Primer and method for screening patinopecten yessoensis with high temperature resistance based on SNP (Single Nucleotide Polymorphism)

Abstract

The invention discloses primers and a method for screening patinopecten yessoensis with a high-temperature-resistant characteristic based on SNP (Single Nucleotide Polymorphism). DNA (Deoxyribose Nucleic Acid) sequences of upstream and downstream primers are respectively shown as SEQ ID No.2 and SEQ ID No.3. The screening method sequentially comprises the following steps: extracting patinopecten yessoensis RNA (Ribonucleic Acid) and transcribing into cDNA (Complementary Deoxyribose Nucleic Acid); the method comprises the following steps: by taking patinopecten yessoensis cDNA (complementary deoxyribonucleic acid) as a template, carrying out PCR (polymerase chain reaction) amplification to obtain a target sequence containing T652G, C659G and T686T sites in exon regions of an MNK1 gene; performing gene sequencing on the target sequence; the patinopecten yessoensis of which the T652G site genotype is AG, the C659G site genotype is CA and the T686T site genotype is CA is taken as the patinopecten yessoensis with high temperature resistance, and the patinopecten yessoensis has the advantages of genetic stability, accuracy, high efficiency and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic breeding, and particularly relates to a primer and a method for screening a Yesso scallop with high temperature resistance based on SNP. Background Art

[0002] Yesso scallop ( Patinopecten yessoensis ) belongs to the phylum Mollusca, class Lamellibranchia, subclass Pterimorphia, order Pterioida, family Pectinidae, genus Scallop ( Pecten ), with a growth temperature range of 5 to 23°C, is one of the most important aquaculture varieties in my country's northern coastal areas. It has the characteristics of rapid growth, delicious meat, and rich nutrition. In recent years, the summer temperature in the aquaculture waters of northern my country is often higher than 23°C, and the high temperature period has also shown a trend of continuous extension. Large-scale deaths of aquacultured scallops in summer have occurred frequently, which not only affects the market supply of scallops, but also brings huge economic losses to the aquaculture industry of scallops. Therefore, it is urgent to breed a high-temperature resistant scallop variety.

[0003] Single Nucleotide Polymorphism (SNP) is one of the preferred markers for genetic breeding research. It has the advantages of high polymorphism, wide distribution, high genetic stability and accuracy. It has been used as one of the preferred markers for genetic breeding research and is widely used in molecular genetic selection of aquatic animals.

[0004] MNK (Mitogen activated protein kinase interacting kinase) is a substrate or binding factor of extracellular regulated protein kinases (ERK), encoded by two sets of genes, MKNK1 and MKNK2. Each set of genes is then translated into two subtypes through selective splicing, namely: MNK1a, MNK1b and MNK2a, MNK2b. Existing studies have shown that as a downstream kinase in the MAPK pathway, MNK has been confirmed to activate Drosophila melanogaster (Drosophila melanogaster) since it was first discovered in 1997. Drosophila melanogaster ) is involved in the process of apoptosis by inducing DNA damage response caused by ionizing radiation. However, there are relatively few studies on MNK in marine economic animals. MNK1 Report on the selection of heat-resistant Yesso scallops based on SNP sites in gene exon regions. Summary of the invention

[0005] The present invention aims to solve the above-mentioned technical problems existing in the prior art and provides a primer and method for screening Yesso scallops with high temperature resistance based on SNP.

[0006] The technical solution of the present invention is: a primer for screening the high temperature resistant scallop based on SNP, wherein the DNA sequences of the upstream primer F1 and the downstream primer R1 are as follows: F1: 5'- GGACGGATTGTAGCAAGAAGCGATT - 3'; R1: 5'-ACTCCGCTTATCTACATCCAGTTTCAC-3'.

[0007] A method for screening a scallop having high temperature resistance based on SNP using the above primers is carried out in the following steps: Step 1. Extract RNA from scallop and transcribe it into cDNA; Step 2. Using the cDNA of the scallop as a template, PCR amplification was performed to obtain MNK1 Target sequences at T652G, C659G, and T686T sites in the gene exon region; Step 3. Gene sequencing of the target sequence; Step 4. Use the Japanese scallop MNK1 Scallops with genotype AG at T652G site in the exon region of the gene, genotype CA at C659G site and genotype CA at T686T site are high temperature resistant scallops.

[0008] The PCR amplification system is based on 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance is supplemented with ddH2O; the program of the PCR amplification reaction is 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 53.5°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min, and storage at 4°C.

[0009] The present invention is based on the Japanese scallop MNK1 The genotype of T652G site in the exon region of the gene is AG, the genotype of C659G site is CA and the genotype of T686T site is CA as molecular markers (SNPs), PCR primers were designed, and the target sequence was amplified by PCR and sequenced to screen the high temperature resistant varieties of Yesso scallops, which have the advantages of genetic stability, accuracy and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Picture 1 Schematic diagram of the bivalve opening height of the Yesso scallop under high temperature stress of 24℃.

[0011] Picture 2 The scallop was exposed to high temperature at 24℃. MNK1 Schematic diagram of relative gene expression levels.

[0012] Picture 3 Scallop MNK1 Electrophoresis pattern of PCR amplification product fragments in the exon region of the gene and SNP site sequencing results.

[0013] Picture 4 Scallop MNK1 Multiple sequence alignment sequencing results of gene exon region. DETAILED DESCRIPTION

[0014] Step 1. Extract RNA from scallop and transcribe it into cDNA; Step 2. Using the cDNA of the scallop as a template, PCR amplification was performed to obtain MNK1 The target sequence of the T652G, C659G and T686T sites in the gene exon region, the PCR amplification system is calculated as 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance is supplemented with ddH2O. The DNA sequences of the upstream primer F1 and the downstream primer R1 are as follows: F1 (SEQ ID No. 2): 5'-GGACGGATTGTAGCAAGAAGCGATT - 3'; R1 (SEQ ID No.3): 5'- ACTCCGCTTATCTACATCCAGTTTCAC -3'; Taq enzyme was Taq enzyme [LA Taq PCR enzyme (Mg 2+ The PCR amplification reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 53.5°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min, and 4°C storage.

[0015] Step 3. Gene sequencing of the target sequence is performed, and its DNA sequence is shown in SEQ ID No. 1, that is, TCTTGTTGGTTACGGATTTATGCGAATGCAGTTTTAGTGATAAGATCTGGGAGAGAGCACATTTGTGTTCAAAGTCAAGTGATACAGTTGTTTAAACAAAAGACAACACCAGTTTACCAAAATGTTAGAGGTAGAGCATCAGGCTTTTTATAACCTATCGCCAAGAAGACCATCTAGTCTAATGTTAGACCGCGTACTTGCTGCATTGCCCTCGCTGGACATGGACCCGATTATGGAAGATATTGAGTTGAGAAATATTGAAAGTTCAACAATGAACCGCCGTCCATCAAGAAACAAGAAGAAACGTCGAAAGGAAGACCAACCTGCCCAAAAATTCAATGATCTTTACACCCCTACTGGAGAAAAGCTGGGGAGTGGTGCCTATGCTTCTGTAAATACGTACCGCAAAAATACAACCCAGAAACAGTATGCTGTAAAAGTTATTGAAAAAGATTTTGGAAGGTCACGGAAGAAGGTGTTCAAGGAGATTGAAATTTTTCACTTGTGCCAAAGTGAAGAGAATATTTTACGGTTGCATGAATACTTTGAGGAGGAAGAAAGATTTTATTTGGTGTTTGATTTGATGCATGGAGGAACCCTGTTGAACAACATTGAGAGGAGGGGCCATGTGACGGAGTTTGAAGCAAGCT TAG TGAT CCG AGATATTGCGAAAGCTCTTCACTT TCT.

[0016] The target sequence obtained contains the scallop MNK1 SNP sites of the gene (positions indicated by bold underlines): T652G, C659G and T686T sites; Step 4. Use the Japanese scallop MNK1 The scallops with genotypes of AG at T652G site, CA at C659G site and CA at T686T site in the gene exon region are Yesso scallops with high temperature resistance.

[0017] experiment: The high temperature resistance traits of the same cultured scallop family under the same culture and management conditions were measured. When the culture temperature was 24℃, the height of the bivalve opening of the scallop was greater than 0.5 cm ( Picture 1 The scallops that could not open at 24°C were selected as the high temperature intolerance group (HN group). At the same time, the scallops whose bivalve was tightly closed when the culture temperature was 24°C were selected as the high temperature tolerance group (HR group). RNA was extracted from each group of scallops and reverse transcribed into cDNA. qRT-PCR was used to amplify the RNA. MNK1 The relative expression levels of genes in the HR group and the HN group were analyzed.

[0018] The qRT-PCR amplification system was calculated as 20 μL, including 0.8 μL of upstream primer, 0.8 μL of downstream primer, 0.8 μL of ROXReference Dye, 10 μL of TB Green Premix Ex Taq, and 2 μL of DNA template, and the balance was supplemented with ddH2O. The qRT-PCR amplification reaction program was then performed, including: 95°C pre-denaturation for 10 min; 95°C cycle denaturation for 15 s, 60°C annealing for 60 s, and 35 cycles; 95°C for 10 s, 65°C for 1 min, and 97°C for 1 s; the sequences of the upstream primer and downstream primer are as follows: Upstream primer F2 (SEQ ID No. 4): GATCTGGAATGCTTCGCTGGAGAG; Upstream primer R2 (SEQ ID No. 5): TCCTCGTCTTCCTGGCTGTCTTC; The internal reference gene ( β-actin ) primers were used for comparison to calculate the relative expression level of each qRT-PCR amplification product.

[0019] High temperature resistance of scallops in HR and HN groups and MNK1 The results of relative gene expression level analysis are shown in Picture 2 As shown in the figure, "**" indicates a very significant difference compared with the HN group ( P < 0.01). Picture 2 This showed that the HR and HN groups of Yesso scallops MNK1 There were significant differences in the relative expression levels of the gene, indicating that the gene was closely related to the high temperature resistance of the Yesso scallop.

[0020] Further, RNA of each group of scallops was extracted and reverse transcribed into cDNA. PCR amplification was performed with primers with DNA sequences shown in SEQ ID No.2 and SEQ ID No.3; the PCR amplification system was prepared in 10 μL, including: 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance was supplemented with ddH2O. Subsequently, PCR amplification reaction was performed, and the program included: 95℃ pre-denaturation for 10 min; 95℃ cycle denaturation for 30 s, 60℃ annealing for 30 s, 72℃ pre-extension for 1 min 30 s, reaction for 35 cycles; 72℃ extension for 10 min, and storage at 4℃.

[0021] The amplified products were sequenced and the obtained SNP loci were genotyped ( Picture 3 ), and MNK1 Multiple sequence alignment of exon region sequencing results ( Picture 4 ),Discover MNK1 There are three mutation sites in the exon region of the gene, T652G, C659G and T686T, among which T652G is a conversion site, and C659G and T686T are transversion sites. From Table 1, it can be seen that the high temperature tolerant scallop individuals MNK1 The genotype of the T652G site in the gene is AG, the genotype of the C659G site is CA, and the genotype of the T686T site is CA. The above genotypes can be used as SNP sites for screening the high temperature resistant Yezo scallops.

[0022] Table 1 MNK1 Genotype frequency and allele frequency of a gene

[0023] HN: heat-intolerant scallops; HR: heat-tolerant scallops; P The values ​​were compared with those of the HN group.

[0024] The SNP primers of the present invention were used to detect 60 individuals from the same cultured scallop family under the same culture management conditions. MNK1 The gene was amplified and sequenced by PCR, and 40 individuals of the scallop were screened. MNK1 The genotype of the T652G site in the gene is AG, the genotype of the C659G site is CA, the genotype of the T686T site is CA, and the remaining 20 individuals do not meet the MNK1 The genotype of the T652G site in the gene is AG, the genotype of the C659G site is CA, and the genotype of the T686T site is CA. The high temperature stress treatment at 24°C resulted in the screening of MNK1All 40 Yesso scallop individuals with genotypes of AG at T652G, CA at C659G, and CA at T686T in the gene survived, while the remaining 20 individuals all died.

Claims

1. A primer for screening a scallop having high temperature resistance based on SNP, characterized in that The DNA sequences of the upstream primer F1 and the downstream primer R1 are as follows: F1: 5'- GGACGGATTGTAGCAAGAAGCGATT - 3'; R1: 5'-ACTCCGCTTATCTACATCCAGTTTCAC-3'.

2. A method for screening Yesso scallops with high temperature resistance based on SNP using the primers described in claim 1, characterized in that Follow the steps below: Step 1. Extract RNA from scallop and transcribe it into cDNA; Step 2. Using the cDNA of the scallop as a template, PCR amplification was performed to obtain MNK1 Target sequences at the T652G, C659G, and T686T sites in the exon region of the gene; Step 3. Gene sequencing of the target sequence; Step 4. Use the Japanese scallop MNK1 The scallops with AG genotype in the gene exon region, CA genotype in the C659G site and CA genotype in the T686T site are scallops with high temperature resistance.

3. The method for screening the high temperature resistant scallop based on SNP using the primers according to claim 1 according to claim 2, characterized in that: The PCR amplification system is based on 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance is supplemented with ddH2O; the program of the PCR amplification reaction is 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 53.5°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min, and storage at 4°C.

Images