Molecular marker for identifying genetic sex of bullfrog, identification primer and application method of molecular marker

Abstract

The invention belongs to the technical field of biology, and particularly relates to a molecular marker for identifying bullfrog genetic sex, an identification primer and an application method of the molecular marker. The molecular marker capable of accurately identifying the gender of tadpoles is successfully developed, the gender of adult frogs can be accurately identified, and a key technical foundation is laid for a unisexual group breeding strategy in production. According to the invention, the materials of bullfrogs and tadpoles are collected, differential fragments of male and female genomes are determined by genome re-sequencing, a pair of primers is designed, and the genetic sex of adult frogs and tadpoles can be accurately identified by a PCR (Polymerase Chain Reaction) method. The accuracy of the gender molecular marker for identifying the genetic sex of bullfrogs can reach 100%.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker for identifying the genetic sex of a bullfrog, an identification primer and an application method thereof. Background Art

[0002] As a high-quality aquaculture species, bullfrog (Rana catesbeiana) has been widely cultivated and developed around the world in recent years, especially in the aquaculture industry in China, the United States and some Asian countries. Bullfrogs have strong adaptability and rapid growth rate, so they can be successfully cultivated under various climatic conditions. Bullfrogs are favored by the market mainly for their delicious meat, rich protein and high nutritional value. They are rich in amino acids, vitamins and minerals and are widely used in the mid-to-high-end catering industry, especially in the Asian and European and American markets. The economic benefits and industry potential of bullfrog farming on a global scale cannot be ignored. With the continuous growth of market demand and the continuous advancement of technology, bullfrog farming is expected to continue to be an important part of the aquaculture industry in the future, which is of great significance to improving the global food supply chain, promoting agricultural modernization and promoting local economic development. Bullfrog farming not only has a high market demand, but also has strong economic benefits, becoming an important way for many farmers and enterprises to increase their income.

[0003] At present, bullfrog breeding has some new development prospects. Male bullfrogs have fast individual growth rate in the early stage, can better adapt to market demand, and have a higher meat yield than female bullfrogs, which is more popular in the market. Cultivating all-male populations is conducive to improving economic benefits, but there are no reports on the research on the sex determination mechanism, sex differentiation and production of all-male populations of bullfrogs. Although the sex of bullfrogs can be determined by external morphological observation in production, there is no way to determine the genetic sex of bullfrogs (bullfrogs are easily induced by environmental factors such as temperature in the early stage of development), and the sex of tadpoles cannot be identified by external morphological observation. In order to obtain the purpose of all-male bullfrog breeding, bullfrogs need to be treated with estrogen induction during design, and then pseudo-female bullfrogs (XY, ♀) with male genetic sex are selected as parents through genetic sex identification, and mated with male bullfrogs (XY, ♂) with male genetic sex, and super male bullfrogs (YY, ♂) are selected from the offspring, and then mated with female bullfrogs (XX, ♀) with female genetic sex to obtain all-male offspring. This process lacks the use of molecular markers to identify the genetic sex of bullfrogs.

[0004] Therefore, the practical value of studying the sex determination and sexual differentiation of bullfrogs is to produce monosex populations. Monosex breeding has many advantages, such as faster growth rate, better meat quality, more uniform individual size, and higher reproductive value.

[0005] Prior art CN111593128A discloses a molecular marker for identifying the genetic sex of Northeast Forest Rana. Its main feature is to extract the genome of the toe tissue of Northeast Forest Rana, use the extracted genomic DNA as a template, and perform PCR amplification reaction with a primer pair containing the sequences shown in SEQ ID NO:1 and SEQ ID NO:2. The PCR amplification product is detected by electrophoresis on a 14% polyacrylamide gel, and the result shows that the individual with the corresponding band of the nucleotide sequence (222bp) shown in SEQ ID NO:3 is a genetic male Northeast Forest Rana, and the individual lacking the corresponding band of the nucleotide sequence shown in SEQ ID NO:3 is a genetic female Northeast Forest Rana.

[0006] Prior art CN110964798A discloses extracting the genome of the toe tissue of the Northeast Forest Rana, using the extracted genomic DNA as a template and a primer pair containing the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 to perform a PCR amplification reaction. The PCR amplification product is detected by electrophoresis on a 14% polyacrylamide gel. The individual with the corresponding band of the nucleotide sequence (261bp) shown in SEQ ID NO:3 in the amplification result is a genetic male Northeast Forest Rana, and the individual lacking the corresponding band of the nucleotide sequence shown in SEQ ID NO:3 is a genetic female Northeast Forest Rana. The invention can identify pseudo-male individuals, that is, individuals that are physiologically male but genetically female. Pseudo-male individuals are used to mate with female individuals, and the proportion of physiological females in the offspring produced is as high as more than 90%. It can achieve gender control of the Northeast Forest Rana breeding population and improve the economic benefits of Northeast Forest Rana breeding.

[0007] However, the above-mentioned prior arts do not involve sex identification of bullfrogs, while the successful development of the marker of the present invention can accurately identify the sex of tadpoles and can accurately identify the sex of adult frogs, laying a key technical foundation for the single-sex population breeding strategy in production. Summary of the invention

[0008] The present invention aims to overcome the deficiencies in the prior art. The present invention first provides a molecular marker for identifying the genetic sex of bullfrogs, wherein the molecular marker comprises SEQ ID NO: 2 and / or SEQ ID NO: 4.

[0009] In certain embodiments, the molecular marker consists of SEQ ID NO:2 and / or SEQ ID NO:4.

[0010] In certain embodiments, the molecular marker is SEQ ID NO:1 and / or SEQ ID NO:3.

[0011] The present invention also provides the use of the molecular marker for identifying the genetic sex of bullfrogs as described above in the preparation of a product for identifying the genetic sex of bullfrogs.

[0012] In certain embodiments, the product is a primer, a probe, or a kit.

[0013] In certain embodiments, the primers comprise SEQ ID NO:4 and SEQ ID NO:5.

[0014] The present invention also provides a primer set for identifying the molecular marker for identifying the genetic sex of bullfrog as described above, wherein the primers include SEQ ID NO:4 and SEQ ID NO:5.

[0015] The present invention also provides a kit for identifying the molecular markers for identifying the genetic sex of bullfrogs as described above, wherein the kit comprises the primer set as described above.

[0016] The present invention also provides an application of the primer set or the kit in identifying the genetic sex of bullfrogs.

[0017] The present invention also provides a method for identifying the genetic sex of bullfrogs, the method comprising the step of performing PCR amplification using the above primer set or the above kit.

[0018] Compared with the prior art, the present invention has at least the following beneficial effects:

[0019] The present invention has successfully developed a molecular marker that can accurately identify the sex of tadpoles and the sex of adult frogs, laying a key technical foundation for the single-sex population breeding strategy in production. The present invention collects materials of bullfrogs and tadpoles, uses genome resequencing to determine the difference fragments of the male and female genomes, and designs a pair of primers that can accurately identify the genetic sex of adult frogs and tadpoles through the PCR method. The accuracy of the sex molecular marker of the present invention in identifying the genetic sex of bullfrogs can reach 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a picture of a female sexually mature bullfrog;

[0021] Figure 2 This is a picture of a male sexually mature bullfrog;

[0022] Figure 3 This is the HE staining picture of tadpole ovary;

[0023] Figure 4 This is the HE staining picture of tadpole testis;

[0024] Figure 5 Molecularly labeled gel maps for bullfrog and tadpole. DETAILED DESCRIPTION

[0025] The embodiments of the present invention are described in detail below. It should be noted that the embodiments are descriptive rather than restrictive and cannot be used to limit the protection scope of the present invention.

[0026] The raw materials used in the present invention, unless otherwise specified, are conventional commercially available products; the methods used in the present invention, unless otherwise specified, are conventional methods in the art.

[0027] The partial sequence of the male bullfrog genome is:

[0028] AGATTGACTGGATGTGCTATAGATGTCTTGTATACAATGATGAACCTCTTT

[0029] AATTGGAGTACAGATGGTAGAATACAGCCAACGCATTTTGGGGGACAAG

[0030] AGACTCCCCTTCTTTAGGGCTGCTGTTTGAATATGGATCCCGTTAGGGT

[0031] CTGTTCTGGGACCTGAGAATCAGGTCTGGGAATGTCACAGACAGACAGGT

[0032] CCCAAACAGACCCTAACAGGATCCATATTCAAACAGCAGCCCTGAGGAA

[0033] GGGAAGCCCCTTGTCCCCTGAAACGCATTGGATGTATTCTACCATCTCTA

[0034] CTCCAAATAAAACAGTTTATTTCACAAACTACTGCATTTCGGGCTCTCCTT

[0035] TACATTCACCTGCTTTGATCAATATGGGAGCAACCGCCTGGCCACACCCT

[0036] CAGGTAGCAGCCCATACCTGTAACAGGGTTTACCATCTTCACAAAACAGT

[0037] CAGGCATCAAACTCTGTAAAAAACCTTTCTTACCTTGCCTATTGGAACTCCTACCTACAACCA(SEQID No.1);

[0038] The male bullfrog genome-specific sequence is:

[0039] TTTCTTACCTTGCCTATTGGAACTCCTACCTACAACCA (SEQ ID No. 2); The partial sequence of the female bullfrog genome is:

[0040] AGATTGACTGGATGTGCTATAGATGTCTTGTATACAATGATGAACCTCTTT

[0041] AATTGGAGTACAGATGGTAGAATACAGCCAACGCATTTTGGGGGACAAG

[0042] AGACTCCCCTTCTTTAGGGCTGCTGTTTGAATATGGATCCCGTTAGGGT

[0043] CTGTTCTGGGACCTGAGAATCAGGTCTGGGAATGTCACAGACAGACAGGT

[0044] CCCAAACAGACCCTAACAGGATCCATATTCAAACAGCAGCCCTGAGGAA

[0045] GGGAAGCCCCTTGTCCCCTGAAACGCATTGGATGTATTCTACCATCTCTA

[0046] CTCCAAATAAAACAGTTTATTTCACAAACTACTGCATTTCGGGCTCTCCTT

[0047] TACATTCACCTGCTTTGATCAATATGGGAGCAACCGCCTGGCCACACCCT

[0048] CAGGTAGCAGCCCATACCTGTAACAGGGTTTACCATCTTCACAAAACAGTCAGGCATCAAACTCTGTAAAAAAACCTTTCTTTCAACC (SEQ ID No. 3); The female bullfrog genome-specific sequence is:

[0049] TTTCTTTCAACC (SEQ ID No. 4);

[0050] Example 1

[0051] The present invention collects materials of bullfrogs and tadpoles, uses genome resequencing to determine the difference fragments of male and female genomes, and designs a pair of primers, which can accurately identify the genetic sex of adult frogs and tadpoles through the PCR method.

[0052] The specific information of the patent of this invention is as follows:

[0053] The partial sequence of the male bullfrog genome is shown in SEQ ID No.1.

[0054] The partial sequence of the female bullfrog genome is shown in SEQ ID No.2.

[0055] Based on the above male and female different sequence parts, a pair of primers were designed, and the sequence information is as follows:

[0056] NW-510-F: AGATTGACTGGATGTGCTATAG (SEQ ID No. 5);

[0057] NW-510-R:TAGGTAGGAGTTCCAATAGGC (SEQ ID No. 6);

[0058] Then the PCR reaction was carried out using the above primers.

[0059] We obtained 60 physiological female bullfrogs and 60 physiological male bullfrogs by dissecting bullfrogs and examining their gonads.

[0060] Observation criteria such as Figure 1 and Figure 2 As shown;

[0061] In addition, the tadpoles were tailed (to collect DNA) and embedded in paraffin sections. The testes and ovaries were observed by HE staining to determine the physiological sex of the tadpoles. Thus, 20 female tadpoles and 13 female tadpoles were obtained. The HE staining section observation standard is as follows Figure 3 and Figure 4 As shown;

[0062] The bullfrog samples whose sexes had been identified were collected separately, and the bullfrog DNA was extracted using a DNA extraction kit to prepare PCR templates. The specific reaction system was: 2×MasterMix (Nanjing Novogene Biotechnology Co., Ltd.) 10.0 μL, upstream primer (NW-510-F) 1.0 μL, downstream primer (NW-510-R) 1.0 μL, DNA template 2.0 μL, ddH2O 6.0 μL, a total of 20.0 μL; the reaction procedure was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 70°C for 30 s, extension at 72°C for 80 s, 30 cycles; extension at 72°C for 7 min, and storage at 4°C.

[0063] After obtaining the PCR product, agarose gel electrophoresis was performed. The results are as follows Figure 5 As shown:

[0064] We collected data from all 120 frogs and 30 tadpoles, and the data are shown in Table 1 below:

[0065] Table 1 Test results

[0066]

[0067] In summary, the accuracy of using the sex molecular marker of the present invention to identify the genetic sex of bullfrogs can reach 100%, and it has great application prospects in the industry.

[0068] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker for identifying the genetic sex of bullfrog, characterized in that: The molecular marker comprises SEQ ID NO:2 and / or SEQ ID NO:

4.

2. The molecular marker according to claim 1, characterized in that The molecular marker consists of SEQ ID NO: 2 and / or SEQ ID NO:

4.

3. The molecular marker according to claim 2, characterized in that The molecular marker is SEQ ID NO:1 and / or SEQ ID NO:

3.

4. Use of the molecular marker for identifying the genetic sex of bullfrog as claimed in claim 1 in preparing a product for identifying the genetic sex of bullfrog.

5. The use according to claim 4, characterized in that: The product is a primer, a probe or a kit.

6. The use according to claim 5, characterized in that: The primers include SEQ ID NO:4 and SEQ ID NO:

5.

7. A primer set for identifying the molecular marker for identifying the genetic sex of bullfrog according to claim 1, characterized in that: The primers include SEQ ID NO:4 and SEQ ID NO:

5.

8. A kit for identifying the molecular markers for identifying the genetic sex of bullfrogs as claimed in claim 1, characterized in that: The kit comprises the primer set according to claim 7.

9. Use of the primer set according to claim 7 or the kit according to claim 8 in identifying the genetic sex of bullfrog.

10. A method for identifying the genetic sex of a bullfrog, characterized in that: The method comprises the step of performing PCR amplification using the primer set according to claim 7 or the kit according to claim 8.

Images