Specific DNA marker for detecting high grain weight allele on rice grain weight QTL qTGW2-35.7 and application

Abstract

The invention provides a specific DNA marker for detecting high grain weight allele on rice grain weight QTL qTGW2-35.7 and application of the specific DNA marker. The name of the DNA marker is Tw35754, an upstream primer sequence of the DNA marker Tw35754 is a nucleotide sequence as shown in SEQ ID No: 1, and a downstream primer sequence of the DNA marker Tw35754 is a nucleotide sequence as shown in SEQ ID No: 2. When the specific DNA marker Tw35754 is used for detecting rice DNA, whether a to-be-detected material carries an IRBB52 high-grain-weight allele on QTL qTGW2-35.7 or not can be quickly and accurately identified, namely whether the grain weight, the grain length, the grain width and the length-width ratio of rice can be increased or not can be identified. The marker provided by the invention is good in specificity and high in accuracy, and has an application prospect in rice grain weight and grain shape variety improvement.

Description

[Technical field]

[0001] The present invention belongs to the field of genetic breeding for improving rice grain weight and grain shape, and specifically relates to a specific DNA marker for detecting a high-grain weight allele on a rice grain weight QTL qTGW2-35.7 and its application, in particular to the identification of a QTL controlling rice grain weight and grain shape, the detection of a high-grain weight allele and the breeding application for improving grain weight and grain shape. [Background technology]

[0002] In recent years, research based on quantitative trait loci (QTLs) has played an increasingly important role in agricultural biotechnology. By studying these QTLs that control important agronomic traits such as pest and disease resistance and seed size, scientists can more accurately locate beneficial variations and apply them to breeding practices, thereby cultivating better quality and more efficient crop varieties.

[0003] Grain weight is one of the key yield traits of rice, which is mainly determined by grain length, grain width and grain thickness. Among them, rice grain length and grain width are not only important indicators for evaluating the appearance quality of rice, but also have an important impact on the milling quality and cooking and eating quality of rice, greatly affecting its market value. Therefore, identifying more new QTLs that control grain weight and grain shape and developing DNA markers that are closely linked to them will be conducive to the variety improvement of rice grain weight and grain shape.

[0004] At present, there are two main strategies commonly used to improve rice yields: one is the traditional hybrid breeding method, which is to screen out new strains with excellent growth performance by repeatedly testing the combination of different parents; although this method is low-cost, it is time-consuming and inefficient. The other is to use molecular marker-assisted selection (MAS), which can quickly identify individuals carrying the desired phenotype at an early stage, greatly shortening the breeding cycle and improving the success rate. However, the traditional MAS method relies on the simultaneous use of multiple polymorphic markers in the linkage disequilibrium region, which not only increases the complexity of the experiment, but also limits its practicality and accuracy.

[0005] Although the above methods can improve rice quality to a certain extent, they still have some limitations. For example, the traditional hybrid breeding method is difficult to meet the market demand for new varieties due to its long time span; and the existing MAS method can significantly speed up the breeding process, but due to the lack of effective single markers, the accuracy in practical applications needs to be improved.

[0006] The patentee identified a new QTL qTGW2-35.7 controlling grain weight from the indica rice variety Teqing and the indica rice variety IRBB52 derived population. The allele from IRBB52 significantly increased 1000-grain weight, grain length, grain width and length-width ratio. Subsequently, based on the results of whole-genome resequencing of Teqing and IRBB52, the patentee developed a molecular marker for detecting the IRBB52 high-grain weight allele on qTGW2-35.7. This marker can be widely used to improve grain weight and grain shape traits in rice varieties. [Summary of the invention]

[0007] The technical problem to be solved by the present invention is to provide a specific DNA marker for detecting high-grain weight alleles on rice grain weight QTL qTGW2-35.7 and its application. The marker can specifically identify the high-grain weight alleles located in the rice qTGW2-35.7 region with high accuracy and can be used for molecular marker-assisted selection breeding of high-grain weight rice varieties.

[0008] The present invention is achieved in that:

[0009] A specific DNA marker for detecting a high-grain weight allele on rice grain weight QTL qTGW2-35.7, the DNA marker is named Tw35754, and the primer sequence of the DNA marker Tw35754 is as follows:

[0010] The upstream primer sequence of Tw35754 is: GGTACATATAAGAAATGATGCCTG; the nucleotide sequence shown in SEQ ID No: 1;

[0011] The downstream primer sequence of Tw35754 is: GCCTCCTCAATTTATACTAGATGA; the nucleotide sequence is shown in SEQ ID No: 2.

[0012] Furthermore, the DNA marker is used to detect the IRBB52 high grain weight allele on the rice grain weight QTL qTGW2-35.7.

[0013] Furthermore, a method for detecting a specific DNA marker for a high-grain weight allele on the rice grain weight QTL qTGW2-35.7 is provided, the steps of which are as follows:

[0014] (1) Using the DNA of the control IRBB52 and the rice material to be tested as templates, adding the DNA marker Tw35754 described in claim 1 and Taq DNA polymerase for PCR amplification, the PCR reaction conditions are: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 15 seconds, 32 cycles, and extension at 72°C for 3 minutes;

[0015] (2) Detect the PCR product by 6% non-denaturing polyacrylamide gel electrophoresis. If the size of the PCR product fragment of the sample to be tested is consistent with IRBB52, it means that the sample to be tested carries the IRBB52 high-grain weight allele on qTGW2-35.7.

[0016] The present invention has the following advantages:

[0017] The present invention provides a specific PCR marker for detecting the IRBB52 high grain weight allele on the rice grain weight QTL qTGW2-35.7, and the marker can accurately identify whether the material to be tested carries the IRBB52 high grain weight allele at the locus, and according to the detection result, it can be judged whether the rice variety can increase the rice grain weight, grain length, grain width and length-width ratio. The marker provided by the present invention has good specificity and high accuracy, which helps to quickly lock the valuable genetic variation source, and simplifies the complex multiple marker combination mode, and only needs a set of primers with good specificity to achieve the ideal typing effect, and has good application prospects in the improvement of rice grain weight and grain shape varieties.

Brief Description of the Drawings

[0018] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0019] Figure 1 This is an electrophoresis detection diagram of DNA of 22 strains of Teqing, IRBB52 and their derivative groups after PCR amplification using the DNA marker Tw35754 used in the embodiment of the present invention; wherein, M: molecular weight control; P1: Teqing; P2: IRBB52; 1-22: strains to be tested. [Specific implementation method]

[0020] The following will be combined with the attached Figure 1 The technical scheme of the present invention is clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0021] Example: Detection of DNA markers specific for the high-grain weight allele of IRBB52 at the rice grain shape QTL qTGW2-35.7

[0022] For the QTL qTGW2-35.7 positioning interval, based on the whole genome resequencing results of Teqing and IRBB52, the sequences of the two were compared, the differential sites were screened, and primers were designed using Oligo7 to develop an InDel marker Tw35754 that can be used to detect the specific fragment of the IRBB52 high grain weight allele on qTGW2-35.7. The primer sequence of the DNA marker Tw35754 is as follows:

[0023] The upstream primer sequence of Tw35754 is: GGTACATATAAGAAATGATGCCTG; the nucleotide sequence shown in SEQ ID No: 1;

[0024] The downstream primer sequence of Tw35754 is: GCCTCCTCAATTTATACTAGATGA; the nucleotide sequence is shown in SEQ ID No: 2.

[0025] To determine whether this DNA marker Tw35754 is specific between Teqing and IRBB52, and whether the near-isogenic lines derived from the Teqing / IRBB52 combination and isolated at qTGW2-35.7 can accurately identify the IRBB52 high-grain weight allele, the following specific methods were used for detection:

[0026] (1) Rice material planting: Based on the preliminary positioning results, near-isogenic lines that were separated at the qTGW2-35.7 locus were selected from the Teqing / IRBB52 derivative population and planted in the Shaxian Experimental Base of Fujian Academy of Agricultural Sciences in 2019. A randomized block design was used with two replicates and eight plants in one row per line.

[0027] (2) Characteristic investigation: At maturity, the middle 6 plants of each strain were harvested, dried and threshed, and the grains were poured into a 5 mol / L sodium chloride solution. The shriveled and unfilled grains floating on the solution were removed with a colander; the full grains were taken out and rinsed with clean water; the full grains were placed in a 37°C oven and dried until the moisture content of the grains was about 10%-11% (about 16 hours), and the full grains were taken out; 600 full grains were selected and divided into 2 technical replicates, and the weight was taken. The thousand-grain weight, grain length, grain width and length-width ratio were measured using a Wanshen SC-G automatic seed analyzer. The data error between the two technical replicates was no more than 2.0%.

[0028] (3) DNA marker detection: 22 strains were used as test materials, and their genomic DNA was extracted using the microtiter method. The extraction method is as follows: take leaves from the middle 6 individual plants of each strain, pick 0.5 cm long leaves respectively, mix them, put them in a 2 ml centrifuge tube, add 400 μl of DNA extraction solution to the centrifuge tube, put in a small steel ball, cover the lid tightly, and use a tissue grinder to grind the front and back sides for 30 seconds each at a frequency of 25 Hz; add 400 μl of chloroform extraction solution in a fume hood, cover the lid tightly, mix it upside down, and centrifuge it at 11,000 rpm for 1 minute; slowly pipette 300 μl of supernatant into a 1.5 ml centrifuge tube, add 600 μl of pre-cooled anhydrous ethanol to the centrifuge tube, cover the lid tightly, mix it upside down; centrifuge at 11,000 rpm for 3 minutes; discard the supernatant, add 70% ethanol to wash the precipitate twice, discard the supernatant, turn the 1.5 ml centrifuge tube upside down on a clean paper, and dry it naturally; add 100 μl of 1 / 10×TE buffer. Then, PCR amplification was performed on Teqing, IRBB52 and 26 strains to be tested using the specific marker Tw35754. The amplification program was as follows: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 15 seconds, 32 cycles, and extension at 72°C for 3 minutes. Finally, PCR products were detected by 6% non-denaturing polyacrylamide gel electrophoresis.

[0029] like Figure 1 As shown in the figure, at the Tw35754 locus, samples 1, 3, 4, 6, 9, 11, 14, 15, 17, 18, 21, and 22 were IRBB52 homozygous, indicating that these strains carried the IRBB52 high-grain weight allele on qTGW2-35.7; samples 2, 5, 7, 8, 10, 12, 13, 16, 19, and 20 were Teqing homozygous, and these strains did not carry the IRBB52 allele. Through variance analysis, there were extremely significant differences in thousand-grain weight, grain length, grain width, and length-to-width ratio between the two allele strains, and the P values ​​were all less than 0.0001. The strains carrying the IRBB52 allele on qTGW2-35.7 increased the thousand-grain weight, grain length, grain width, and length-to-width ratio by 0.30 g, 0.027 mm, 0.025 mm, and 0.011, respectively. As shown in Table 1 and Table 2, the following Table 1 and Table 2 are the SAS calculation results of the near-isogenic line:

[0030] Table 1

[0031] genotype Thousand-grain weight Grain length Grain width Aspect Ratio 1 (homozygous type) 25.56g 5.320mm 5.352mm 2.786 2 (homozygous IRBB52) 26.17g 5.375mm 5.401mm 2.809

[0032] Table 2

[0033] Thousand-grain weight Grain length Grain width Aspect Ratio A 0.30g 0.027mm 0.025mm 0.011 P <.0001 <.0001 <.0001 <.0001 SS 12.84 0.10 0.07 0.018 SSl(g) 12.27 0.12 0.07 0.05 SSe 16.01 0.07 0.09 0.03 SSp 41.12 0.30 0.23 0.10 <![CDATA[R 2 ]]> 31.21％ 35.22％ 30.24％ 17.89％

[0034] The above results show that the DNA marker Tw35754 provided by the present invention has high reliability in detecting the IRBB52 high-grain weight allele on rice grain shape qTGW2-35.7, and can be applied to molecular marker-assisted selection breeding of the IRBB52 high-grain weight allele on rice grain shape QTL qTGW2-35.7.

[0035] Although the specific implementation modes of the present invention are described above, those skilled in the art should understand that the specific implementation modes described are only illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A specific DNA marker for detecting high grain weight alleles on the rice grain weight QTL qTGW2-35.7, characterized in that: The DNA marker name is Tw35754, and the primer sequence of the DNA marker Tw35754 is as follows: The upstream primer sequence of Tw35754 is: GGTACATATAAGAAATGATGCCTG; the nucleotide sequence shown in SEQ ID No: 1; The downstream primer sequence of Tw35754 is: GCCTCCTCAATTTATACTAGATGA; the nucleotide sequence is shown in SEQ ID No:

2.

2. An application of a specific DNA marker for detecting a high-grain weight allele on the rice grain weight QTL qTGW2-35.7, characterized in that: Based on the use of the DNA marker described in claim 1 in detecting the IRBB52 high grain weight allele on the rice grain weight QTL qTGW2-35.

7.

3. A method for detecting a specific DNA marker for a high-grain weight allele on a rice grain weight QTL qTGW2-35.7, characterized in that: The detection method steps are as follows: (1) Using the DNA of the control IRBB52 and the rice material to be tested as templates, adding the DNA marker Tw35754 described in claim 1 and Taq DNA polymerase for PCR amplification, the PCR reaction conditions are: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 15 seconds, 32 cycles, and extension at 72°C for 3 minutes; (2) Detect the PCR product by 6% non-denaturing polyacrylamide gel electrophoresis. If the size of the PCR product fragment of the sample to be tested is consistent with IRBB52, it means that the sample to be tested carries the IRBB52 high-grain weight allele on qTGW2-35.7.

Images