Seed identification primer and identification method for sika deer, red deer and hybrid individuals thereof based on nuclear DNA sequence

Abstract

The invention is applicable to the technical field of biology, and provides a primer and a method for identifying species of sika deer, red deer and hybrid individuals thereof based on a nuclear DNA (Deoxyribose Nucleic Acid) sequence. The identification primer comprises a primer pair (a) containing SEQ ID NO. 1 and SEQ ID NO. 2 and / or a primer pair (b) containing SEQ ID NO. 3 and SEQ ID NO. 4. The identification primer is used for performing PCR amplification on a target genome, an amplification product is detected, when one band appears, the product is sika deer, when two bands appear, the product is red deer, and when three bands appear, the product is a hybrid individual of the sika deer and the red deer. According to the invention, a red deer and sika deer interspecific SNP marker is screened out, and a PCR-RFLP genotyping method is established according to the marker. According to the method, rapid and low-cost precise species identification suitable for large-scale detection of sika deer, red deer and hybrid individuals is realized by designing primers and constructing and optimizing a PCR amplification system.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to primers and identification methods for species identification of sika deer, red deer and their hybrids based on nuclear DNA sequences. Background Technology

[0002] Both sika deer and red deer are important members of the deer family. Their antlers, blood, bones, penises, and fetuses all have medicinal value, while venison is highly prized for its tender texture, delicious flavor, and rich content of protein, unsaturated fatty acids, and vitamins. Currently, the market price of sika deer antlers, blood, meat, and other products is significantly higher than that of red deer products. Furthermore, sika deer are smaller and produce less antler and meat than red deer, leading to the phenomenon of red deer or sika-horse hybrid deer products being sold as sika deer products. The influx of large quantities of imported red deer products has further exacerbated the chaos in the deer product market, seriously hindering the healthy development of the industry. Therefore, establishing a rapid and efficient method for species identification between red deer and sika deer is imperative.

[0003] Currently, methods for identifying sika deer and red deer mainly include physical morphological characteristics, immunological identification based on protein levels, and molecular identification based on DNA levels. However, identification based on physical morphological characteristics is only effective for some products that have maintained their original state, thus having a narrow scope of application. Protein-based detection is costly, suffers from poor batch-to-batch stability, and is only applicable to certain deer products. Furthermore, it cannot detect individuals that have hybridized between species at the protein level. Because DNA molecular markers are unaffected by environmental factors, have high accuracy, are highly sensitive, and are easy to operate, they are currently a hot research topic in animal and plant species identification methods and are widely used for identifying sika deer and red deer. Methods for species identification at the DNA level mainly include species-specific PCR amplification, DNA barcoding technology, PCR-RFLP, and LAMP amplification. These methods are all based on mitochondrial DNA sequences. Since mitochondrial DNA is maternally inherited (only the maternal mitochondria are present), these detection methods cannot effectively identify hybrid deer. Furthermore, species-specific PCR methods are complex to operate, and due to the high homology of sequences among species, non-specific amplification can easily occur, leading to false positives. DNA barcoding technology requires sequencing of PCR products, which is costly and time-consuming. Although LAMP amplification has high sensitivity, it is easily contaminated by environmental DNA, resulting in false positives. In addition, gene chip methods based on large-scale SNP markers can effectively detect red deer, sika deer, and hybrid individuals, but they are costly, time-consuming, and require specialized detection and data analysis platforms, making it difficult to achieve large-scale detection. Therefore, it is essential to screen for species-specific molecular markers based on chromosomal DNA of sika deer and red deer, and to establish a method that is low-cost, easy to operate, and suitable for large-scale detection. To this end, this invention proposes primers and identification methods for sika deer, red deer, and their hybrid individuals based on nuclear DNA sequences. Summary of the Invention

[0004] The purpose of this invention is to provide primers and methods for species identification of sika deer, red deer and their hybrids based on nuclear DNA sequences, in order to solve the problems mentioned in the background art.

[0005] The objective of this invention is achieved through the following technical solution: Species identification primers for sika deer, red deer, and their hybrids based on nuclear DNA sequences, wherein the identification primers are as follows (a) and / or (b): (a) SRMID1-F, whose nucleotide sequence is shown in SEQ ID NO.1, is 5'-ATCAAAAGCACCACCCTCAATCT-3'; SRMID1-R, whose nucleotide sequence is shown in SEQ ID NO.2, is 5'-TGCCCTTCTGACCAGTGTGTTTC-3'; (b) SRMID2-F, whose nucleotide sequence is shown in SEQ ID NO.3, is 5'-AAGCAACCAAAAAGGCAAACTAT-3'; SRMID2-R, whose nucleotide sequence is shown in SEQ ID NO.4, is 5'-GAAACAGTCTTACCAAAGAACTGTGTATC-3'.

[0006] The application of the identification primers described above in the identification of sika deer, red deer and their hybrid individuals.

[0007] A method for species identification of sika deer, red deer, and their hybrids based on nuclear DNA sequences involves using the aforementioned identification primers to perform PCR amplification of the target genome, detecting the amplification products, and identifying sika deer by the presence of one band, red deer by two bands, and hybrids of sika deer and red deer by three bands.

[0008] Furthermore, for (a) the identification primers: the amplification product shows a 530bp band, the target genome is sika deer; the amplification product shows two bands of 377bp and 153bp, the target genome is red deer; the amplification product shows three bands of 530bp, 377bp and 153bp, the target genome is hybrid individual.

[0009] Furthermore, for the identification primers in (b): the amplification product shows a 490bp band, indicating the target genome is that of a sika deer; the amplification product shows two bands of 328bp and 162bp, indicating the target genome is that of a red deer; the amplification product shows three bands of 490bp, 328bp, and 162bp, indicating the target genome is that of a hybrid individual.

[0010] Compared with the prior art, the beneficial effects of the present invention are: This invention, based on whole-genome data of sika deer and red deer, screened for species-specific SNP markers between the two species and established a PCR-RFLP genotyping method accordingly. This method, through primer design, construction, and optimization of the PCR amplification system, achieves rapid, low-cost, and large-scale accurate species identification of sika deer, red deer, and hybrid individuals. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The results are shown in the electrophoresis diagram for PCR amplification. In the diagram, A represents a 530bp band amplified by primers SRMID1-F and SRMID1-R, and B represents a 490bp band amplified by primers SRMID2-F and SRMID2-R. In the diagram, M represents the DL2000 DNA Marker; 1-4 represent Siping sika deer; 5-12 represent hybrid deer; and 13-16 represent Qingyuan red deer.

[0012] Figure 2 The results are shown in the electrophoresis results of PCR product digestion; where A represents the genotype of an individual based on the size of the digested fragment at the SRMID1 site, and B represents the genotype of an individual based on the size of the digested fragment at the SRMID2 site; in the figure, M represents DL2000 DNA Marker; 1-4 represent Siping sika deer; 5-12 represent hybrid deer; and 13-16 represent Qingyuan red deer.

[0013] Figure 3 The sequencing peak diagrams are for three genotypes at two loci; where A is the sequencing peak diagram for three genotypes at the SRMID1 locus, and B is the sequencing peak diagram for three genotypes at the SRMID2 locus.

[0014] Figure 4 The results show the population genotyping results; where A represents the population genotyping results based on the SRMID1 locus, and B represents the population genotyping results based on the SRMID1 locus; in the figure, M represents the DL2000 DNA Marker; 1-4: Dongfeng Sika Deer; 5-8: Shuangyang Sika Deer; 9-12: Dongda Sika Deer; 13-16: Tahe Red Deer; 17-20: Yihe Red Deer; 21-24: New Zealand Red Deer; 25-28: Hybrid Deer. Detailed Implementation

[0015] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0016] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0017] Example 1: Screening and identification of species-specific SNP markers in sika deer and red deer; (1) Screening of species-specific SNP markers; Fastp software was used to filter whole-genome resequencing data from red deer and sika deer to obtain CleanData. BWA software was used to align the CleanData to the red deer reference genome version mCerEla1.1 (GCF_910594005.1), and then Picard software was used to sort and label repetitive sequences to obtain BAM files. SNP merging and genotyping were performed using the workflow recommended on the GATK website. Two-allelic loci located on autosomes were extracted and filtered based on minimum allele frequency (MAF > 0.2) and deletion rate (geno < 0.05) to obtain high-quality SNP loci. vcftools software was used to calculate Fst values ​​for the red deer and sika deer populations, identifying loci with an Fst value of 1. These loci were then screened based on their genomic distribution, chromosome number, flanking nucleotide sequence characteristics, and the type of restriction enzymes associated with the polymorphic sites. Finally, two loci located on chromosomes 19 and 22, respectively, were selected for further analysis and named SRMID1 (Chr19:g. 47535071 T>C) and SRMID2 (Chr22:g.27605668 T>C), respectively. Detailed information is shown in Table 1. Both of these SNP polymorphic loci were present. Pst I endonuclease cleavage site.

[0018] Table 1. Species-specific SNP loci information for sika deer and red deer.

[0019] (2) Primer design and PCR amplification; To amplify these two SNP polymorphic sites, 400 bp flanking DNA sequences were extracted from each site. Two pairs of primers were designed using Primer Premier 5.0. The primer sequence information and amplification length are shown in Table 2. Table 2 PCR amplification primer information

[0020] The amplified region DNA sequence and SNP polymorphic sites are as follows: SRMID1: ATCAAAAGCACCACCCTCAATCTCAAAGATGTAGTTCCTCTGCAAGTCCAGCTCCCTGAGGTGGCCCAGGCCCTCAAAGATGGACTCATCAAGCCTCATGATGATGTTCCTCGCCAGGGACACGGACTCCAGTGAAGACAGGTTCTGGAGCATCAGAGCCGCCATGTCTTCCGTCAGGGAGTTCCCTGATAAGTCCAGCATGCGCAGAGCGCGCAGGCTGTGGAGGGCGGCCGCCGTCTCCTTGTAGTTCTCAGAGAGGGAGTTGTCAGGCAGCGACAGGCTGCGCAGGTGGGCCTGCTCCTGAAAGGCGACGTGGCCAATGCGCTCCAGGTAGCAGTCGTGCAGACTGAGGCTCTCCAGGAAAGGGTAACGC(T / C)GCAGTGAGTTGTTCCCCAGGGTCTTGAGAGGGTTGGCATCCAGGAGGAGCATCCGGGACGAGGGTGGGAGATCGCTGGGCACTGAAGCAAGGTTCCGCCCTCGACAGTCAGCCACTCCATCAAGCTAGGTCCA GAAACACACTGGTC <{ AGAAGGGCA (as shown in SEQ ID NO.5).

[0021] SRMID2: AAGCAACCAAAAAGGCAAACTAT It should be noted that there seems to be an incorrect angle bracket in the original text for which is "<{ AGAAGGGCA " and it should be just " AGAAGGGCA ". This has been maintained in the translation as it is not clear if it's a typo or an actual part of the original text with a specific meaning.ATATTTGAAAACACAGTTGTGGTTCATGGTTAATTATTTCATATCTCTAAGAGAATGTTTTAGTTGCACACAAAAGGTAAATTTAATTACCATACAAATGTTTGAAACTCTCTGATATAATAAAATCCCCCAGGATCACATGTCTACTAAACAGACTTCCTTCTCTTTCCAAATACATTATTGATCAGCTTGGCCATGGATTTAGATCCACTGTATCTTCTC TTTTCTTTGAGTTTGAGGTTTGTCAGGATGTCCCTGATAATTCTGATGAACATCATTTCCACCTCCAGAGATTGCTCTGC(T / C)GCAGAGAGTTCACAGAACCGGCAGCGGTTCTCCAGGGCCAGTCTGTGCCCTTCTGTCCAGCCAACCTCTCGCACATGACAGAGATCTTGCTTGTTACCCACCAGAAGCACTGCTGACTCCACAGCTCTGAAACACA GATACACAGTTCTTTGGTAAGACTGTTTC (As shown in SEQ ID NO.6).

[0022] Note: The underlined sequence indicates the primer position; the numbers in parentheses represent the two alleles of the SNP.

[0023] In addition to the usual basic principles, the primer design also took into account that the enzyme digestion fragments of the amplification products should be easily distinguishable by agarose gel electrophoresis. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0024] Sixteen samples were selected, including four Qingyuan red deer, four Siping sika deer, and eight hybrid deer [female red deer and male sika deer, or female sika deer and male red deer], for DNA extraction and PCR amplification. The PCR amplification reaction system consisted of 30 µL: 15 µL of 2× PCR Master Mix, 1 µL of DNA template, 0.25 µL each of forward and reverse primers, and 13.5 µL of ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The PCR products were detected by 2.5% agarose gel electrophoresis. The two primer pairs amplified bands of 530 bp and 490 bp, respectively, consistent with expectations. Figure 1 ).

[0025] (3) Enzyme digestion and genotype determination; PCR products were used Pst Enzyme digestion was performed using an enzyme I restriction enzyme, with a digestion system of 10 µL: 10× buffer 1 µL. Pst 0.5 µL of enzyme was added, along with 4 µL of PCR product, and the volume was brought to 10 µL with ddH2O. The mixture was digested overnight at 37°C. Subsequently, the digested products were detected by 2.5% agarose gel electrophoresis, and the genotype of the individuals was determined based on the size of the digested fragments. At the two SNP polymorphic sites, all red deer (TT) individuals produced two bands, sika deer (CC) individuals produced one band, while hybrid deer (TC) showed three bands. Figure 2 Table 3 shows the size information of the restriction enzyme fragments of different genotypes at the two SNP polymorphic sites. Table 3 PCR-RFLP enzyme digestion fragment information

[0026] To verify the accuracy of the enzyme digestion results, PCR products from individuals with three different genotypes were selected for first-generation sequencing. The results showed that the DNA sequences at the SNP sites were consistent with expectations. Figure 3 ).

[0027] (4) Group identification analysis; To verify the universality of the two SNP loci in this invention, genotyping analysis was performed on three red deer populations (Tahe red deer, Yihe red deer, and New Zealand red deer), three sika deer populations (Dongfeng sika deer, Shuangyang sika deer, and Dongda sika deer), and hybrid deer [Qingyuan red deer (♀) and Siping sika deer (♂) F1 generation]. Four individuals from each population were included, totaling 28 samples. Gel electrophoresis results showed that 12 red deer samples produced two bands, 12 sika deer individuals produced one band, and 4 hybrid deer individuals produced three bands. Figure 4 This indicates that the two SNP sites are common across different subspecies or breeds of red deer and sika deer.

[0028] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent.

Claims

1. A primer for species identification of sika deer, red deer and their hybrid individuals based on nuclear DNA sequences, characterized in that: The identification primers are as follows (a) and / or (b): (a) SRMID1-F, the nucleotide sequence of which is shown in SEQ ID NO. 1, 5'-ATCAAAAGCACCACCCTCAATCT-3'; SRMID1-R, the nucleotide sequence of which is shown in SEQ ID NO. 2, is 5'-TGCCCTTCTGACCAGTGTGTTTC-3'; (b) SRMID2-F, the nucleotide sequence of which is shown in SEQ ID NO. 3, 5'-AAGCAACCAAAAAGGCAAACTAT-3'; SRMID2-R, the nucleotide sequence of which is shown in SEQ ID NO. 4, is 5'-GAAACAGTCTTACCAAAGAACTGTGTATC-3'.

2. Use of the identification primer according to claim 1 in identifying the species of sika deer, red deer and their hybrid individuals.

3. A method for identifying the species of sika deer, red deer and their hybrids based on nuclear DNA sequences, characterized in that: The target genome is amplified by PCR using the identification primers described in claim 1, and the amplified product is detected. If one band appears, it is a sika deer; if two bands appear, it is a red deer; if three bands appear, it is a hybrid individual of a sika deer and a red deer.

4. The method according to claim 3, characterized in that Identification primers of (a): The amplified product showed a 530bp band, and the target genome was sika deer; the amplified product showed two bands of 377bp and 153bp, and the target genome was red deer; the amplified product showed three bands of 530bp, 377bp, and 153bp, and the target genome was a hybrid individual.

5. The method according to claim 3, characterized in that: (b) Identification primers: The amplified product showed a 490bp band, and the target genome was sika deer; the amplified product showed two bands of 328bp and 162bp, and the target genome was red deer; the amplified product showed three bands of 490bp, 328bp, and 162bp, and the target genome was a hybrid individual.

Images