SNP (Single Nucleotide Polymorphism) molecular marker related to immune characteristics of yak and application of SNP molecular marker

Abstract

The invention relates to the technical field of biological detection, in particular to a yak immune characteristic related SNP molecular marker and application. According to the scheme, the SNP molecular marker for detecting the immune globulin content of the yak is located at the 107100737th basic group on a chromosome 2 of a yak reference genome LUBosgruv3.0 version, and a mutant basic group is A or G; according to molecular marker alleles, yaks have three genotypes of AA, AG or GG. The invention provides a new SNP molecular marker resource for non-diagnostic yak immune trait marker-assisted selection, and provides a basis for yak assisted breeding.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a SNP molecular marker related to yak immune characteristics and an application thereof. Background Art

[0002] As a typical livestock in alpine areas, the yak's unique ability to survive and reproduce is shaped by the harsh environment. Its immune system, as a key line of defense, shows remarkable adaptability, which is an important manifestation of the yak's ability to survive in alpine areas. By deeply understanding the immune characteristics of yaks, we can more scientifically guide their feeding and management practices and improve their disease resistance and production efficiency.

[0003] At present, disease-resistant breeding plays a vital role in animal husbandry production. It can not only significantly improve the resistance and immunity of yaks to various pathogens, thereby reducing the incidence of diseases, but also effectively reduce the use of antibiotics and drugs, which is of great significance for maintaining ecological balance, reducing environmental pollution, and ensuring the safety and quality of livestock products. By using advanced molecular marker technology, disease-resistant related genes can be accurately selected and identified at the molecular level. This means that the disease resistance of yaks can be accurately screened and evaluated at the early stage of their growth. This early screening method based on the molecular level not only greatly improves the efficiency and accuracy of disease-resistant breeding, but also greatly shortens the breeding cycle and reduces breeding costs.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the immune characteristics of yaks and its application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a SNP molecular marker for detecting the immunoglobulin content of yaks. The SNP molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G.

[0008] Preferably, the immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0009] Preferably, according to the molecular marker alleles, yaks have three genotypes: AA, AG or GG;

[0010] The levels of immunoglobulin A and immunoglobulin G in yaks with genotype GG were significantly higher than those in yaks with genotype AA or AG.

[0011] The content of immunoglobulin M in yaks with genotype GG was significantly higher than that in yaks with genotype AA.

[0012] The present invention also provides the use of the SNP molecular marker in preparing a product for detecting yak immune traits.

[0013] The present invention also provides the use of the SNP molecular marker in preparing a product for assisting in breeding yaks with high immunity.

[0014] The present invention also provides a primer pair for detecting SNP molecular markers of yak immunoglobulin content, and the primer pair is shown as SEQ ID NO.1-2;

[0015] The SNP molecular marker is the SNP molecular marker.

[0016] The present invention also provides the use of the primer pair in preparing a product for detecting yak immune traits and / or a product for assisting in breeding yaks with high immunity.

[0017] The present invention also provides a method for using SNP molecular markers to assist in breeding yaks with high immunity, comprising the following steps:

[0018] (1) Extracting yak genomic DNA;

[0019] (2) using the genomic DNA obtained in step (1) as a template and using the primer pair to perform PCR amplification to obtain a PCR amplification product;

[0020] (3) Performing genotyping analysis on the PCR amplification products to obtain yaks with different genotypes, correlating the genotypes of the yaks with immunoglobulins, screening yaks with high immunoglobulin content, and obtaining yaks with high immunity;

[0021] The PCR amplification system is: 2×L-Exp Taq Master Mix (dye plus) 12.5 μL, RNase-free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL;

[0022] The PCR amplification program was: 98°C for 2 min; 98°C for 10 s, 54°C for 30 s, 72°C for 10 s, for a total of 35 cycles; and extension at 72°C for 2 min.

[0023] The invention also provides application of the method in screening yaks with high immunity.

[0024] The present invention also provides a kit for detecting yak immune traits or assisting in breeding yaks with high immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0025] The present invention provides a SNP molecular marker related to the immune characteristics of yaks and its application. The SNP molecular marker used for detecting the immunoglobulin content of yaks is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G; when the 107100737th base on chromosome 2 is A, the yak genotype is AA or AG; when the 107100737th base on chromosome 2 is G, the content of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG is significantly higher than that in yak individuals with genotype AA or AG. The content of immunoglobulin A and immunoglobulin G (p<0.05); the content of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA (p<0.05); by detecting the base at the 107100737th nucleotide site on chromosome 2 of the yak, the IgA, IgG and IgM contents of the yak individuals can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for yak assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the PCR amplification product; M represents Marker.

[0027] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0028] The present invention also provides a SNP molecular marker for detecting the immunoglobulin content of yaks, wherein the SNP molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G;

[0029] The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0030] In the present invention, the primer pair is shown as SEQ ID NO.1-2;

[0031] Upstream primer SEQ ID NO.1: 5′-TCTGAGCAAGTAACACATTCC-3′;

[0032] Downstream primer SEQ ID NO.2: 5'-TCCTGACATTGGGTCTGATTA-3';

[0033] The length of the amplified fragment was 529 bp.

[0034] In the present invention, SEQ ID NO.3: TCTGAGCAAGTAACACATTCCTCAGTGAGACACCCCATCTCCTCATATATATACTTAGATCATTACTAGGGCATTTCCCCAGGAGACAAAATTACTAGAACTAGAAGCAAACAAAATGTGTTTCCCCAGGCTTCAAAATGACAAATACCAAGTG TGTGTGGTTTGGGAGGCAGGCATGTGTGTGGGGGCTATAAGTGTAAGCTTGAACACCTCGTGGAGAACTATCAAATCTTATCTATATCTCTTTAGATTACAAATCCCACACCCTTTGCACTATACAATGCTGCCTTTCCAAGGAATGAAGCAAGCCTTGT A GAATCTTTGAAGGGACAATTATGAGCTGAACCAGTTGCATGCCTAAACATTTATGCAGTTAACAAACACACACACACATTTGTAAGTATAAAATAGCTCAATAATTCCTTTTTCTACAAAAAAAAAAGATGCAAAATTCATTTAGAAAGTTAAAGAGAAATAAATTGACTTTACACTAATTCCATTAAATTAATCAGACCCAATGTCAGGA.

[0035] The SNP molecular marker is located at position 315 of SEQ ID NO.3.

[0036] In the present invention, the PCR amplification system is: 2×L-Exp Taq Master Mix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL;

[0037] The PCR amplification program was: 98°C for 2 min; 98°C for 10 s, 54°C for 30 s, 72°C for 10 s, for a total of 35 cycles; and extension at 72°C for 2 min.

[0038] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] 1. Sample collection

[0041] The samples came from Niangya yaks on the ranch in Jiali County, Nagqu City, Tibet Autonomous Region. 5 mL of blood samples were collected from 191 fasting yaks and placed in clean pro-coagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 minutes and then centrifuged at 3500 r / min for 10 minutes. The supernatant was aspirated into PE tubes, which were sealed and stored in a -20°C low-temperature refrigerator. Another 5 mL of blood sample was collected and added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood samples were collected, they were quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, they were frozen in a -20°C refrigerator for DNA extraction.

[0042] 2 Main reagents and instruments

[0043] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genome extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (MB-4907A), immunoglobulin G (IgG) (MB-4616A), and immunoglobulin M (IgM) (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0044] 3 Methods

[0045] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0046] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0047] 3.2 Extraction of genomic DNA from blood

[0048] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0049] 3.3 Primer design

[0050] Referring to the chromosome 2 sequence of the yak genome LU_Bosgru_v3.0 version, the Pick Primers online tool provided by the NCBI website was used to design specific primers, including the g107100737A>G SNP site.

[0051] Primer sequences

[0052] F: 5'-TCTGAGCAAGTAACACATTCC-3' (SEQ ID NO: 1);

[0053] R: 5'-TCCTGACATTGGGTCTGATTA-3' (SEQ ID NO: 2).

[0054] The length of the amplified fragment was 529 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0055] 3.4 PCR amplification and sequencing

[0056] PCR amplification system 25 μL: 2×L-Exp Taq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL.

[0057] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 54°C for 30 s, 72°C for 10 s, for a total of 35 cycles; extension at 72°C for 2 min.

[0058] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 It shows that the length of the sequence obtained by PCR amplification is 529bp. After sequencing, it is found that the nucleotide sequence at position 315 of the amplified product (base 107100737 on chromosome 2 of the genome LU_Bosgru_v3.0 version) has an A / G mutation. The amplified product band is clear without any mixed bands and has good specificity. The site was preliminarily identified as the SNP marker site of yak and named g107100737A>G SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 315th position of the sequence is an A mutation. The fragment size of the PCR amplified product meets the expected size, and the next step of the experiment can be carried out.

[0059] SEQ ID NO:3

[0060] TCTGAGCAAGTAACACATTCCTCAGTGAGACACCCCATCTCCTCATATATATACTTAGATCATTACTAGGGCATTTCCCCAGGAGACAAAATTACTAGAACTAGAAGCAAACAAAATGTGTTTCCCCAGGCTTCAAAATGACAAATACCAAGTGTGT GTGGTTTTGGGAGGCAGGCATGTGTGTGGGGGCTATAAGTGTAAGCTTGAACACCTCGTGGAGAACTATCAAATCTTATCTATATCTCTTTAGATTACAAATCCCACACCCTTTGCACTATACAATGCTGCCTTTCCAAGGAATGAAGCAAGCCTTGTA GAATCTTTGAAGGGACAATTATGAGCTGAACCAGTTGCATGCCTAAACATTTATGCAGTTAACAAACACACACACACATTTGTAAGTATAAAATAGCTCAATAATTCCTTTTTCTACAAAAAAAAAAGATGCAAAATTCATTTAGAAAGTTAAAGAGAAATAAATTGACTTTACACTAATTCCATTAAATTAATCAGACCCAATGTCAGGA.

[0061] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0062] 4 Statistical analysis

[0063] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g107100737A>G gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM. The results are expressed as "mean ± standard error".

[0064] 5 Results

[0065] 5.1 PCR amplification and sequencing results

[0066] The amplified product of the g107100737A>G SNP site on chromosome 2 of yak was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 529 bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0067] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the g107100737A>GSNP site has an AG mutation, and there are three genotypes: AA, AG, and GG.

[0068] 5.2 Statistical analysis results

[0069] Analysis of the genotypes and allele frequencies of the g107100737A>G SNP locus on chromosome 2 of yaks from the perspective of population genetics. As shown in Table 1, at the g107100737A>G SNP locus, the AA genotype frequency was the highest and was the dominant genotype, and the A allele frequency was 77.9%, showing a dominant allele. By χ 2 The adaptability test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.344, and the PIC was 0.285. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.

[0070] Table 1 Polymorphism of the g107100737A>G SNP locus on chromosome 2 of yaks

[0071]

[0072] 5.3 Association analysis of different genotypes with IgA, IgG, and IgM

[0073] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the contents of immunoglobulin A and immunoglobulin G in yaks with the GG genotype were significantly higher than those in yaks with the AA or AG genotype, and the content of immunoglobulin M in yaks with the GG genotype was significantly higher than that in yaks with the AA genotype (p<0.05). The results are shown in Table 2.

[0074] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0075]

[0076] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0077] As shown in Table 2, the contents of immunoglobulin A and immunoglobulin G in yaks with the GG genotype were significantly higher than those in yaks with the AA or AG genotype, and the content of immunoglobulin M in yaks with the GG genotype was significantly higher than that in yaks with the AA genotype (p<0.05), indicating that the bases at the g107100737A>G SNP locus on chromosome 2 of yaks were significantly correlated with yak IgA, IgG, and IgM (p<0.05), and were SNP markers related to yak IgA, IgG, and IgM.

[0078] The present invention provides a SNP molecular marker related to the immune characteristics of yaks and its application. The SNP molecular marker used for detecting the immunoglobulin content of yaks is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G; when the 107100737th base on chromosome 2 is A, the yak genotype is AA or AG; when the 107100737th base on chromosome 2 is G, the content of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG is significantly higher than that in yak individuals with genotype AA or AG. The content of immunoglobulin A and immunoglobulin G (p<0.05); the content of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA (p<0.05); by detecting the base at the 107100737th nucleotide site on chromosome 2 of the yak, the IgA, IgG and IgM contents of the yak individuals can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for yak assisted breeding.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker for detecting the immunoglobulin content of yaks, characterized in that: The SNP molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G.

2. The SNP molecular marker according to claim 1, characterized in that: The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

3. The SNP molecular marker according to claim 1 or 2, characterized in that: According to the molecular marker alleles, there are three genotypes of yaks: AA, AG, or GG; The levels of immunoglobulin A and immunoglobulin G in yaks with genotype GG were significantly higher than those in yaks with genotype AA or AG. The content of immunoglobulin M in yaks with genotype GG was significantly higher than that in yaks with genotype AA.

4. Use of the SNP molecular marker according to any one of claims 1 to 3 in the preparation of a product for detecting immune traits of yaks.

5. Use of the SNP molecular marker according to any one of claims 1 to 3 in the preparation of products for assisting in the selection of yaks with high immunity.

6. A primer pair for detecting SNP molecular markers of yak immunoglobulin content, characterized in that: The primer pair is shown in SEQ ID NO.1-2; The SNP molecular marker is the SNP molecular marker according to claim 1.

7. Use of the primer pair according to claim 6 in preparing a product for detecting immune traits of yaks and / or a product for assisting in breeding yaks with high immunity.

8. A method for breeding yaks with high immunity using SNP molecular markers, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the genomic DNA obtained in step (1) as a template and performing PCR amplification using the primer pair described in claim 6 to obtain a PCR amplification product; (3) Performing genotyping analysis on the PCR amplification products to obtain yaks with different genotypes, correlating the genotypes of the yaks with immunoglobulins, screening yaks with high immunoglobulin content, and obtaining yaks with high immunity; The PCR amplification system is: 2×L-Exp Taq Master Mix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL; The PCR amplification program was: 98°C for 2 min; 98°C for 10 s, 54°C for 30 s, 72°C for 10 s, for a total of 35 cycles; and extension at 72°C for 2 min.

9. Use of the method according to claim 8 in screening yaks with high immunity.

10. A kit for detecting immune traits of yaks or assisting in breeding yaks with high immunity, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to any one of claims 1 to 3 or a primer pair according to claim 6.

Images