] Y1) Application in molecular marker-assisted breeding of chickens for resistance to Salmonella pullorum;

[0021] Y2) in the application of chicken resistance to Salmonella pullorum breeding.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides a CNTN5 gene related to Salmonella pullorum resistance and its single nucleotide polymorphism site (SNP) as a molecular marker, which is obtained based on a whole genome association analysis method and located at a nucleotide single base mutation at 185063016bp of chromosome 1 of a chicken, and is also located in the intron region of the CNTN5 gene, where the base C is mutated to T, showing that the chicken is highly resistant to Salmonella pullorum. Using the CNTN5 gene SNP molecular marker provided by the present invention, chicken varieties with high resistance to Salmonella pullorum can be quickly and effectively screened and bred, providing candidate genes for improving chicken resistance to pullorum, and also providing technical support for the genetic analysis of other important economic traits of livestock and poultry. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The CNTN5 gene and its SNP molecular markers associated with resistance to Salmonella pullorum were screened for genome-wide association analysis. DETAILED DESCRIPTION

[0025] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0026] Embodiment 1:

[0027] 1) Chicken genomic DNA extraction and gene resequencing

[0028] A total of 149 chickens (3 days old) challenged with Salmonella pullorum were selected, and liver samples were collected from the dead individuals and the surviving individuals on the 13th day after the challenge for genomic DNA extraction and genome resequencing, respectively.

[0029] The liver tissue genome was extracted according to the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit. First, 30 mg of liver tissue was taken and the liver tissue was cut with scissors to better lyse the cells. Then, tissue DNA was extracted according to the procedure of the kit. After DNA extraction, quality inspection was performed, and the total amount of DNA was detected using the Quant-iT PicoGreen dsDNAAssay Kit; after all DNA samples were qualified by Picogreen fluorescence detection, an electrophoresis experiment based on 1% agarose gel was performed to detect the integrity of the DNA. If all DNA sample bands were clear, bright and complete, they were used for subsequent sequencing.

[0030] Genome resequencing was performed using the second-generation sequencing technology based on the Illumina NovaSeq sequencing platform. The preparation of the genome library was performed according to the standard Illumina TruSeq Nano DNALT experimental process. In this example, 149 libraries were constructed using the TruSeqTM DNASample Prep Kit, and paired-end (2×150bp) sequencing was performed on these libraries.

[0031] 2) Sequencing data filtering

[0032] The data from the sequencing machine is saved in a double-end FASTQ format, and the data quality is evaluated based on Q 20 and Q30 (the sequencing error rate is 0.1%). The data that pass the evaluation also needs to be filtered, and the raw library data measured is filtered using PLINK software.

[0033] There are three filtering criteria. The first is to remove contaminated adapters. This step is performed by selecting AdapterRemoval software, which is used to remove 3'-end adapter contamination. The second is quality filtering, which uses a sliding window method. The window size is set to 5bp and the step size is set to 1bp. Move forward one base at a time, and the average Q value of the window is calculated based on 5 bases. When the average Q value is less than or equal to 20, only the second to last base and the previous bases in the window are retained. Finally, the data with unqualified lengths must be filtered, that is, the double-end sequences with a sequence length of less than or equal to 50bp in the double-end are removed.

[0034] 3) Comparison statistics with reference genome

[0035] The sequencing sequences obtained by resequencing were aligned with the NCBI chicken reference genome GRCg6a using BWA (version 0.7.12-r1039). The alignment rate, sequencing depth, genome coverage and other information of each sample were obtained based on the position of Clean Reads on the reference genome. Samtools software was used to sort and index the alignment results.

[0036] Then, GenomeAnalysisTK v4.0 (GATK) software was used for downstream analysis: GATAMarkDuplicates was first used to remove sequence duplications caused by PCR, and then GATK Haplotypecaller was used to search for variants across the entire genome. Finally, GATK VariantFiltration was used to perform hard filtering of variant sites. In order to ensure the accuracy of SNP sites, SNP sites were filtered, and the filtering conditions were set as follows:

[0037] (1) Quality by Depth (QD) < 2, QD is the quality value corrected by depth, which is the quality value (Q value) divided by the depth before site filtering; because the Q value is positively correlated with the depth, QD can eliminate the influence of sequencing depth and determine the true quality value of the site;

[0038] (2) Fisher Strand (FS)>60, FS is determined by Fisher's exact test to determine whether the current variant has a strand-specific tendency;

[0039] (3) RMS Mapping Quality (MQ) < 40, MQ is the root mean square of the alignment quality of all aligned reads, which is used to determine the average alignment quality of a site;

[0040] (4) Strand Odds Ratio (SOR)>3. SOR uses OR value to judge the degree of strand specificity of the variant site. The larger the value, the higher the degree of strand specificity.

[0041] (5) Mapping Quality Rank Sum Test (MQRankSum) < -12.5. MQRankSum is the Mann-Whitney rank sum test result of the alignment quality between different bases at the heterozygous site. The credibility of the site is evaluated by the difference in the alignment quality between the reference base (ref) and the mutant base (alt).

[0042] (6) Read Pos Rank Sum Test (ReadPosRankSum) <-8, which is still a rank sum test for heterozygous sites to see whether different bases tend to appear at specific positions in the sequence (for example, close to the beginning or end of the sequence).

[0043] The filtering criteria for InDel sites include: FS>200; QD<2; SOR>10; MQRankSum<-12.5; ReadPosRankSum<-8.

[0044] Finally, Vcftools software was used to filter the SNPs in the mutation according to the population variation distribution. The filtering thresholds included:

[0045] (1) The number of minor alleles is greater than 3;

[0046] (2) SNP missing rate exceeds 5%;

[0047] (3) SNP quality greater than 30;

[0048] (4) minimum sequencing depth 5;

[0049] (5) the minimum allele frequency is less than 0.05;

[0050] After quality control, 3,102,334 SNP variation sites were finally obtained for genome-wide association analysis.

[0051] 4) Genome-wide association analysis:

[0052] The filtered SNPs were used for genome-wide association analysis using rMVP software, general linear model (GLM), mixed linear model (MLM), and fixed and random model circular probability unified method (FarmCPU) to identify key candidate genes and loci affecting chicken resistance to Salmonella pullorum.

[0053] Finally, 195 significant SNP loci associated with host resistance to Salmonella pullorum were screened and identified, with a significant marker level of P < 1.38 × 10 -6 .

[0054] The gene position of the significant site was located, and the g.185063016T>C variant site was located in the CNTN5 gene (the nucleotide sequence of which is shown in SEQ ID NO.1), and its P value was 7.27×10 -8 , the most significant and located in the gene region, such as Figure 1 Correspondingly, after being challenged with Salmonella pullorum, the base at 185063016bp of chromosome 1 in the genome of dead chickens was C; while the base at 185063016bp of chromosome 1 in the genome of surviving chickens was T.

[0055] Therefore, the CNTN5 genotype can be detected to further select or breed chickens to improve the host's resistance to Salmonella pullorum.

[0056] SEQ ID NO.1 (CNTN5 gene):

[0057] ATGAGGTTCAACACGGCAAAGTGCAGGGTTTTGCACTTGGGCCAGAGGAACCCCAGGCATCTATACAGACTGGAAGGAGCAGTCCTTGAGAGCAGCTCT GCAGAGAAGGACCTGCGGGTCCTGATGGATGACAAACTTAACATGAGCCAGCAGTGTGTTCTTGCAGCTCGGAAAGCAAATGGTATCCCAGGCTGCATCATGAGAGGGGTGGACAGCAGGGACAGGGAGGTGATTGT CCCTCTCTACTCTGCTCTTGTGAGGCCCCATCTGGAGTACTGTGTCCAGGTATGGAGCCCCCAGTACAAGAAAGACAGAGAGCTATTTGAGAGGGTCCAGAGAAGGGCCACAAAGATGATCAGGGGGCTGGAGCACCT CCCCTACGAGGACAGGCTGAGGGAGCTGGGCTTGTTCGACCTGGAGAAGAGAAGGCTGCGGGGTGACCTCATTGCAGCCTTTCAGTACCTGAAGAGAGCCTATGAACAGGAAGGGAGTAAACTTTTTGAAAGGGTAG ATAACAGCAGGACAAGGGGGAATGGTTTTAAGTTGAAAGAGGGAAGATTTAGGTTGGATGTTAGGGGGAAGTTCTTTACTATGAGTGTGGTGAGGTGCTGGAACGGGCTGCCCAGAGAGGTTGTGGATGCCCCGTCCC T GGAGGTTTTCAAGGCCAGGTTGGATGAGGCCCCGGGCAACCTGGTCTACTAA

[0058] Among them, the double-strike base is the CNTN5 gene SNP molecular marker site related to the host's resistance to Salmonella pullorum. When the base is T, it corresponds to the chicken's high resistance to Salmonella pullorum, that is, the surviving individual; when the base is C, it corresponds to the chicken's low resistance to Salmonella pullorum, that is, the dead individual.

[0059] This example also provides a pair of primers for amplifying the CNTN5 gene, which are shown in SEQ ID NOs. 2 to 3 respectively:

[0060] SEQ ID NO.2 (upstream primer): 5'-ATGAGGTTCAACACGGCAAA-3';

[0061] SEQ ID NO. 3 (downstream primer): 5'-TTAGTAGACCAGGTTGCCCG-3'.

[0062] Example 2: Application of CNTN5 gene SNP molecular marker in identifying chicken resistance to Salmonella pullorum

[0063] Another 100 chickens (3 days old) challenged with Salmonella pullorum were selected, and liver samples from the dead individuals and the surviving individuals on the 13th day after the challenge were collected for genomic DNA extraction.

[0064] PCR amplification was performed using the primer pairs shown in SEQ ID NOs. 2-3 to obtain the CNTN5 gene fragment, and genotyping of the CNTN5 gene fragment was performed.

[0065] PCR amplification reaction system:

[0066]

[0067] PCR amplification reaction conditions:

[0068]

[0069] The results showed that after being challenged with Salmonella pullorum, the base at the SNP site of the CNTN5 gene in the genome of the deceased individuals was C; while the base at the SNP site of the CNTN5 gene in the genome of the surviving individuals was T.

[0070] The results shown above prove that the molecular markers and primer combinations provided by the present invention have accurate detection results and can effectively distinguish different genotypes.

[0071] In summary, the present invention has discovered for the first time a site associated with the high or low resistance of the host Salmonella pullorum in the CNTN5 gene, providing an effective candidate gene for breeding chicken strains with excellent traits. At the same time, the present invention uses a marker trait association analysis method to identify that a SNP (g.185063016T>C) in the CNTN5 gene is significantly associated with the host Salmonella pullorum resistance. This site can be applied to the association analysis related to the host Salmonella pullorum resistance, and provides a new genetic marker resource for the molecular marker-assisted selection of the host Salmonella pullorum resistance. In short, the present invention uses a method based on whole genome association analysis to screen and identify genes related to the host Salmonella pullorum resistance. For the identified candidate genes, the present invention further uses a candidate gene method strategy to determine whether there is a site associated with the host Salmonella pullorum resistance trait in the studied gene, thereby further verifying the relationship between the candidate gene and the host Salmonella pullorum resistance performance. In addition, through the candidate gene method, the SNP sites associated with the host Salmonella pullorum resistance trait identified can be used as molecular markers for the selection of excellent traits in chickens, which is helpful for the genetic progress of the host Salmonella pullorum resistance performance. The present invention has the characteristics of simple operation, short time consumption, high accuracy of selected markers, etc., and also provides technical support for the genetic analysis of other important economic traits of livestock and poultry.

[0072] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. The use of CNTN5 gene in breeding or assisting breeding of chicken breeds with high resistance to Salmonella pullorum, characterized in that: The nucleotide sequence of the CNTN5 gene is shown in SEQ ID NO.

1.

2. Application of CNTN5 gene SNP molecular marker in breeding or auxiliary breeding of chicken breeds with high resistance to Salmonella pullorum, characterized in that: The CNTN5 gene SNP molecular marker is located at the 185063016bp site of chromosome 1 of the chicken, in the intron region of the CNTN5 gene, and the polymorphism of the site is T or C.

3. The use according to claim 2, characterized in that: The CNTN5 gene SNP molecular marker is used for breeding or auxiliary breeding of chickens with high resistance to Salmonella pullorum, and the breeding or auxiliary breeding standard is: when the base at the CNTN5 gene SNP molecular marker is T, it corresponds to the high resistance of chickens to Salmonella pullorum; when the base at the CNTN5 gene SNP molecular marker is C, it corresponds to the low resistance of chickens to Salmonella pullorum.

4. A method for screening chicken breeds with high / low resistance to Salmonella pullorum, characterized in that: The CNTN5 gene SNP molecular marker as claimed in claim 2 is used.

5. The method according to claim 4, characterized in that The following steps are also included: S1. Collect chicken tissue samples or blood samples and extract their genomic DNA; S2. Detect the genotype at the SNP molecular marker of the CNTN5 gene.

6. The method according to claim 5, characterized in that In step S2, the genomic DNA obtained in step S1 is amplified by the primer pair shown in SEQ ID NO. 2-3 to obtain a nucleotide fragment containing the CNTN5 gene, and the genotype at the SNP molecular marker of the CNTN5 gene is detected.

7. A primer pair for amplifying the CNTN5 gene SNP molecular marker as claimed in claim 2, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs. 2 to 3 respectively.

8. Use of the primer pair according to claim 7 in the preparation of any of the following products: Y1) Use in the preparation of a reagent for detecting or assisting in detecting high / low resistance of chickens to Salmonella pullorum; Y2) Use in the preparation of a reagent for screening or identifying chicken breeds with high / low resistance to Salmonella pullorum; Y3) Use in the preparation of early prediction reagents for chicken resistance to Salmonella pullorum.

9. A reagent, characterized in that Comprising the primer pair as claimed in claim 7.

10. Use of the reagent according to claim 9 in any of the following: Y1) Application in molecular marker-assisted breeding of chickens for resistance to Salmonella pullorum; Y2) in the application of chicken resistance to Salmonella pullorum breeding.

Images