Primer group for detecting mcr-1 to mcr-10 and application

Abstract

The invention discloses a primer group for detecting polymyxin drug resistance genes (mcr-1 to mcr-10) of bacteria, a multiplex PCR (Polymerase Chain Reaction) method and application. The primer group comprises 10 pairs of primers which are respectively used for carrying out specific PCR (Polymerase Chain Reaction) amplification on mcr-1 to mcr-10 genes. Based on the primer group, a one-step multiplex PCR method for efficiently detecting the genes from mcr-1 to mcr-10 is established. According to the method disclosed by the invention, efficient, specific and sensitive detection of mcr-1 to mcr-10 genes can be realized through one-step reaction of a reaction system. The method provided by the invention is used for detecting escherichia coli and salmonella isolates and comparing with a genome sequencing result, so that the accuracy of the method provided by the invention is further verified. The invention fills the blank of lack of mcr-1 to mcr-10 gene multiplex PCR primer groups and methods at present, and has good application prospects in the fields of clinical detection and microbial prevention and control.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a primer set for detecting mcr-1 to mcr-10 and an application thereof. Background Art

[0002] Due to the irregular use of drugs in humans and animals, the situation of bacterial resistance has become serious in recent years, and the emergence of multi-drug resistant bacteria has made the prevention and treatment of bacterial infections more difficult. Bacterial resistance can reduce or even ineffective clinical drug treatment of bacterial infections, posing a serious threat to the life and health of humans and animals, and has therefore attracted great attention worldwide.

[0003] Colistin is the last line of defense against infections caused by β-lactamase-producing Gram-negative bacteria. If bacteria also develop resistance to colistin, bacterial infections will be left untreatable. However, the plasmid-mediated mobile colistin resistance gene mcr-1 was first discovered in China in 2016, followed by mcr-2 to mcr-10. The mcr gene can spread rapidly through horizontal transfer, and can also be integrated into the chromosomal DNA and / or plasmids of environmental strains and passed on to offspring through vertical transmission, posing a serious threat to global public health. Studies have found that multiple different mcr genes can coexist in a strain of bacteria, such as the coexistence of mcr-1 and mcr-7, the coexistence of mcr-7 and mcr-8, the coexistence of mcr-1, mcr-3 and mcr-5, etc. The coexistence of multiple mcr genes is associated with increased resistance to colistin.

[0004] Colistin-resistant bacteria have spread to the six continents except Antarctica, of which mcr-1 and mcr-9 are the most widely distributed, having been found in isolates from 61 and 40 countries in the six continents, respectively. The global distribution ranges of mcr-1 to mcr-10 vary.

[0005] Most mcr-positive bacteria belong to the Enterobacteriaceae family, such as Escherichia coli, Salmonella enterica, Klebsiella pneumoniae, and Enterobacter spp. For example, mcr-8 is mainly found in Klebsiella pneumoniae, mcr-9 is common in Salmonella enterica, mcr-10 is mainly found in Enterobacter logenkamp, ​​and mcr-3 is common in Enterobacteriaceae and Aeromonas spp.

[0006] In order to detect the mcr gene and limit its rapid spread, a rapid, economical, convenient and reliable detection method is urgently needed. Molecular biological methods such as whole genome sequencing (WGS) and polymerase chain reaction (PCR) can be used to accurately identify the mcr gene. WGS is expensive and has high requirements for instruments and technology, which limits its application. In contrast, the PCR method has many advantages such as accuracy, rapidity, simplicity and economy, and can be used for the detection of the mcr gene.

[0007] CN112522378A discloses multiplex PCR primers and detection methods for detecting mcr-1, mcr-3, mcr-8, and mcr-10. CN110172522A discloses multiplex PCR primers and methods for detecting mcr-6, mcr-7, and mcr-8. CN108754000A discloses multiplex PCR primers and methods for detecting mcr-4, mcr-5, and mcr-8. CN110172522A discloses multiplex PCR primers and methods for detecting mcr-6, mcr-7, and mcr-8. CN10838A discloses multiplex PCR primers and methods for detecting mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5. CN112458191A discloses fluorescent PCR primers and methods for detecting mcr-1, mcr-3, mcr-8, and mcr-10. CN113817855A discloses digital PCR primers and detection methods for detecting mcr-6, mcr-7, mcr-8, mcr-9, and mcr-10. CN113943824A discloses digital PCR primers and detection methods for detecting mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5. To date, there is no multiplex PCR primer set and method for simultaneously detecting 10 mcr genes (mcr-1 to mcr-10). Summary of the invention

[0008] In order to solve the problems of the prior art, the present invention provides a primer set for detecting mcr-1 to mcr-10 and its application.

[0009] A primer set for detecting mcr-1 to mcr-10, the primer set comprising 10 pairs of primers, namely, a primer pair shown in SEQ ID No: 1 and SEQ ID No: 2, a primer pair shown in SEQ ID No: 3 and SEQ ID No: 4, a primer pair shown in SEQ ID No: 5 and SEQ ID No: 6, a primer pair shown in SEQ ID No: 7 and SEQ ID No: 8, a primer pair shown in SEQ ID No: 9 and SEQ ID No: 10, a primer pair shown in SEQ ID No: 11 and SEQ ID No: 12, a primer pair shown in SEQ ID No: 13 and SEQ ID No: 14, a primer pair shown in SEQ ID No: 15 and SEQ ID No: 16, a primer pair shown in SEQ ID No: 17 and SEQ ID No: 18, and a primer pair shown in SEQ ID No: 19 and SEQ ID No: 20; The nucleotide sequences of SEQ ID No: 1 and SEQ ID No: 2 are: CGCGACCGCCAATCTTAC, TGGCAAGCTGTGGGAAAGT; The nucleotide sequences of SEQ ID No: 3 and SEQ ID No: 4 are: TGGCGGTCTATCCTGTATCG, AAACGCACTGGCTTATGCAC; The nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6 are: CATGCTATGACGAGGTTGTCCTT, GTTGTCATAGGTGTTGGTGAGC; The nucleotide sequences of SEQ ID No: 7 and SEQ ID No: 8 are: TGTCGTGTTTGACTACGGCAT, TGTTGGTATTCCATGGGCGT respectively; The nucleotide sequences of SEQ ID No: 9 and SEQ ID No: 10 are: ACGAAGCAAGGGAAGTCGTT, TCTGCATGTTGCCAGAAGGT, respectively; The nucleotide sequences of SEQ ID No: 11 and SEQ ID No: 12 are: CGTCCGGTCAATCCCTATCTG, CATGTGTCAGCACAGTGTCG; The nucleotide sequences of SEQ ID No: 13 and SEQ ID No: 14 are: CTGGTGCTGAACTGGCCTTT, TCCATCCCCTTCTCTTTGGC; The nucleotide sequences of SEQ ID No: 15 and SEQ ID No: 16 are: TACCAGCAATTATCCTGGCGT, AACTGCGGAAGACAGTGGT; The nucleotide sequences of SEQ ID No: 17 and SEQ ID No: 18 are: AGGCATTGCTTACCGTTTGC, CGAAGGGTGTTGTCGTAGGT; The nucleotide sequences of SEQ ID No: 19 and SEQ ID No: 20 are: ATTCCGTTTGTGCTGGTTGC, ATAGTCGGTGTGGCGAATGG, respectively.

[0010] The present invention also provides the above-mentioned detection mcr-1 to mcr-10 Application of primer sets in multiplex PCR methods.

[0011] A multiplex PCR method is established, comprising the following steps: (1) Extract DNA from the bacteria to be tested; (2) Prepare the above 10 sets of primer pairs into solutions with a concentration of 10 μM respectively; (3) The DNA extracted in step (1) was used as a template and the primer pair in step (2) was added to the PCR reaction system. In the 25 μL reaction system, the components and their contents were as follows: 12.5 μL 2× Taq Master Mix, final concentration 0.02 μM for amplification mcr-1 , mcr-2 Primer pairs for the gene, final concentration 0.03 μM for amplification mcr-3 Primer pairs for the gene, final concentration 0.025 μM for amplification mcr-4 Primer pairs for the gene, final concentration 0.02 μM for amplification mcr-5 to mcr-10 The primer pair of the gene, 1 μL of DNA template for amplification, and finally made up to 25 μL with ddH2O; (4) PCR amplification reaction: The reaction program is: 95℃ for 10 min; 95℃ for 15 s, 62℃ for 60 s, 72℃ for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. (5) Electrophoresis detection: The PCR products were electrophoresed in 3% agarose gel at 120 V for 90 min. After electrophoresis, the agarose gel was placed in an imager for observation. The presence of the mcr gene was determined based on the appearance of amplified fragments and the size of the fragments. The specific fragment sizes were 722 bp (mcr-1), 454 bp (mcr-2), 209 bp (mcr-3), 363 bp (mcr-4), 974 bp (mcr-5), 1510 bp (mcr-6), 1418 bp (mcr-7), 1268 bp (mcr-8), 819 bp (mcr-9) and 1128 bp (mcr-10).

[0012] The present invention also provides the use of the primer set for detecting mcr-1 to mcr-10 in the detection of mcr genes for non-diagnostic and therapeutic purposes of clinical or environmental bacteria.

[0013] Compared with the prior art, the present invention has the following advantages: (1) Based on the sequence characteristics of the 10 mcr genes (mcr-1 to mcr-10) in different bacteria, the target sequences to be amplified were accurately screened and specific primers were designed. Experiments verified that each primer pair could amplify the target sequence efficiently and specifically, and no hairpin structure was formed within the primers, and no dimers were formed between primers. Ultimately, the 10 mcr genes (mcr-1 to mcr-10) could be detected efficiently, specifically, and sensitively through a single reaction system and one-step detection.

[0014] (2) The multiplex PCR reaction system and reaction procedure, especially the primer concentration and annealing temperature, were optimized, and a one-step multiplex PCR detection method for 10 mcr genes (mcr-1 to mcr-10) was established.

[0015] (3) The correctness and accuracy of the present invention have been verified by various methods such as specificity, sensitivity and genome sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a multiplex PCR test of 10 mcr genes, where M is 100 bp DNA Ladder and NC represents negative control; Figure 2 is the detection limit of the mcr gene, where Figure 2 A is the detection limit of multiplex PCR when the extracted plasmid DNA is used as template; Figure 2 B is the detection limit of multiplex PCR using extracted genomic DNA as template; Figure 3 For multiplex PCR detection of mcr gene in Escherichia coli isolates, total DNA extracted by boiling lysis method was used as template for multiplex PCR amplification, where M is a molecular weight marker and NC is a negative control; Figure 4 The results of multiplex PCR detection of mcr gene in Salmonella isolates, among which, Figure 4 A is multiplex PCR amplification using plasmid DNA as template. Figure 4 B is the result of multiplex PCR amplification using total DNA extracted by boiling lysis method as template, M is the molecular weight marker, and NC represents the negative control. DETAILED DESCRIPTION

[0017] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0018] Example 1 Primer design and synthesis The nucleotide sequences of 10 mcr genes were retrieved and downloaded from the National Center for Biotechnology Information (NCBI). Primer design and primer specificity analysis were performed using NCBI's Primer-BLAST. The designed specific primers are shown in Table 1. In order to make the multiple PCR primers more compatible, the melting temperature (Tm) and dimer formation of the primers were analyzed using the Multiple Primer Analyzer (Thermo Fisher Scientific).

[0019] Table 1 For amplification mcr Multiplex PCR primers for genes

[0020] Ten sets of primer pairs were prepared into 10 μM solutions.

[0021] Example 2 Establishment of multiplex PCR method Multiplex PCR was performed in a 25 μL reaction system, which contained 12.5 μL 2×Taq MasterMix (Jian'an Protein, Suzhou); primers for amplifying mcr-1, mcr-2, and mcr-5 to mcr-10 genes at a final concentration of 0.02 μM, primers for amplifying mcr-3 gene at a final concentration of 0.03 μM, and primers for amplifying mcr-4 gene at a final concentration of 0.025 μM; 1 μL of DNA template for amplification, and finally ddH2O was used to make up the reaction system to 25 μL.

[0022] Multiplex PCR was performed according to the following reaction program: 95°C for 10 min; 95°C for 15 s, 62°C for 60 s, and 72°C for 60 s, for a total of 35 cycles; and a final extension at 72°C for 5 min.

[0023] Example 3 Verification of specificity and sensitivity of multiplex PCR method Escherichia coli X2 (containing mcr-1 gene) and Salmonella QLULR4 (containing mcr-9 gene) preserved in our laboratory were used as positive controls for mcr-1 and mcr-9. The positive controls for mcr-2 to mcr-8 and mcr-10 were synthesized by Shanghai Bio-Tech and integrated into pUC57 plasmids. The synthetic regions of the corresponding genes are as follows: mcr-2.1 (NCBI Reference Sequence: NG_051171.1: 101-1717, bases 108-571), mcr-3.1 (NCBI Reference Sequence: NG_055505.1: 101-1726, bases 1041-1259), mcr-4.1 (NCBI Reference Sequence: NG_057470.1, bases 277-649), mcr-5.1 (NCBI Reference Sequence: NG_055658.1: 101-1744, bases 648-1631), mcr-6.1 (NCBI Reference Sequence: NG_055781.1, bases 23-1542), and mcr-7.1 (NCBI Reference Sequence: NG_055790.1, bases 277-649). Sequence: NG_056413.1: 101-1720, bases 53-1480), mcr-8.1 (NCBI Reference Sequence: NG_061399.1: 101-1798, bases 396-1673), mcr-10.1 (NCBI Reference Sequence: NG_066767.1, bases 143-1280).

[0024] For the negative control group, an equal amount of ddH2O was used instead of template for multiplex PCR amplification.

[0025] Extraction of bacterial DNA: The specificity of the multiplex PCR method was verified by the positive strains of the above 10 genes. At the same time, in order to detect the detection limit of multiplex PCR, the genomic DNA and plasmid DNA of the above 10 mcr gene positive isolates were extracted by bacterial genomic DNA extraction kit (Tiangen, Beijing) and colorful plasmid mini extraction kit (Polymer, Beijing). The total DNA of the isolates was extracted by boiling lysis method. The plasmid DNA of the isolates was extracted according to the instructions of TIANprep MiniPlasmid Kit (Tiangen, Beijing).

[0026] The total DNA of the 10 mcr gene-positive strains was used as a template for multiplex PCR amplification to verify the specificity of multiplex PCR. The detection limit of multiplex PCR was determined with different concentrations of plasmid DNA and genomic DNA. The PCR products were electrophoresed in a 3% agarose gel at 120 V for 90 min. To determine the specificity of multiplex PCR amplification, the PCR products were purified and sequenced by Shanghai Sangon Biotechnology.

[0027] Primers for amplifying the internal fragments of 10 mcr genes were designed by Primer-BLAST. The sizes of the amplified products were 722 bp (mcr-1), 454 bp (mcr-2), 209 bp (mcr-3), 363 bp (mcr-4), 974 bp (mcr-5), 1510 bp (mcr-6), 1418 bp (mcr-7), 1268 bp (mcr-8), 819 bp (mcr-9) and 1128 bp (mcr-10), respectively. There was at least a 92 bp difference between any two amplified products, so that the bands of different mcr genes could be distinguished. Since there are multiple variants of each mcr gene, we analyzed the ability of primers to amplify mcr gene variants by Primer-BLAST and SnapGene. The analysis results showed that all variants of the mcr gene could amplify fragments of the expected size by the corresponding primers. Primer-BLAST primer specificity analysis results showed that the 10 primer pairs had good specificity in Enterobacteriaceae. And under the default parameters, the analysis results of Multiple Primer Analyzer (Thermo Fisher Scientific) showed that there was no dimer formation between the 20 primers.

[0028] Multiplex PCR amplification was performed using the total DNA of 10 positive isolates extracted by boiling and lysis as amplification template. Figure 1 As shown, all 10 mcr genes showed specific bands of expected sizes in agarose electrophoresis, indicating that the primers had good specificity. Previous studies have shown that multiple mcr genes coexist in a single isolate. A mixture of 10 mcr gene-positive isolates was used as a template for multiplex PCR amplification. The results showed that all 10 mcr genes could amplify bands of corresponding sizes in a one-step PCR reaction.

[0029] In order to test the detection limit of multiplex PCR, plasmid DNA and genomic DNA of 10 mcr-positive strains were extracted using the kit. According to the detection limit results, when plasmid DNA was used as the amplification template, mcr-1 and mcr-9 had clear bands at 100 pg, and the detection limits of the two genes were less than 100 pg; mcr-2 to mcr-8 and mcr-10 had clear bands at 10 pg of plasmid DNA, and the detection limits of the eight genes were less than 10 pg ( Figure 2 A). When genomic DNA was used as a template for amplification, mcr-1, mcr-5, mcr-7, and mcr-9 had obvious bands at 100 pg of genomic DNA, and the detection limit was less than 100 pg; mcr-2, mcr-3, mcr-4, mcr-6, mcr-8, and mcr-10 had obvious bands at 10 pg of genomic DNA, and the detection limit was less than 10 pg ( Figure 2 B).

[0030] Example 4 Comparison of multiplex PCR method and genome sequencing results Among the isolates used to verify the specificity of multiplex PCR, 254 Salmonella strains had completed whole genome sequencing. To determine whether the mcr gene was present in the isolates, nucleotide sequence alignment of 10 mcr genes was performed by BLASTn. The mcr genes used for nucleotide sequence alignment are shown in Table 2. Similarly, the sequencing data of multiplex PCR products that tested positive for mcr were also submitted to NCBI for sequence alignment to verify the specificity of multiplex PCR amplification.

[0031] Table 2 Nucleotide sequence alignment mcr Gene

[0032] We will combine the above 10 mcr The gene sequence was compared with the sequencing data of 254 strains of Salmonella. The nucleotide sequence comparison results showed that the gene was found in 16 strains of Salmonella. mcr-9.1 Gene. mcr The detailed BLASTn comparison information of the positive strains is shown in Table 3. In addition, 65 strains mcr The sequencing data of the PCR products of the positive isolates were compared by BLASTn on NCBI. The nucleotide sequence comparison results were consistent with the multiplex PCR detection results, further proving the accuracy of the multiplex PCR established by the present invention.

[0033] Table 3 Nucleotide sequence alignment results

[0034] Example 5 Application of multiplex PCR method in detection of Escherichia coli mcr-1 to mcr-10 To verify the effectiveness of the multiplex PCR method, 240 strains of E. coli were cultured at 37°C for 12-16 h. The total DNA of the 240 strains of E. coli was extracted by boiling lysis method and used as a template to detect the mcr gene in the strains by multiplex PCR. Among the 240 strains of E. coli, 49 strains were detected to contain the mcr-1 gene ( Figure 3 These mcr-1 positive E. coli were isolated in 2012 (24 strains), 2013 (15 strains), 2014 (4 strains) and 2015 (6 strains). Among them, 45 strains were isolated from chickens and 4 strains were isolated from pigs.

[0035] Example 6 Application of multiplex PCR method in detection of Salmonella mcr-1 to mcr-10 Since most mcr The genes are all located on plasmids, so multiplex PCR amplification was performed using the plasmid DNA extracted from 180 Salmonella strains as templates. The results of multiplex PCR showed that 11 strains of Salmonella (QLULR4, QLUY102, QLUY105, QLUY201, QLUY203, QLUY404, QLUY408, QLUY412, QLUY419, QLUY703 and QLUY930) were positive. mcr-9 Positive( Figure 4 A).

[0036] In addition, the total DNA of the above 180 strains of Salmonella was extracted by boiling lysis method, and multiplex PCR amplification was performed using the total DNA as a template. The results showed that the multiplex PCR test results using total DNA as a template were consistent with those using plasmid DNA as a template ( Figure 4 B). Although the DNA template of multiplex PCR was replaced from plasmid DNA to total DNA, which has a lower extraction cost, the amplification effect of multiplex PCR was not affected. Therefore, multiplex PCR was used to detect the presence of 158 Salmonella isolates using total DNA as the amplification template. mcr Gene.

[0037] A total of 338 Salmonella strains isolated from 2004 to 2020 were detected using a newly established multiplex PCR method. mcr Among them, 16 strains of Salmonella were detected mcr-9 Positive( Figure 4 B). 16 strains mcr-9 Among the positive isolates, the isolation information of QLUY201, QLUY203 and QLUY404 is unknown. mcr-9The positive isolates were isolated in 2006 (1 strain), 2009 (2 strains), 2010 (9 strains) and 2012 (1 strain). Among them, 12 strains were isolated from chickens and 1 strain (QLULY5) was isolated from humans. In addition, 16 strains mcr-9 The positive Salmonella can be divided into two serotypes: Salmonella Thompson (14 strains) and Salmonella Enterica (2 strains). See Table 4 for details.

[0038] Table 4 mcr Serotype and isolation information of positive Salmonella

[0039] Note: “-” indicates that the separation information is unknown.

[0040] Example 7 Comparison of three gene detection methods for 180 strains of Salmonella The results of three detection methods for 180 strains of Salmonella were summarized, including the results of multiplex PCR detection using total DNA as a template, the results of multiplex PCR detection using plasmid DNA as a template, and the results of nucleotide sequence comparison based on whole genome sequencing. The results showed that the detection results of the three methods were consistent, and a total of 11 strains were detected. mcr-9 Positive isolates (QLULR4, QLUY102, QLUY105, QLUY201, QLUY203, QLUY404, QLUY408, QLUY412, QLUY419, QLUY703 and QLUY930). The results of the three detection methods are shown in Table 5. The multiplex PCR detection results are consistent with the nucleotide sequence alignment results based on the whole genome sequencing data, which proves the accuracy of the multiplex PCR established by the present invention. During the experiment, plasmid DNA was replaced with total DNA extracted by boiling and lysis. This not only reduces the cost of DNA template extraction, but also ensures the accuracy of multiplex PCR.

[0041] Table 5 Three mcr Comparison of genetic testing methods

[0042] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer set for detecting mcr-1 to mcr-10, characterized in that: The primer set comprises 10 pairs of primers, namely, a primer pair shown in SEQ ID No: 1 and SEQ ID No: 2, a primer pair shown in SEQ ID No: 3 and SEQ ID No: 4, a primer pair shown in SEQ ID No: 5 and SEQ ID No: 6, a primer pair shown in SEQ ID No: 7 and SEQ ID No: 8, a primer pair shown in SEQ ID No: 9 and SEQ ID No: 10, a primer pair shown in SEQ ID No: 11 and SEQ ID No: 12, a primer pair shown in SEQ ID No: 13 and SEQ ID No: 14, a primer pair shown in SEQ ID No: 15 and SEQ ID No: 16, a primer pair shown in SEQ ID No: 17 and SEQ ID No: 18, and a primer pair shown in SEQ ID No: 19 and SEQ ID No: 20; The nucleotide sequences of SEQ ID No: 1 and SEQ ID No: 2 are: CGCGACCGCCAATCTTAC, TGGCAAGCTGTGGGAAAGT; The nucleotide sequences of SEQ ID No: 3 and SEQ ID No: 4 are: TGGCGGTCTATCCTGTATCG, AAACGCACTGGCTTATGCAC; The nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6 are: CATGCTATGACGAGGTTGTCCTT, GTTGTCATAGGTGTTGGTGAGC; The nucleotide sequences of SEQ ID No: 7 and SEQ ID No: 8 are: TGTCGTGTTTGACTACGGCAT, TGTTGGTATTCCATGGGCGT respectively; The nucleotide sequences of SEQ ID No: 9 and SEQ ID No: 10 are: ACGAAGCAAGGGAAGTCGTT, TCTGCATGTTGCCAGAAGGT, respectively; The nucleotide sequences of SEQ ID No: 11 and SEQ ID No: 12 are: CGTCCGGTCAATCCCTATCTG, CATGTGTCAGCACAGTGTCG; The nucleotide sequences of SEQ ID No: 13 and SEQ ID No: 14 are: CTGGTGCTGAACTGGCCTTT, TCCATCCCCTTCTCTTTGGC; The nucleotide sequences of SEQ ID No: 15 and SEQ ID No: 16 are: TACCAGCAATTATCCTGGCGT, AACTGCGGAAGACAGTGGT; The nucleotide sequences of SEQ ID No: 17 and SEQ ID No: 18 are: AGGCATTGCTTACCGTTTGC, CGAAGGGTGTTGTCGTAGGT; The nucleotide sequences of SEQ ID No: 19 and SEQ ID No: 20 are: ATTCCGTTTGTGCTGGTTGC, ATAGTCGGTGTGGCGAATGG, respectively.

2. The detection method according to claim 1 mcr-1 to mcr-10 Application of primer sets in multiplex PCR method.

3. The use according to claim 2, characterized in that The concentrations of the primer pairs are: For amplification mcr-1 , mcr-2 The final concentration of the primer pair for the gene was 0.02 μM and was used for amplification mcr-3 The final concentration of the primer pair for the gene was 0.03 μM and was used to amplify mcr-4 The final concentration of the primer pair for the gene was 0.025 μM and was used to amplify mcr-5 to mcr-10 The final concentration of primer pairs for the gene was 0.02 μM.

4. The use according to claim 2, characterized in that The PCR amplification reaction program was as follows: 95°C for 10 min; 95°C for 15 s, 62°C for 60 s, and 72°C for 60 s, for a total of 35 cycles; and a final extension at 72°C for 5 min.

5. The use according to any one of claims 2 to 4, characterized in that: The specific steps are: (1) Extract DNA from the bacteria to be tested; (2) Prepare the above 10 sets of primer pairs into solutions with a concentration of 10 μM respectively; (3) The DNA extracted in step (1) was used as a template and the primer pair in step (2) was added to the PCR reaction system. In the 25 μL reaction system, the components and their contents were as follows: 12.5 μL 2× Taq Master Mix, final concentration 0.02 μM for amplification mcr-1 , mcr-2 Primer pairs for the gene, final concentration 0.03 μM for amplification mcr-3 Primer pairs for the gene, final concentration 0.025 μM for amplification mcr-4 Primer pairs for the gene, final concentration 0.02 μM for amplification mcr-5 to mcr-10 The primer pair of the gene, 1 μL of DNA template for amplification, and finally made up to 25 μL with ddH2O; (4) PCR amplification reaction: The reaction program is: 95℃ for 10 min; 95℃ for 15 s, 62℃ for 60 s, 72℃ for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. (5) Electrophoresis detection: The PCR products were electrophoresed in 3% agarose gel at 120 V for 90 min.

6. Use of the primer set for detecting mcr-1 to mcr-10 as claimed in claim 1 in mcr gene detection for non-disease diagnosis and treatment of clinical or environmental bacteria.

Images