Indel molecular marker related to salt tolerance of sesbania cannabina and application of Indel molecular marker

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to an InDel molecular marker related to the salt tolerance of sesbania cannabina and application of the InDel molecular marker. The technical problem to be solved by the invention is to provide a new choice for screening germplasm resources of sesbania cannabina. According to the technical scheme provided by the invention, an InDel molecular marker related to the salt tolerance of sesbania cannabina is developed, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.3. The InDel molecular marker provided by the invention is remarkably related to the survival rate character of a sesbania cannabina plant under a salt stress condition, and can be used for identifying the salt tolerance of a sesbania cannabina material, and the coincidence rate of the molecular marker and a field identification result reaches 100%. Therefore, the marker is simple to operate, high in amplification result accuracy and low in required reagent cost, development of the marker has important significance in understanding a genetic control mechanism in the aspect of salt tolerance of the sesbania cannabina, and scientific theoretical support is provided for genetic improvement of the sesbania cannabina and in-depth study of germplasm resources.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and relates to InDel molecular markers related to salt tolerance of Sesbania spinulosa and applications thereof. Background Art

[0002] Sesbania, widely distributed in tropical and subtropical regions, has outstanding characteristics such as salt-alkali resistance and waterlogging resistance. Sesbania is mainly used as green manure, soil improvement plant or forage crop. Planting it as a green manure has a good nitrogen fixation effect and helps to improve the soil. As a diploid plant, Sesbania spinosa has advantages such as a small genome and a simple genetic background compared to the tetraploid plant Sesbania spinosa, and can more efficiently complete the functional screening and verification of excellent genes. Crop salt tolerance is an important field in agricultural research, especially in the face of global climate change and soil salinization. The cultivation and application of salt-tolerant crops are of great significance to the sustainable development of agriculture. Sesbania spinosa and Sesbania sesbania are both plants of the genus Sesbania and are closely related. Discovering the salt-tolerant genes of Sesbania spinosa and analyzing the salt-tolerant mechanism of Sesbania spinosa are of great significance to improving the salt tolerance of Sesbania spinosa and other leguminous crops.

[0003] Molecular marker-assisted breeding is an important technology in crop breeding. It combines molecular biology and traditional breeding methods. Molecular markers can provide genetic information related to target traits (such as disease resistance, stress tolerance, high-quality traits, etc.), can screen breeding materials at an early stage, shorten the breeding cycle, and thus improve breeding efficiency and accuracy. Molecular markers have been widely used in genetic diversity research, germplasm identification, genetic map construction, and gene localization. InDel markers are base insertion / deletion phenomena, which have the advantages of wide distribution in the genome and easy detection, and are widely used in many important crops. However, there are no reports on the use of InDel markers in the study of salt tolerance in Sesbania sesbania. Summary of the invention

[0004] In order to solve the deficiencies of the prior art, the present invention provides the following technical solutions: In a first aspect, the present invention provides an InDel molecular marker related to the salt tolerance of Sesbania arvensis, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.3.

[0005] The second aspect of the present invention provides a primer pair for amplifying the above-mentioned InDel molecular marker, the nucleotide sequences of which are primers shown as SEQ ID NO.1 and SEQ ID NO.2.

[0006] The third aspect of the present invention provides the use of the above-mentioned InDel molecular marker primer pair in identifying the salt tolerance of Sesbania spinosa.

[0007] The fourth aspect of the present invention provides the use of the above-mentioned InDel molecular marker in identifying the salt tolerance of Sesbania spinulosa.

[0008] A fifth aspect of the present invention provides a method for identifying salt tolerance of Sesbania spinosa, comprising the following steps: a. Extracting genomic DNA from Sesbania spinosa materials; b. Using the DNA obtained in step a as a template, the above primer pair was used to perform PCR amplification to obtain an amplified product, and the amplified fragment was analyzed by 1% agarose gel electrophoresis; c. If a band appears at the 121 bp position of the amplified product in step b in the electrophoresis graph, the detected Sesbania serrata material is salt-tolerant.

[0009] Furthermore, the reaction system of the PCR amplification is: 20 μL, including 1.0 μL genomic DNA, 10.0 μL 2×PCR Mix, 0.4 μL each of upstream and downstream primers, and 8.2 μL ddH2O.

[0010] Furthermore, the PCR amplification program is: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 50°C annealing for 15 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0011] Beneficial effects of the present invention: The InDel molecular marker provided by the invention is significantly correlated with the survival rate trait of Sesbania serrata plants under salt stress conditions, and can be used to identify the salt tolerance of Sesbania serrata materials, and the molecular marker and the field identification result coincidence rate is 100%. The marker operation is simple, the amplification result is highly accurate, and the required reagent cost is low. The development of the marker is of great significance for understanding the genetic control mechanism of Sesbania serrata salt tolerance, and provides scientific theoretical support for the in-depth study of Sesbania serrata genetic improvement and germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 To analyze the genetic relationship of 16 Sesbania spinulosa accessions, including 7 salt-tolerant Sesbania spinulosa accessions and 9 salt-intolerant Sesbania spinulosa accessions; Figure 2 The data are the survival rate of 16 Sesbania spinulosa accessions under salt stress, including 7 salt-tolerant Sesbania spinulosa accessions and 9 salt-intolerant Sesbania spinulosa accessions; Figure 3 The figure is a result of detecting 16 Sesbania spinulosa germplasms using the InDel molecular marker provided by the present invention; wherein, M is Marker (DL2000), numbers 1-7 are salt-tolerant Sesbania spinulosa, and numbers 8-16 are salt-intolerant Sesbania spinulosa. DETAILED DESCRIPTION

[0013] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0014] In the present invention, the spiny sesbania materials can be separated into salt-tolerant materials and salt-intolerant materials ( Figure 2 ) for clustering distinction ( Figure 1 ). The InDel molecular marker of the present invention is designed based on the structural variation site between the genomes of the YS06002 material and the YS06044 material. The variation site is stable and effective in multiple Sesbania serrata germplasms, and has significant selectivity for distinguishing salt-tolerant Sesbania serrata in a population. The present invention provides an important reference for Sesbania serrata breeding and molecular marker-assisted breeding, and has broad application prospects in the molecular breeding of new Sesbania serrata varieties and new strains.

[0015] Example 1: Development and screening of salt-tolerant InDel molecular markers 1. Compare the genomes of salt-tolerant material YS06002 and salt-intolerant material YS06044, screen the InDel site information, and design primers: use Primer 5 and BLAST to design InDel marker primers.

[0016] 2. Based on the InDel sites identified by the genomic data, the sites with insertion and deletion bases greater than or equal to 300 and less than 450, sequencing depth greater than 10, and that can be identified in both genomes were screened, and 53 InDel sites evenly distributed on the six chromosomes of Sesbania serrata that can be designed into primers were randomly screened.

[0017] 3. Extract 150 bp of reference genome base sequence upstream and downstream of the mutation site of salt-tolerant Sesbania sesbania YS06002 to design primers. The primers were designed according to the standard, with an annealing temperature of 50-56°C, a primer length of (20±5) bp, and a PCR product size of 100-600 bp.

[0018] 4. InDel marker screening: The genomic DNA of each Sesbania serrata germplasm material was extracted by the CTAB method. The Sesbania serrata germplasm came from multiple regions, including 16 germplasms (Table 1). PCR amplification and 1% agarose gel electrophoresis analysis were performed using the 16 Sesbania serrata germplasm DNAs as templates to screen InDel markers with obvious polymorphism. Salt-tolerant materials and salt-intolerant materials were selected, and finally an InDel marker with clear and stable bands, good repeatability and high polymorphism was obtained.

[0019] 5. The nucleotide sequence of the InDel molecular marker SEQ ID NO. 3 is as follows: TCTTTTATGTTCAAGTATCATGTTATACGTTGCATTTTCAAGAGTGTTGTCAAAGAGATGTTTAAAATTTTTTATGTGAAAAAAGCAGAAAATTGATTATTTTTTTATTCTGCTTCTTGAA.

[0020] After screening, the primer pairs that can distinguish salt-tolerant and salt-intolerant Sesbania sesbania are as follows: SEQ ID NO.1: 5'-TCTTTTATGTTCAAGTATC-3'; SEQ ID NO.2: 5'-TTCAAGAAGCAGAATAAA-3'.

[0021] Table 1 Information on the sources of 16 Sesbania spinulosa germplasms

[0022] Example 2: Verification of InDel molecular markers related to salt tolerance of Sesbania spinosa Experimental materials: 16 Sesbania spinulosa materials from various regions (Table 1).

[0023] The genomic DNA of 16 samples of Sesbania serrata was extracted respectively, and then PCR amplification was performed with Sesbania serrata genomic DNA as template and InDel-labeled primers (sequence SEQ ID No.1 and sequence SEQ ID No.2). The total volume of the InDel-labeled PCR reaction system was 20 μL, including 1.0 μL genomic DNA (100 ng / μL), 10.0 μL 2 × PCR Mix, 0.4 μL of upstream and downstream primers (10 μmol / L), and 8.2 μL ddH2O. The PCR amplification program was: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 15 s, 50 ℃ annealing for 15 s, 72 ℃ extension for 15 s, 35 cycles; 72 ℃ extension for 5 min.

[0024] Then, the PCR amplification products were detected by 1% agarose gel electrophoresis (1×TAE buffer) and stained with nucleic acid dyes and photographed.

[0025] The genotypes of the 16 Sesbania varieties and germplasms were identified. Figure 3 As shown, when the above primer pair is used for amplification, the one with a band at the 121 bp position in the electrophoresis graph is the salt-tolerant Sesbania truncatula, while the one with a band at 500 bp in the electrophoresis graph is the salt-intolerant Sesbania truncatula.

[0026] The results show that the InDel molecular marker developed in this application can be used to distinguish salt-tolerant materials from salt-intolerant materials according to the band size of the amplified fragment. Therefore, the present invention can be applied to the screening of salt-tolerant materials of Sesbania serrata, thereby improving the accuracy and efficiency of germplasm testing, and laying a certain foundation for the subsequent development of Sesbania serrata breeding.

[0027] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An InDel molecular marker related to salt tolerance of Sesbania spinosa, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.

3.

2. A primer pair for amplifying the InDel molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

3. Use of the primer pair according to claim 2 in identifying the salt tolerance of Sesbania spinosa.

4. Use of the InDel molecular marker according to claim 1 in identifying the salt tolerance of Sesbania spinosa.

5. A method for identifying salt tolerance of Sesbania spinulosa, characterized in that: The following steps are involved: a. Extracting genomic DNA from Sesbania spinosa materials; b. Using the DNA obtained in step a as a template, perform PCR amplification using the primer pair described in claim 2 to obtain an amplified product, and perform 1% agarose gel electrophoresis analysis on the amplified fragment; c. If a band appears at the 121 bp position in the electrophoresis graph of the amplified product of step b, the detected Sesbania sesbania material is salt-tolerant.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 20 μL, including 1.0 μL genomic DNA, 10.0 μL 2×PCR Mix, 0.4 μL each of upstream and downstream primers, and 8.2 μL ddH2O.

7. The method according to claim 5, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 50°C for 15 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

Images