Primer for early diagnosis of sarcoptic mite infection and application thereof

Abstract

The invention discloses a primer for early diagnosis of sarcoptic mite infection and application thereof. At present, scabies detection methods have many defects, but according to the method, a part of sarcoptic mite COX1 gene region is selected as a target amplification section, positive plasmids are constructed, multiple groups of primer probes are designed, an optimal primer combination and a fluorescent probe are screened out through experiments, an amplification system and reaction conditions are determined, recombinase polymerase amplification reacts at 42 DEG C for 20 min, and the target amplification section is obtained. And detecting the fluorescence change by using a GS8 fluorescence isothermal amplification instrument. The method is high in sensitivity, capable of detecting sarcoptic mite DNA with the concentration as low as 30 copies / mu L, negative and free of peak, has the advantages of high sensitivity, high specificity, rapidness, high efficiency, simplicity and convenience in operation and the like, can accurately detect sarcoptic mite infection, provides a reliable basis for clinical diagnosis and overcomes the defects in the prior art.

Description

Background Art

[0002] Scabies is a skin disease caused by scabies mites, which is highly contagious and has a high incidence rate. At present, the diagnosis of scabies mainly relies on clinical symptom observation and laboratory testing methods (such as skin scraping examination, dermoscopy and skin biopsy, etc.).

[0003] The clinical symptom observation method is highly subjective, and different doctors may have different interpretations of the symptoms. For patients with atypical symptoms, it is difficult to make an accurate diagnosis based on clinical symptoms alone, which may lead to misdiagnosis. It is also impossible to directly determine whether it is a scabies infection and can only be speculated based on the symptoms, which means that the pathogen cannot be determined.

[0004] Laboratory testing methods also have many disadvantages. Most patients with common scabies have a small number of scabies mites. For example, during the skin scraping examination, if the scraping site is not accurate, a false negative result may occur. At the same time, although the skin scraping examination is less traumatic, it will still cause some discomfort to the patient, especially for sensitive groups such as children. Moreover, it requires professional personnel to operate, and the collection and processing of samples are required to be high, otherwise it will affect the accuracy of the test results. During the dermatoscopy examination, the interpretation of the results is highly dependent on the experience and professional level of the dermatologists engaged in dermatoscopy, and the diagnosis of different doctors may be different. At the same time, special dermatoscopy equipment is required, which is not equipped in all medical institutions, limiting its wide application. In the case of extremely small numbers of scabies mites or atypical lesions, dermatoscopy may not be able to make an accurate diagnosis. Skin biopsy is also an invasive examination, which will bring great pain and risks to patients and may cause complications such as bleeding and infection. At the same time, the operation is complicated and requires professional pathologists to diagnose, and the cost is relatively high. It takes a long time from sample collection to results, which is not conducive to rapid diagnosis and treatment.

[0005] Scabies is recognized by the World Health Organization as an easily neglected skin disease. The global blueprint plans to basically control it by 2030. At present, the incidence of scabies is gradually increasing, and the global burden is increasing. Scabies often causes regional outbreaks, seriously affecting the health of patients, especially the elderly. Therefore, timely and early diagnosis is of great significance for the prevention and control of scabies. For the detection of scabies infection, a highly sensitive, highly specific, rapid, simple and reliable detection method is urgently needed to address the deficiencies of the above-mentioned existing technologies. Summary of the invention

[0006] The purpose of the present invention is to provide a primer capable of early diagnosing scabies infection and use thereof, so as to solve the problems existing in the prior art.

[0007] The first aspect of the present invention provides a primer combination for detecting scabies infection.

[0008] Furthermore, the primer combination includes an upstream primer F5 and a downstream primer R4.

[0009] Furthermore, the sequence of the upstream primer F5 is shown as SEQ ID NO.1, and the sequence of the downstream primer R4 is shown as SEQ ID NO.2. The sequence of SEQ ID NO.1 is 5'-CTTCTATAATAAAAAGACAATTTTGAACAATA-3', and the sequence of SEQ ID NO.2 is 5'-ATTTCAAGTTGAGAAATTATCAGGATAATCAG-3'.

[0010] Furthermore, the primer combination further includes a fluorescent probe S007SsPB1, and the sequence of the fluorescent probe S007SsPB1 is SEQ ID NO.3:

[0011] 5'-TAACTTTTTTYCCTCAACATTTTTTAGGTTTAAGAGGTATACCT-3'

[0012] The modified fluorescent probe sequence of SEQ ID NO.3 is: 5'-TAACTTTTTTYCCTCAACATTTTTTAGG(FAM-dT)(THF)(BHQ1-dT)AAGAG GTATACCT-C3-Spacer-3'

[0013] A second aspect of the present invention provides a kit for detecting scabies infection.

[0014] Furthermore, the kit comprises the above primer combination.

[0015] Furthermore, the kit also contains reagents for nucleic acid amplification reaction, including but not limited to tris-acetate buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, creatine phosphate, creatine kinase, Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease III and dNTP.

[0016] Furthermore, the final concentration of the tris(hydroxymethyl)aminomethane-acetic acid buffer is 30 mM, the final concentration of the potassium acetate is 100 mM, the final concentration of the magnesium acetate is 14 mM, the final concentration of the dithiothreitol is 3 mM, the final concentration of the polyethylene glycol is 5%, the final concentration of ATP is 2 mM, the final concentration of the creatine phosphate is 20 mM, the final concentration of the creatine kinase is 100 ng / μL, the final concentration of the Escherichia coli SSB protein is 600 ng / μL, the final concentration of the bacteriophage uvsX protein is 150 ng / μL, the final concentration of the bacteriophage uvsY protein is 25 ng / μL, the final concentration of the klenow polymerase large fragment is 80 ng / μL, the final concentration of the nuclease exonuclease III is 50 ng / μL, and the final concentration of the dNTP is 450 μM.

[0017] Furthermore, the kit further comprises a positive plasmid LDJ.45, wherein the positive plasmid LDJ.45 comprises a target region sequence of scabies cytochrome oxidase subunit I gene (COX1 gene), wherein the target region sequence is SEQ ID NO.4:

[0018] TTTTGATTTTTTGGACACCCAGAAGTTTACATTCTTATTATTCCTGGATTTGG

[0019] GATAATTTCTCATATTATTACTTATTCAAGTAATAAAAGAGAACCATTTGGAT

[0020] CTTTAGGTATAATTTATGCTATGATTTCTATTGCAACTTTAGGTTTTATTGTAT

[0021] GAGCTCATCATATATTTACTGTTGGATTAGATGTTGATACTCGAGCTTATTTTA

[0022] CTTCAGCTACTATAATTATCGCTGTCCCTACAGGAGTAAAAATTTTTAGTTGA

[0023] TTATCTACAATATTAGGAGGAAAATTAGATTTTAACCCCTCTATGTATTGAGC

[0024] AATTGGCTTTGTGTTTCTATTTAGAATGGGAGGTCTTACGGGTATTATTTTAT

[0025] CTAACTCTTCTTTAGATGTTAGATTACACGATACTTACTATGTTGTAGCTCAC

[0026] TTTCATTATGTTTTATCTATAGGTGCTGTTTTTGCTCTTATAGGGGGTTTTTCT

[0027] TTTTGATATATAATGTTTACAGGTTATTTTTTAAAACCTTCTATAATAAAAAGA

[0028] CAATTTTGAACAATATTTATAGGAGTTAATATAACTTTTTTCCCTCAACATTT

[0029] TTTAGGTTTAAGAGGTATAACCTCGACGGTATTCTGATTATCCTGATAATTTCT

[0030] CAACTTGAAATACTATTTCATCTTTAGGAACTATAATTACAATATTCTCAATATTATTTTTTATGTATATTTTATGAGATTCATTATCAAAATATAAAATTATTTCA.

[0031] The third aspect of the present invention provides a method for detecting scabies infection using the primer combination or the kit.

[0032] Furthermore, the method comprises the following steps:

[0033] 1) Extracting nucleic acid from the sample to be tested;

[0034] 2) performing a fluorescent nucleic acid amplification reaction on the nucleic acid of the sample to be tested using the primer combination or the kit;

[0035] 3) Determine whether scabies infection exists in the sample to be tested based on the change in the fluorescence signal.

[0036] Furthermore, the amplification temperature of the fluorescent nucleic acid amplification reaction is 42° C., the reaction time is 20 min, and the fluorescence is read every 30 seconds.

[0037] Furthermore, in step 1), the sample to be tested is a skin sample.

[0038] Furthermore, the skin sample is dandruff tissue.

[0039] A fourth aspect of the present invention provides use of the primer combination or the kit in preparing a product for detecting scabies infection.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] 1. Improve detection accuracy

[0042] 1) Accurately identify scabies-specific nucleic acid sequences: The nucleic acid sequences of scabies are unique. This technology needs to accurately identify nucleic acid fragments specific to scabies to distinguish them from nucleic acids of other pathogens and normal skin tissues to avoid false positive or false negative results.

[0043] 2) Reduce nonspecific amplification: During the detection process, it is necessary to prevent other substances similar to scabies mite nucleic acid from causing nonspecific amplification, ensure that the test results are only for scabies infection, and improve the specificity of the test.

[0044] 2. Enhance detection sensitivity

[0045] 1) Detection of low-concentration scabies nucleic acid: In the early stages of infection or when the infection is mild, the number of scabies mites may be small and their nucleic acid concentration is relatively low. This technology needs to be able to sensitively detect trace amounts of scabies nucleic acid in order to detect infection early.

[0046] 2) Overcoming the influence of inhibitors in samples: Skin samples may contain various substances that inhibit nucleic acid amplification, such as blood, oil, etc. The technology needs to have a way to overcome the influence of these inhibitors to ensure the sensitivity of the test.

[0047] 3. Achieve rapid detection

[0048] 1) Shorten the detection time: Traditional scabies detection methods are often time-consuming and cannot meet the needs of rapid diagnosis. Fluorescence nucleic acid amplification technology requires optimization of reaction conditions and processes to shorten the detection time so that patients can be diagnosed and treated as soon as possible.

[0049] 2) Simplify the operation steps: The complex operation process not only increases the detection time, but also may introduce human errors. The technology should simplify the operation steps as much as possible to improve the operability and efficiency of the detection.

[0050] 4. Improve the reliability and repeatability of detection

[0051] 1) Ensure the stability of test results: Different batches of test reagents, different operators and different test environments may affect the reliability of test results. The technology needs to ensure stable test results under various conditions.

[0052] 2) Repeatability: Multiple test results should be highly consistent so that doctors and patients can have confidence in the test results. The technology needs to fully consider the requirements of repeatability during the design and verification process. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is a fluorescence detection diagram of amplification using the upstream primer F1 and 6 downstream primers R1, R2, R3, R4, R5 and R6 respectively, with plasmid 8 of LDJ.45 as the positive control.

[0054] Figure 2 This is a fluorescence detection diagram of amplification using the upstream primer F1 and 6 downstream primers R1, R2, R3, R4, R5 and R6, with ddH2O as the negative control.

[0055] Figure 3 This is a fluorescence detection graph of amplification using downstream primer R4 and 8 upstream primers F1, F2, F3, F4, F5, F6, F7 and F8, with plasmid 8 of LDJ.45 as the positive control.

[0056] Figure 4 This is a fluorescence detection graph of amplification using downstream primer R4 and 8 upstream primers F1, F2, F3, F4, F5, F6, F7 and F8, with ddH2O as a negative control.

[0057] Figure 5 This is a fluorescence detection graph of amplification using the combination of upstream primer F5 and downstream primer R4, LDJ.45 plasmid 8, LDJ.45 plasmid 9 and LDJ.45 plasmid 10 as positive controls, and ddH2O as a negative control.

[0058] Figure 6 This is a fluorescence detection diagram of amplification using the combination of upstream primer F5 and downstream primer R4, with ddH2O as a negative control. DETAILED DESCRIPTION

[0059] In order to make the purpose, technical solution and advantages of the present invention more clear, the present invention is further described in detail below. However, it should be understood that the description herein is only used to explain the present invention and is not intended to limit the scope of the present invention.

[0060] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention, and the terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art, which will not be repeated herein.

[0061] Example 1

[0062] This embodiment provides the overall process of the present invention, which specifically includes:

[0063] 1. The scabies cytochrome oxidase subunit I gene (COX1 gene) was selected as the target gene. The common scabies mites (Sarcoptes scabiei) COX1 genes listed in the literature were searched through NCBI, and the conserved regions were found by comparison using Vector NTI software. A partial region of the COX1 gene (see SEQ ID NO.4) was selected as the target amplification segment.

[0064] The selected partial region of COX1 gene is sequence SEQ ID NO.4:

[0065] TTTTGATTTTTTGGACACCCAGAAGTTTACATTCTTATTATTCCTGGATTTGG

[0066] GATAATTTCTCATATTATTACTTATTCAAGTAATAAAAGAGAACCATTTGGAT

[0067] CTTTAGGTATAATTTATGCTATGATTTCTATTGCAACTTTAGGTTTTATTGTAT

[0068] GAGCTCATCATATATTTACTGTTGGATTAGATGTTGATACTCGAGCTTATTTTA

[0069] CTTCAGCTACTATAATTATCGCTGTCCCTACAGGAGTAAAAATTTTTAGTTGA

[0070] TTATCTACAATATTAGGAGGAAAATTAGATTTTAACCCCTCTATGTATTGAGC

[0071] AATTGGCTTTGTGTTTCTATTTAGAATGGGAGGTCTTACGGGTATTATTTTAT

[0072] CTAACTCTTCTTTAGATGTTAGATTACACGATACTTACTATGTTGTAGCTCAC

[0073] TTTCATTATGTTTTATCTATAGGTGCTGTTTTTGCTCTTATAGGGGGTTTTTCT

[0074] TTTTGATATATAATGTTTACAGGTTATTTTTTAAAACCTTCTATAATAAAAAGA

[0075] CAATTTTGAACAATATTTATAGGAGTTAATATAACTTTTTTCCCTCAACATTT

[0076] TTTAGGTTTAAGAGGTATAACCTCGACGGTATTCTGATTATCCTGATAATTTCT

[0077] CAACTTGAAATACTATTTCATCTTTAGGAACTATAATTACAATATTCTCAATATTATTTTTTATGTATATTTTATGAGATTCATTATCAAAATATAAAATTATTTCA.

[0078] 2. Design and synthesize specific primers and probes for the scabies mite COX1 gene, including upstream primers F1, F2, F3, F4, F5, F6, F7, F8 and downstream primers R1, R2, R3, R4, R5, R6, and fluorescent probe S007SsPB1.

[0079] Based on the conserved region of the scabies COX1 gene, the following primers and fluorescent probes were designed and synthesized:

[0080] Table 1 Primer and probe sequences

[0081]

[0082] Among them, the sequence after modifying the sequence SEQ ID NO.3 is

[0083] 5'-TAACTTTTTTYCCTCAACATTTTTTAGG(FAM-dT)(THF)(BHQ1-dT)AA GAGGTATAACCT-C3-Spacer-3'.

[0084] 3. The scabies COX1 gene was constructed into the vector pUC57 to prepare a positive plasmid for scabies (LDJ.45 plasmid) for experimental verification and sensitivity testing. The plasmid was synthesized by Qingke Biotechnology Co., Ltd.

[0085] The plasmid copy number is calculated as follows: the length of the synthetic scabies COX1 gene target region is 242 bp, and the size of the PUC57 vector is 2710 bp. According to the simple copy number conversion formula, 10 ng is approximately equal to 3*10 9 copy.

[0086] The concentration of the positive plasmid was calibrated with NanoDrop and diluted to 3 ng / μL (converted to a copy number concentration of 3*10) with Tris-EDTA (TE). ^9 The plasmid was diluted to different concentrations of plasmid 1-plasmid 10 (see Table 2) for experimental verification and sensitivity testing:

[0087] Table 2 Components and concentrations of amplification system

[0088]

[0089] 4. Establish a rapid detection system for scabies mite nucleic acid, optimize the reaction conditions and processes, and achieve high-sensitivity and high-specificity amplification and detection of scabies mite nucleic acid.

[0090] 4.1 Amplification system

[0091] Table 3 Components and concentrations of amplification system

[0092]

[0093]

[0094] The fluorescent probe S007SsPB1 sequence added here is a modified sequence of SEQ ID NO.3, namely:

[0095] 5'-TAACTTTTTTYCCTCAACATTTTTTAGG(FAM-dT)(THF)(BHQ1-dT)AA GAGGTATAACCT-C3-Spacer-3'

[0096] 4.2 Reaction conditions

[0097] The amplification temperature is 42°C, the reaction is 20 minutes, and the GS8 fluorescence thermostatic amplification instrument is used to detect the change in fluorescence value, and the fluorescence is read every 30 seconds. Recombinase polymerase amplification does not require complex sample DNA pretreatment process, does not require thermal denaturation of the template, and the reaction is completed under low constant temperature conditions. The reaction is highly sensitive and specific, and the result can be obtained after 20 minutes of machine detection. The reaction is interpreted by fluorescence value, which eliminates the process of electrophoresis verification of PCR products and avoids aerosol contamination.

[0098] Under the optimized reaction system and conditions, positive plasmids of different concentrations were used as templates for nucleic acid amplification and fluorescence detection. The changes in the fluorescence signal were recorded to evaluate the sensitivity and specificity of the detection system. Through experiments such as fixed upstream primers and different downstream primer combinations, fixed downstream primers and different upstream primer combinations, the best primer combination F5+R4 was screened out as the detection primer, and LDJ.45 plasmid 8 (300 copies / μL), plasmid 9 (30 copies / μL), plasmid 10 (15 copies / μL) and negative (ddH2O) were used as templates. The detection was carried out on a constant temperature fluorescence detector to further verify the sensitivity of the combination, which could be detected up to 30 copies / μL, and there was no peak in the negative, proving the high sensitivity and specificity of the present invention.

[0099] Example 2

[0100] In this example, LDJ.45 plasmid 8 was used as a template, and upstream primer F1 and six downstream primers R1, R2, R3, R4, R5 and R6 were used in combination for amplification.

[0101] Template: 2μ300 copies / μL of LDJ.45 plasmid 8 as a positive control

[0102] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0103] Table 3 Amplification system of positive control and upstream primer F1 and downstream primers R1, R2, R3, R4, R5 and R6

[0104]

[0105] 300 copies / μL of LDJ.45 plasmid 8 were added to the eight empty positions A1-A8 as a positive control. In addition, 10 μM F1 was added to each well position as an upstream primer, 10 μM R1 was added to well position A1 as a downstream primer, 10 μM R2 was added to well position A2 as a downstream primer, 10 μM R3 was added to well position A3 as a downstream primer, 10 μM R4 was added to well position A4 as a downstream primer, 10 μM R5 was added to well positions A5 and A6 as a downstream primer, and 10 μM R6 was added to well positions A7 and A8 as a downstream primer.

[0106] The experimental results can be found in Figure 1 The fluorescence PCR detection diagram shown in the figure shows that curve A4 (i.e., adding 10 μM F1 as the upstream primer, 10 μM R4 as the downstream primer, and 300 copies / μL of LDJ.45 plasmid 8 as the template well 4) has the highest peak value compared with other curves, and the difference is significant. This shows that under the premise of adding the same upstream primer F1 and positive plasmid template, the downstream primer F4 has the best amplification effect compared with other downstream primers.

[0107] Example 3

[0108] The upstream primer F1 was combined with 6 downstream primers R1, R2, R3, R4, R5 and R6 for amplification.

[0109] Template: 2 μL ddH2O as negative control

[0110] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0111] Table 4 Negative control and amplification combination system of upstream primer F1 and downstream primer R1 / R2 / R3 / R4 / R5 / R6

[0112]

[0113] The results of fluorescent PCR detection can be found in Figure 2 , where ddH2O was added to A1-A8 as negative controls, the amplification curves of the eight wells presented a smooth straight line (reference Example 2, the curve with positive significance, the peak values ​​of which were all above 2000, much higher than the peak values ​​of all wells of the negative control of this example, where the peak value of well 7 was only 900, still a straight line, and therefore the detection was still determined to be negative), and there was no obvious upward trend from beginning to end, indicating that there was no amplification of the target nucleic acid sequence in the negative control sample, and no accumulation of fluorescent signals caused by the specific binding of the primer to the template and the subsequent extension reaction occurred, which strongly proved that the experimental system was reliable in avoiding contamination and effectively eliminated the possibility of false positive results.

[0114] Example 4

[0115] The downstream primer R4 was optimized through Example 2 and Example 3, and the downstream primer R4 was selected to be combined with 8 upstream primers F1, F2, F3, F4, F5, F6, F7 and F8, respectively, and a positive control for amplification.

[0116] Template: 2 μL LDJ.45 plasmid 8 (300 copies / μL) as positive control

[0117] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0118] Table 5 Positive control and amplification combination system of upstream primers F1-F8 and downstream primer R4

[0119]

[0120]

[0121] The experimental results can be found in Figure 3As shown in the fluorescence PCR detection diagram, as shown in the figure, curve A5 (i.e., adding 10 μM F5 as the upstream primer, 10 μM R4 as the downstream primer, and 300 copies / μL of LDJ.45 plasmid 8 as the template well 5) has the highest peak value compared with other curves, and the difference is significant. This result shows that under the premise of adding the same downstream primer R4 and positive plasmid template, the upstream primer F5 has the best amplification effect compared with the other 7 upstream primers.

[0122] Example 5

[0123] The downstream primer R4 was optimized through Example 2 and Example 3, and the downstream primer R4 was selected to be combined with 8 upstream primers F1, F2, F3, F4, F5, F6, F7 and F8, respectively, and a negative control for amplification.

[0124] Template: 2 μL ddH2O as negative control

[0125] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0126] Table 6 Negative control and amplification combination system of upstream primers F1-F8 and downstream primer R4

[0127]

[0128] The experimental results can be found in Figure 4 As shown in the fluorescence detection diagram, it can be seen that ddH2O was added to A1-A8 as a negative control, and the amplification curves of the 8 wells showed a relatively smooth straight line, without an obvious upward trend from beginning to end, indicating that there was no amplification of the target nucleic acid sequence in the negative control sample, and no accumulation of fluorescent signals caused by the specific binding of primers to templates and subsequent extension reactions occurred, which strongly proved that this experimental system is reliable in avoiding contamination and effectively eliminated the possibility of false positive results.

[0129] Example 6

[0130] Through Example 4 and Example 5, the upstream primer F5 and the downstream primer R4 can be optimally selected. The upstream primer F5 and the downstream primer R4 are combined, and three different concentrations of LDJ.45 plasmids are selected as templates to verify the sensitivity of the above combination detection.

[0131] Template: 2 μL LDJ.45 plasmid 8 (300 copies / μL), 2 μL plasmid 9 (30 copies / μL), 2 μL plasmid 10 (15 copies / μL) as positive control, 2 μL ddH2O as negative control.

[0132] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0133] Table 7 Negative control and amplification combination system of upstream primers F1-F8 and downstream primer R4

[0134]

[0135] The experimental results are shown in the attached Figure 5 As shown in the fluorescence detection graph, it can be seen that as positive controls, 300 copies / μL of plasmid 8 in wells 3 and 4 (as shown by curves A3 and A4 in the figure) and 30 copies / μL of plasmid 9 in wells 5 and 6 (as shown by curves A5 and A6 in the figure) are significantly different from the negative controls in wells 1 and 2 (as shown by curves A1 and A2 in the figure).

[0136] At the same time, the addition of 15 copies / μL LDJ.45 plasmid 10 in wells 7 and 8, as shown by curves A7 and A8 in the figure, showed little difference compared with the negative control in wells 1 and 2, indicating that this method is not effective for detecting plasmids with a concentration as low as 15 copies / μL.

[0137] Example 7

[0138] According to the test results of Example 6, the combined effect of upstream primer F5+downstream primer R4 was tested.

[0139] Template: 2 μL ddH2O as negative control

[0140] Instrument: Constant temperature fluorescence detector (Manufacturer: Xinda Gene; Model: GS8)

[0141] Table 8 Negative control and amplification combination system of upstream primers F1-F8 and downstream primer R4

[0142]

[0143] The results of fluorescent PCR detection can be found in Figure 6 ddH2O was added to A1-A8 as negative controls. The amplification curves of the eight wells showed a smooth straight line, and there was no obvious upward trend from beginning to end, indicating that there was no amplification of the target nucleic acid sequence in the negative control sample, and there was no accumulation of fluorescent signals caused by the specific binding of primers to templates and subsequent extension reactions. This strongly proved that this experimental system was reliable in avoiding contamination and effectively eliminated the possibility of false positive results.

[0144] The above examples finally determined the best combination for rapid detection of scabies nucleic acid, i.e., the combination of upstream primer F5, downstream primer R4 and fluorescent labeled primer R4007SsPB1. The combination has high detection sensitivity, i.e., scabies DNA can be detected at a concentration as low as 30 copies / μL (LDJ.45 plasmid 9 of Example 6 as a positive template), and there is no negative peak.

[0145] In the prior art, for the detection of scabies, the traditional microscope examination mainly relies on observing the morphological characteristics of scabies to determine whether it is infected; the accuracy is relatively low, and false positive or false negative results are prone to occur; professional equipment and technicians are required, and the operation is relatively complicated; different operators may cause differences in results, and the repeatability is relatively poor; while the ordinary PCR technology only amplifies the nucleic acid fragments specific to scabies, and then detects the amplified products by gel electrophoresis and other methods, and cannot monitor the reaction process in real time, and there may be a certain risk of non-specific amplification. The sensitivity of ordinary PCR is relatively low, and it may be difficult to detect trace amounts of scabies nucleic acid. After the ordinary PCR detection is completed, gel electrophoresis and other analysis steps are required, which takes a long time. The results of ordinary PCR require manual observation of the gel electrophoresis pattern, and the judgment results are easily affected by subjective factors; immunodiagnostic technology detects antibodies or antigens produced by the body after scabies infection, reflecting the body's immune response state. It is necessary for the body to produce enough antibodies or antigens after a period of infection to detect, which is relatively lagging behind nucleic acid detection; different pathogens may have similar antigenic structures, resulting in false positive results.

[0146] The fluorescent nucleic acid detection technology of the present invention can be combined with scabies nucleic acid through specific primers and probes, and the change of fluorescent signal is used to determine whether scabies infection exists. It can more accurately identify scabies nucleic acid sequences, reduce nonspecific amplification, and improve the specificity of detection. At the same time, the detection of fluorescent signals is very sensitive, and can detect lower concentrations of scabies nucleic acid (positive plasmids as low as 30 copies / μL can be detected), with high specificity and sensitivity, not limited by the morphology and number of scabies, greatly reducing the probability of false positives and false negatives, and improving the detection rate of early infection; the whole set of technical operation procedures is simple, the degree of automation is high, and the detection can be completed in a short time, and the detection results can generally be obtained in 20 minutes); at the same time, the technology has high repeatability and can provide a reliable basis for clinical diagnosis; finally, the fluorescent nucleic acid detection technology automatically analyzes the fluorescent signal through an instrument, and the result is objective and accurate, reducing the error of human judgment.

[0147] The fluorescent nucleic acid amplification technology of the present invention is used to detect scabies infection, and has the characteristics of high sensitivity, high specificity, fast and efficient process and simple operation. In terms of sensitivity, this technology can detect trace amounts of scabies nucleic acid, and can accurately detect the infection even when the number of scabies is small in the early stage of infection, which is helpful for early diagnosis and timely treatment; it can effectively avoid missed diagnosis caused by a small number of scabies, and improve the accuracy of detection. In terms of specificity, the amplification detection is carried out for the nucleic acid sequence unique to scabies, which is clearly distinguished from the nucleic acid of other pathogens, reducing the possibility of misdiagnosis, and can accurately identify scabies infection without misjudging other skin diseases or parasitic infections as scabies.

[0148] The detection process of this technology is relatively fast and can produce results in a short time, saving time for the diagnosis and treatment of patients; it can provide doctors with accurate diagnostic basis in a timely manner so as to formulate reasonable treatment plans. This technology is easy to operate and only requires the collection of skin dandruff samples from patients. The operation is relatively simple and less traumatic to patients; at the same time, the detection process is highly automated, reducing human operation errors and improving the reliability of detection.

[0149] Those skilled in the art can clearly understand that, for the convenience and brevity of description, the specific working process and related instructions of the system described above can refer to the corresponding process in the aforementioned method embodiment, and will not be repeated here.

[0150] So far, the technical solutions of the present invention have been described in conjunction with the preferred embodiments shown in the accompanying drawings. However, it is easy for those skilled in the art to understand that the protection scope of the present invention is obviously not limited to these specific embodiments. Without departing from the principle of the present invention, those skilled in the art can make equivalent changes or substitutions to the relevant technical features, and the technical solutions after these changes or substitutions will fall within the protection scope of the present invention.

Claims

1. A primer combination for detecting scabies infection, characterized in that: The primer combination includes an upstream primer F5 and a downstream primer R4, the sequence of the upstream primer F5 is shown in SEQ ID NO.1, the sequence of the downstream primer R4 is shown in SEQ ID NO.2, the sequence of SEQ ID NO.1 is 5'-CTTCTATAATAAAAAGACAATTTTGAACAATA-3', and the sequence of SEQ ID NO.2 is 5'-ATTTCAAGTTGAGAAATTATCAGGATAATCAG-3'.

2. The primer combination according to claim 1, characterized in that The primer combination further includes a fluorescent probe S007SsPB1, and the sequence of the fluorescent probe S007SsPB1 is SEQ ID NO.3: 5'-TAACTTTTTTYCCTCAACATTTTTTAGGTTTAAGAGGTATACCT-3'.

3. A kit for detecting scabies infection, characterized in that: The kit comprises the primer combination as claimed in claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also contains reagents for nucleic acid amplification reactions, including but not limited to tris-acetate buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, creatine phosphate, creatine kinase, Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease III and dNTP.

5. The kit according to claim 3, characterized in that The final concentration of the tris-acetate buffer is 30 mM, the final concentration of potassium acetate is 100 mM, the final concentration of magnesium acetate is 14 mM, the final concentration of dithiothreitol is 3 mM, the final concentration of polyethylene glycol is 5%, the final concentration of ATP is 2 mM, the final concentration of creatine phosphate is 20 mM, the final concentration of creatine kinase is 100 ng / μL, the final concentration of Escherichia coli SSB protein is 600 ng / μL, the final concentration of bacteriophage uvsX protein is 150 ng / μL, the final concentration of bacteriophage uvsY protein is 25 ng / μL, the final concentration of klenow polymerase large fragment is 80 ng / μL, the final concentration of nuclease exonuclease III is 50 ng / μL, and the final concentration of dNTP is 450 μM.

6. The kit according to claim 3, characterized in that The kit further comprises a positive plasmid LDJ.45, wherein the positive plasmid LDJ.45 comprises a target region sequence of scabies cytochrome oxidase subunit I gene (COX1 gene), wherein the target region sequence is SEQ ID NO.4: TTTTGATTTTTTGGACACCCAGAAGTTTACATTCTTATTATTCCTGGATTTGGGATAATTTCTCATATTATTACTTATTCAAGTAATAAAAGAGAACCATT TGGATCTTTAGGTATAATTTATGCTATGATTTCTATTGCAACTTTAGGTTT TATTGTATGAGCTCATATATTTACTGTTGGATTAGATGTTGATACTCGAGCTTATTTTACTTCAGCTACTATAATTATCGCTGTCCCTACAGGAGTAAAAATTTTTAGTTGATTATCTACAATATTAGGAGGAAAATTAGATTTTAACCCCTCTATGTATTGAGCAATTGGCTTTGTGTTTCTATTTAGAATGGGAGG TCTTACGGGTATTATTTTATCTAACTCTTCTTTAGATGTTAGATTACACGATACTTACTATGTTGTAGCTCACTTTCATTATGTTTTATCTATAGGTGCTGTTTTTGCTCTTATAGGGGGTTTTCTTTTTGATATAATGTTTACAGGTTATTTTTTAAAACCTTCTATAATAAAAAGACAATTTTGAACAATAT TTATAGGAGTTAATATAACTTTTTTCCCTCAACATTTTTTAGGTTTAAGAGGTATACCTCGACGGTATTCTGATTATCCTGATAATTTCTCAACTTGAAATACTATTTCATCTTTAGGAACTATAATTACAATATTCTCAATATTATTTTTTATGTATATTTTATGAGATTCATTATCAAAATATAAAATTATTTCA.

7. A method for detecting scabies infection using the primer combination of claim 1 or 2 or the kit of any one of claims 3 to 6, characterized in that: The following steps are involved: 1) Extracting nucleic acid from the sample to be tested; 2) performing a fluorescent nucleic acid amplification reaction on the nucleic acid of the sample to be tested using the primer combination of claim 1 or 2 or the kit of any one of claims 3 to 6; 3) Determine whether scabies infection exists in the sample to be tested based on the change in the fluorescence signal.

8. The method according to claim 7, characterized in that The amplification temperature of the fluorescent nucleic acid amplification reaction is 42° C., and the reaction time is 20 min.

9. The method according to claim 7, characterized in that: In step 1), the sample to be tested is dandruff tissue.

10. Use of the primer combination according to claim 1 or 2 or the kit according to any one of claims 3 to 6 in the preparation of a product for detecting scabies infection.

Images