Molecular marker related to bovine muscle betaine content and application thereof

Abstract

The invention relates to a molecular marker which is located at the 102029509th basic group from the 5'terminal on a No.9 chromosome of a bovine reference genome AR-UCD1.2 and is related to the content of betaine in bovine muscles. The invention describes a primer pair and a kit for detecting the molecular marker, and application of the primer pair and the kit in identifying the betaine content in bovine muscle, screening bovine varieties or performing bovine genetic breeding. The cattle muscle betaine relative abundance of AA genotype individuals is 0.90, the cattle muscle betaine relative abundance of GG individuals is-1.45, and cattle with high muscle betaine content can be obtained by selecting the AA genotype individuals. The method effectively solves the problem that the bovine muscle betaine content cannot be measured in vivo in actual production, reduces the breeding cost, effectively increases or reduces the bovine muscle betaine content in actual production, is high in accuracy and low in detection cost, can realize automatic detection, and has very high practical application value in the aspect of bovine breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and specifically relates to a molecular marker located on bovine chromosome 9 and related to the level of betaine content in bovine muscle and an application thereof. Background Art

[0002] Betaine is an alkaloid that is commonly found in animals and plants. It is an intermediate product of animal metabolism and has the functions of regulating osmotic pressure in the body, relieving stress, promoting fat metabolism and protein synthesis, and increasing lean meat rate. With the improvement of living standards, consumers' demand for beef is no longer limited to quantity, and the requirements for meat quality are getting higher and higher. In order to speed up the breeding process of cattle meat quality-related traits, betaine, as an important metabolic marker, has attracted more and more attention from researchers and breeders, and is expected to become part of the beef cattle breeding program. In livestock and poultry nutrition, betaine is an important feed additive that can improve livestock and poultry growth performance and meat quality. If the key SNP sites of betaine content in cattle muscle are screened through genetic breeding technology and added to molecular marker-assisted selection, the genetic improvement of traits such as beef quality can be accelerated, which can increase the economic benefits of breeding enterprises. Summary of the invention

[0003] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a molecular marker related to the level of betaine content in cattle muscle, which is obtained through whole genome association analysis and can significantly affect the trait of the level of betaine content in cattle muscle.

[0004] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0005] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, wherein the kit comprises the above-mentioned primer pair.

[0006] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0007] A fifth object of the present invention is to provide a method for screening cattle breeds with high or low muscle betaine content.

[0008] The sixth object of the present invention is to provide a method for genetic improvement of cattle.

[0009] The above object of the present invention is achieved by:

[0010] A molecular marker located on chromosome 9 of the bovine reference genome ARS-UCD1.2 and associated with the betaine content in bovine muscle, wherein the SNP site of the molecular marker corresponds to the A>G mutation at the 102029509th base from the 5′ end on chromosome 9 of the bovine reference genome ARS-UCD1.2 of the bovine reference genome sequence in the GenBank database, and the polymorphism of the base at the site leads to different traits of the betaine content in bovine muscle, wherein when the single nucleotide at the SNP site is A, the betaine content in bovine muscle is high; and when the single nucleotide at the SNP site is G, the betaine content in bovine muscle is low.

[0011] Preferably, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein M in the sequence is A or G.

[0012] A primer pair for detecting the aforementioned molecular marker comprises an upstream primer U and a downstream primer D, and the nucleic acid sequence thereof is as follows:

[0013] U (upstream primer): 5'-CGTCTGCAAGTAGGCATGAG-3' (SEQ ID No. 2);

[0014] D (downstream primer): 5'-CCCAGGTCTTGTCCCACTC-3' (SEQ ID No. 3).

[0015] A kit for detecting the aforementioned molecular marker, the kit comprising the primer pair according to claim 3.

[0016] The aforementioned molecular markers, primer pairs or kits are used in identifying the high or low betaine content in cattle muscle, screening cattle breeds with high or low betaine content in cattle muscle or cattle genetic breeding, and the cattle include Huaxi cattle and its synthetic line.

[0017] A method for identifying the betaine content in cattle muscle comprises the following steps: detecting the SNP site of the aforementioned molecular marker on cattle chromosome 9, and judging the betaine content in cattle muscle according to the genotype of the SNP site; when the SNP site is the AA genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the AG genotype; when the SNP site is the AG genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the GG genotype;

[0018] The cattle with AA genotype are cattle with A at base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2;

[0019] The cattle with the AG genotype are cattle whose bases at position 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 are A and G;

[0020] The cattle with the GG genotype are cattle whose base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 is G;

[0021] The bovine reference genome ARS-UCD1.2 is the bovine reference genome sequence in the GenBank database.

[0022] A method for screening cattle breeds with high betaine content in cattle muscle, comprising the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 9 of the cattle, eliminating individuals whose single nucleotide at the SNP site is G, and retaining individuals whose single nucleotide at the SNP site is A as breeding cattle; the cattle include Huaxi cattle and their synthetic lines.

[0023] Preferably, the aforementioned detection method comprises the following steps:

[0024] (1) Extracting genomic DNA from the cattle to be tested;

[0025] (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the bovine to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0026] (3) sequencing the PCR amplification product to obtain sequencing results;

[0027] (4) Determine the genotype based on the sequencing results.

[0028] A method for genetic improvement of cattle, comprising the following steps: determining the molecular markers of claim 1 or 2 of the breeding cattle in the breeding cattle core group, and making corresponding selections based on the molecular markers: selecting the breeding cattle individuals with AA or AG genotype at the 102029509th base from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 for the succession breeding of the breeding cattle, and eliminating the breeding cattle individuals with the GG genotype at this point, so as to increase the frequency of the allele A at this site generation by generation, thereby increasing the betaine content in the muscle of the offspring cattle; the cattle include Huaxi cattle and their synthetic lines.

[0029] The aforementioned molecular markers, primer pairs and / or any of the methods described are used in cattle breeding.

[0030] Compared with the prior art, the present invention has the following advantages and effects:

[0031] The method used in the present invention is to detect the base of the g.102029509A>G polymorphic site on chromosome 9 of the cattle reference genome ARS-UCD1.2, to discriminate the genotype of the cattle individual, to select the cattle muscle betaine content, and to obtain cattle with a higher muscle betaine content. The method provided by the present invention can be used for early screening of cattle to be selected, effectively solve the problem that the cattle muscle betaine content in actual production cannot be measured in vivo, reduce breeding costs, effectively increase or decrease the cattle muscle betaine content in actual production, the method has high accuracy, low detection cost, and can realize automatic detection, and has high practical application value in cattle breeding.

[0032] (1) The present invention detected a significant molecular marker on the nucleotide sequence of chromosome 9 of cattle that is associated with the level of betaine content in cattle muscle through genome-wide association study (GWAS). The present invention established a molecular marker-assisted selection breeding technology for improving the level of betaine content in cattle muscle, improved the process of breeding cattle with high muscle betaine content in Huaxi cattle and its synthetic lines, adapted to market demand, and contributed to increasing sales profits and improving core competitiveness for enterprises.

[0033] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker located on chromosome 9 of cattle and associated with the high or low betaine content in cattle muscle. Through the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits, and the technology can be applied to the genetic improvement of high betaine content in cattle muscle, thereby improving the excellent quality of beef, accelerating the breeding process, and thereby increasing corporate profits and core competitiveness.

[0034] (3) The present invention provides a method for cattle breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of the cattle herd and shorten the time for improving Huaxi cattle, thereby effectively improving the economic benefits of breeding cattle. The present invention can ultimately achieve the improvement of the economic benefits of commercial cattle by optimizing the dominant allele (A) with high betaine content in cattle muscle from the SNP molecular marker individuals. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a genome-wide association study (GWAS) analysis of betaine content in cattle muscle on chromosome 9 in Huaxi cattle;

[0036] Figure 2 This is a graph showing the high and low betaine content in the muscle of cattle of different genotypes.

[0037] Figure 3These are the sequencing results of the sequence near the g.102029509A>G polymorphic site on chromosome 9 of the reference genome ARS-UCD1.2 of cattle with AA, AG and GG genotypes. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the implementation manner of the present invention is not limited thereto.

[0039] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0040] Example 1 Identification of Betaine Content in Cattle Muscle

[0041] 1. Experimental Animals

[0042] The experimental cattle herds used in the present invention are all from the bull resource group established by the cattle genetic breeding team of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0043] A total of 116 Huaxi cattle bulls were selected from the resource group. When the average fattening period of the cattle in the group reached 24 months, they were uniformly slaughtered. The slaughter process was strictly carried out in accordance with the "Meat Procurement Specifications", and the slaughter data, carcass data and meat quality data were strictly measured in accordance with the requirements of GB / T 27643-2011 "Guidelines for the Determination of Carcass Traits and Meat Quality Traits after Slaughter".

[0044] 2. Sample Collection and Metabolite Determination

[0045] 20 mg of longissimus dorsi muscle of cattle was collected, 600 μL of metabolite extraction solution was added, and metabolites were obtained after vortexing, homogenization, centrifugation, drying and other steps. Non-targeted metabolomics analysis was performed using a high-resolution mass spectrometry UPLC-HRMS system. The metabolomics data were normalized using the SERRF R package to correct for batch effects. The quantitative information obtained by the above methods was merged, and the quantitative information detected by multiple methods was excluded to ensure the uniqueness of the metabolites, and then log2 transformation was performed for the final statistical analysis.

[0046] 3. Whole genome 770k high-density chip for SNP typing

[0047] From the above-mentioned resource group of 116 cattle, longissimus dorsi muscle samples were taken, and after grinding with liquid nitrogen, the whole genome DNA was extracted by the standard phenol-chloroform method, and the DNA concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined by Nanodrop2000 / 2000C nucleic acid protein detector. The qualified DNA samples were tested by NanoDrop2000 / 2000C nucleic acid protein detector, and the DNA was diluted to about 50ng / μL according to the test concentration. Then 6μl of the extracted DNA sample to be tested was mixed with 2μl Loading Buffer, loaded into 1% agarose gel, and the integrity of the DNA was tested by running gel. The DNA sample was sent to Newgene Biotechnology (Shanghai) Co., Ltd., and the cattle whole genome Illumina BovineHD chip 770K SNP chip (Illumina, USA) genotype determination was performed according to the company's standard process. PLINK v1.90 software was used to perform quality control on the 770K chip scanning typing data of all samples, and finally valid genotype data of 507,812 SNPs were obtained. In addition, Beagle 5.4 was used to fill the filtered autosomal SNPs to the sequence level based on a reference group of 1,847 individuals. After quality control, a total of 8,221,244 filled SNPs were obtained for metabolite genome-wide association analysis.

[0048] 4. Genome-wide association analysis

[0049] Metabolic phenotypes were corrected for age (months), batch, and the first two principal components based on SNPs, followed by rank-based inverse normal transformation using GenABEL. Associations between SNPs and metabolite phenotypes were performed using mixed linear models (--mlm) in the GCTA software. The significance threshold for association between SNPs and metabolites was 5 x 10 -8 GWAS analysis results are as follows Figure 1 As shown. Figure 1 It can be seen that there is a site on chromosome 9 that significantly affects the betaine content in cattle muscle. The molecular marker SNP site g.102029509A>G is extremely significantly correlated with the betaine content (P<2.96x 10 -11 ). The phenotypes of different genotypes in the group are significantly different. The muscle betaine content of AA cattle is significantly higher than that of GG cattle, and the muscle betaine content of heterozygous AG cattle is between the two pure and homozygous types. The above shows that this molecular marker significantly affects the muscle betaine content of cattle. It can be used for marker-assisted selection to increase the muscle betaine content of cattle in this group, thereby accelerating the breeding process of this trait.

[0050] 5. Determination of the polymorphism of the bovine SNP site g.102029509A>G

[0051] (1) The longissimus dorsi muscles of three cows were used as experimental materials, and genomic DNA was extracted from each of them.

[0052] (2) Primer design and synthesis

[0053] According to the cattle reference genome ARS-UCD1.2 sequence, the following primers were designed and synthesized:

[0054] U (upstream primer): 5'-CGTCTGCAAGTAGGCATGAG-3' (SEQ ID No. 2);

[0055] D (downstream primer): 5'-CCCAGGTCTTGTCCCACTC-3' (SEQ ID No. 3).

[0056] (3) PCR amplification

[0057] The three cow genomic DNAs obtained in step (1) were used as templates and U and D were used as primers to perform PCR amplification to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.

[0058] PCR amplification system: 100 ng of genomic DNA, 25 μL of Green Taq Mix, 200 nm of upstream and downstream primers, and make up the system to 50 μL with ddH2O.

[0059] PCR amplification program: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; and final extension at 72°C for 5 minutes.

[0060] (4) Sequencing and sequence analysis

[0061] Products 1, 2, and 3 were sequenced to obtain the sequences of products 1, 2, and 3. The three product sequences differed by only one base, which was the 121st base from the 5' end of the three sequences, where the base was an M (A / G) mutation. Figure 1 , where the horizontal axis represents the chromosome number of cattle; the vertical axis represents -log10(P). Figure 1 As shown in , there are SNPs on chromosome 9 of the cattle reference genome ARS-UCD1.2 that significantly affect the betaine content in cattle muscle, among which the 102029509th base from the 5′ end is the causative mutation. Figure 2 The difference in betaine content between different genotypes at this site was named SSC9g.102029509A>G. The sequencing results are as follows:

[0062] CCCAGGTCTTGTCCCACTCGGGGGTCTGGAGGCTCGAAGGGGCCCCTCC

[0063] ACGTGGTGCCAGTGGGGGGAGGGGCAGCGCGCGAGCCTGTGGCCACTTTCTTACCCGGCGCACGGTCTCCCM(A / G)

[0064] GTCCCTGGGGTCAGGGCGCTGTAGCCTCTGCGCAGACTTCCAGGGCTTG

[0065] CTCATGCTGTCCCGCTCTCCAAGGTGGTCAGTTGCCCTTTCTGTGAAG

[0066] GGAGCGAAGTCAGGAAGGACCTGTGTCACCATCGTGGTGACATCATTCT

[0067] CCCAAAATACTTCTTAGAAGAGACGTCCGCCAGGAGGGCTTCCAAACTG

[0068] TTACTGTGAGGAAGGCAGTCATGTGACACTTTCCCCACGATCAGAGGGG

[0069] CCCGGGCTCAGAGGTGTTCCTACCAACTCATGCCTACTTGCAGACG

[0070] Note: The M marked in the sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0071] The individual whose base 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base 121 from the 5' end of the PCR amplification product obtained in step (iii) is A is a homozygous individual, and the genotype of this individual is named AA. The individual whose base 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base 121 from the 5' end of the PCR amplification product obtained in step (iii) is G is a homozygous individual, and the genotype of this individual is named GG. The individual whose base 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base 121 from the 5' end of the PCR amplification product obtained in step (iii) is A and G is a heterozygous individual, and the genotype of this individual is named AG.

[0072] The present invention provides a SNP molecular marker that can significantly increase the muscle betaine content of breeding cattle. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of high-content betaine in the muscle of Huaxi cattle. The relative abundance of muscle betaine in AA-type individuals is 0.90, and the relative abundance of muscle betaine in GG individuals is -1.45. The muscle betaine content of AA-type individuals is significantly higher than that of GG-type individuals. If the present invention selects all GG-type individuals into AA-type individuals, the potential for economic benefits of a large-scale cattle farm with 10,000 heads is huge. Among the individuals of this SNP molecular marker, by optimizing the dominant allele (A) of the SNP, it is possible to ultimately achieve the improvement of the economic benefits of commercial cattle, thereby increasing the income of the enterprise.

[0073] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A molecular marker located on chromosome 9 of the cattle reference genome ARS-UCD1.2 and associated with the level of betaine in cattle muscle, characterized in that: The SNP site of the molecular marker corresponds to the A>G mutation at the 102029509th base from the 5′ end on chromosome 9 of the bovine reference genome ARS-UCD1.2 of the bovine reference genome sequence in the GenBank database. The polymorphism of the base at this site leads to different levels of betaine content in bovine muscle. When the single nucleotide at the SNP site is A, the bovine muscle betaine content is high; when the single nucleotide at the SNP site is G, the bovine muscle betaine content is low.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is A or G.

3. A primer pair for detecting the molecular marker according to claim 1 or 2, characterized in that It contains upstream primer U and downstream primer D, and its nucleic acid sequence is as follows: U (upstream primer): 5'-CGTCTGCAAGTAGGCATGAG-3' (SEQ ID No. 2); D (downstream primer): 5'-CCCAGGTCTTGTCCCACTC-3' (SEQ ID No. 3).

4. A kit for detecting the molecular marker according to claim 1 or 2, characterized in that: The kit comprises the primer pair according to claim 3.

5. Use of the molecular marker according to claim 1 or 2, the primer pair according to claim 3 or the kit according to claim 4 in identifying the level of betaine content in cattle muscle, screening cattle breeds with high or low betaine content in cattle muscle or cattle genetic breeding, characterized in that: The cattle include Huaxi cattle and their synthetic lines.

6. A method for identifying the betaine content in cattle muscle, characterized in that: The following steps are included: Detect the SNP site of the molecular marker described in claim 1 or 2 on chromosome 9 of cattle, and judge the level of betaine content in cattle muscle according to the genotype of the SNP site. When the SNP site is the AA genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the AG genotype; when the SNP site is the AG genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the GG genotype; The cattle with AA genotype are cattle with A at base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2; The cattle with the AG genotype are cattle whose bases at position 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 are A and G; The cattle with the GG genotype are cattle whose base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 is G; The bovine reference genome ARS-UCD1.2 is the bovine reference genome sequence in the GenBank database.

7. A method for screening cattle breeds with high betaine content in cattle muscle, characterized in that The method comprises the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 9 of cattle, eliminating individuals whose single nucleotide of the SNP site is G, and retaining individuals whose single nucleotide of the SNP site is A as breeding cattle; the cattle include Huaxi cattle and their synthetic lines.

8. The method according to claim 7, characterized in that The detection method comprises the following steps: (1) extracting genomic DNA of the cattle to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the bovine to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

9. A method for genetic improvement of cattle, characterized in that The method comprises the following steps: determining the molecular markers of claim 1 or 2 of the breeding cattle in the breeding cattle core group, and making corresponding selections according to the molecular markers: selecting the breeding cattle individuals with AA or AG genotype at the 102029509th base from the 5′ end on chromosome 9 of the reference genome ARS-UCD1.2 of the breeding cattle, and eliminating the breeding cattle individuals with the GG genotype at this point, so as to increase the frequency of the allele A at this site from generation to generation, thereby increasing the betaine content in the muscle of the offspring cattle; the cattle include Huaxi cattle and their synthetic lines.

10. Use of the molecular marker according to claim 1 or 2, the primer pair according to claim 3 or 4 and / or the method according to any one of claims 4 to 9 in cattle breeding.

Images