DNA molecular marker for identifying polygonatum odoratum in south of Jiangsan and application thereof

Abstract

The invention relates to the technical field of molecular markers, in particular to a DNA molecular marker of polygonatum odoratum and application of the DNA molecular marker. The DNA molecular marker disclosed by the invention is shown as SEQ ID NO. 1. The DNA molecular marker can be used for identifying polygonatum odoratum in Jiangnan, and specifically comprises the following steps: extracting total DNA from a sample, then carrying out high-throughput sequencing, comparing sequencing reads to the molecular marker, and if the sequencing reads can completely cover the molecular marker, judging that the species of the sample to be detected is the corresponding species.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to DNA molecular markers of plants of the genus Polygonatum, and specifically to DNA molecular markers for identifying Polygonatum odoratum. Background Art

[0002] The Jiangnan Polygonatum (Polygonatum kiangnanense T. Xu, SYYi & XWSong) is mainly produced in the mountainous areas of Anhui, Hubei, Zhejiang and other provinces. It is a recently identified new species of the genus Polygonatum. The aboveground part of this species is similar to that of Polygonatum odoratum (Mill.) Druce, with ridges on the stem. The aboveground part of Jiangnan Polygonatum is taller than that of Polygonatum odoratum. The flowers of Jiangnan Polygonatum are yellow-green, while those of Polygonatum odoratum are yellow-green to white. The perianth tube of the flowers of Jiangnan Polygonatum is narrow in the middle, while that of Polygonatum odoratum is straight. These small features can distinguish them, but the underground rhizome of Jiangnan Polygonatum is exactly the same as that of Polygonatum (both are thin cylindrical). The dried rhizome is difficult to distinguish from the properties of the medicine. Jiangnan Polygonatum has always been used as a medicine. Therefore, it is necessary to find a simple and efficient identification method to distinguish the two. Summary of the invention

[0003] The present invention mainly aims at the above technical problems, provides a simple molecular marker method to realize the identification of Jiangnan Polygonatum, and specifically provides a DNA molecular marker for identifying Jiangnan Polygonatum and its application.

[0004] Specifically, the present invention provides the following technical solutions: In a first aspect, the present invention provides a molecular marker of Polygonatum odoratum, the sequence of which is shown as SEQ ID NO.1.

[0005] The present invention utilizes a high-throughput sequencing method to assemble contigs sequences from the whole genome sequence of Polygonatum odoratum, and compares the sequences with those of Polygonatum sibiricum species published on NCBI, and finds that one sequence contains an Indel mutation site, which is suitable as a molecular marker for identifying Polygonatum odoratum.

[0006] In another aspect, the present invention provides primers for amplifying the above-mentioned molecular markers.

[0007] In another aspect, the present invention provides a method for identifying Polygonatum odoratum, comprising: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) aligning the reads in step 2) to the aforementioned molecular markers; (4) The species of the sample to be tested is determined based on the coverage of the sequencing reads on the molecular markers. If SEQ ID NO: 1 is completely covered without any gaps, the species of the sample to be tested is determined to include Polygonatum odoratum.

[0008] In another aspect, the present invention provides another method for identifying Polygonatum odoratum, comprising: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) The reads in step 2 are assembled. If the assembled contigs contain the aforementioned molecular markers, it is determined that the species of the sample to be tested includes Polygonatum odoratum.

[0009] In another aspect, the present invention provides another method for identifying Polygonatum odoratum, comprising: (1) Extracting DNA from the plant to be identified; (2) performing PCR amplification using any pair of primers described in claim 2 or 3; (3) Sequencing the PCR product in step 2), and if the sequencing result is consistent with any molecular marker sequence described in claim 1, it is determined that the species of the sample to be tested includes Polygonatum odoratum.

[0010] Preferably, the sequencing in the aforementioned method is first-generation sequencing, second-generation sequencing or third-generation sequencing.

[0011] Preferably, reads are aligned using any of Geneious, Bowtie, Tophat, bwa or HISAT software.

[0012] Preferably, in the aforementioned method, if the sample to be tested is a single sample, the sample to be tested is directly determined to be Polygonatum odoratum.

[0013] On the other hand, another object of the present invention is to provide any of the following applications of the above-mentioned molecular markers, primers or methods: (1) Application in identification of Polygonatum odoratum; (2) Application in identification, improvement or molecular marker-assisted breeding of Polygonatum germplasm resources; (3) Application in the screening of hybrid breeding of Polygonatum sibiricum or in the creation of different Polygonatum sibiricum varieties; (4) Application in the DNA fingerprint database of Polygonatum spp.; (5) Application in the quality inspection of Polygonatum sibiricum seedlings.

[0014] The single DNA molecular marker of the present invention can effectively distinguish whether the tested variety is Jiangnan Polygonatum, providing a guarantee for the identification, planting, resource utilization and breeding of Jiangnan Polygonatum. It is also of great significance for the classification, phylogeny, and phylogenetic research of Polygonatum species, as well as the protection and utilization of Polygonatum resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The method for identifying Polygonatum odoratum and its beneficial effects of the present invention are described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0016] Figure 1 It is a comparison of the DNA molecular marker sequence SEQ ID NO.1 of Polygonatum odoratum and the known homologous sequences of Polygonatum sibiricum.

[0017] Figure 2 It is the comparison result of the DNA molecular marker sequence SEQ ID NO.1 of Polygonatum odoratum in the nr / nt database.

[0018] Figure 3 It is the alignment result of DNA sequencing reads containing Polygonatum odoratum on SEQ ID NO.1.

[0019] Figure 4 It is the alignment result of DNA sequencing reads that do not contain Polygonatum odoratum on SEQ ID NO.1. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Unless otherwise defined, all technical and scientific terms used in this application have the same meanings as commonly understood by those of ordinary skill in the art to which this application belongs. The Polygonatum plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0022] Example 1 Development of Polygonatum odoratum-specific molecular markers Polygonatum jiangnanensis Polygonatum kiangnanenseT. Xu, SYYi & XWSong) is mainly produced in the mountainous areas of Anhui Province, Hubei Province, Zhejiang Province, etc. It is a new species of Polygonatum recently identified. The above-ground part of this species is similar to Polygonatum odoratum (Mill.) Druce, and the underground rhizome is even more difficult to distinguish. Other Polygonatum species distributed in the region include Polygonatum odoratum (Mill.), Polygonatum odoratum (Mill.), Polygonatum odoratum (Mill.), and Polygonatum odoratum (Mill.). The Jiangnan Polygonatum of the present invention is collected from the Dabie Mountain area of ​​Anhui Province.

[0023] The specific molecular marker of Polygonatum odoratum, i.e., DNA molecular marker, is obtained by the following steps: 1) Collect leaves of Polygonatum odoratum; 2) Extract total DNA from leaves of Polygonatum odoratum; 3) Performing second-generation high-throughput sequencing on the above total DNA to obtain sequencing reads; 4) Assemble sequencing reads into contigs.

[0024] 5) Compare the nucleotide sequences with those of Polygonatum species on Genbank to screen for specific marker sites.

[0025] As a result, a fragment was obtained as shown in SEQ ID NO. 1, which had multiple polymorphic sites with the homologous nucleotide sequence of the genome of known Polygonatum species.

[0026] SEQ ID NO.1: 5'- TCTCGTCGTTAATTAATTTGGAAAACTTACTTATCATTCAGGGAGCTATACCCAATATCTTATGAAAACAAGATATTGGGTATGACTCCTTCAACGATTCTTAATACATATACATTAAGACGGAAATCTTATCCA TTTATAGATGGAACTTCAAGAGCAGCTAGGTCTAGAGGAAAGTTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGGTTGATGATATCAGCCCAAGTGTTAATAACACGGCCCTGACTA-3' The above sequences of Jiangnan Polygonatum were further compared with the homologous sequences of known Polygonatum species. The results showed that Jiangnan Polygonatum had significant differences with the known Polygonatum species ( Figure 1 ).

[0027] Example 2 Sequence comparison of Polygonatum odoratum-specific molecular markers and closely related species In order to determine whether the molecular markers of the present invention are species specific, the molecular markers of the present invention were compared using the blast program of Geneious Prime, selecting the nr / nt library, not limiting the species, and keeping the other parameters as default. Figure 2 As shown, it was found that the closely related species of the molecular markers of the present invention in the nr / nt library of NCBI were all plants of the genus Polygonatum. Figure 4 The highest coverage of SEQ ID NO.1 compared with known Polygonatum species is 85.39%. It can be seen that the molecular markers of the present invention are different from all known Polygonatum species and have strong specificity.

[0028] Example 3 Identification method of Polygonatum odoratum 1) Collect leaves of Polygonatum sibiricum plants as samples to be tested; 2) Extract the total DNA of the sample to be tested; 3) Perform second-generation high-throughput sequencing on the total DNA of the above two samples to obtain sequencing reads; The sequencing reads were aligned to SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 using Geneious software with default parameters (low sensitivity).

[0029] 4) The species of the sample to be tested is determined according to the coverage of the sequencing reads on the DNA molecular markers. If any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQID NO:3 can be completely covered, and a consensus sequence that is completely consistent with any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQID NO:3 can be generated, then the species of the sample to be tested is determined to include Polygonatum odoratum.

[0030] Results Figures 3 - 4 As shown, the sequencing reads of the Jiangnan Polygonatum sample are mixed with the sequencing reads of the Jiangnan Polygonatum of the present invention and other known sequencing reads of the genus Polygonatum published on NCBI. The second-generation sequencing species of the genus Polygonatum published by NCBI include Polygonatum acuminatifolium, Polygonatum arisanense, Polygonatum biflorum, Polygonatum binatifolium, Polygonatum campanulatum, Polygonatum caulialatum, Polygonatum cirrhifolium, Polygonatum curvistylum, Polygonatum cyrtonema, Polygonatum cyrtonema var. gutianshanicum, Polygonatum falcatum, Polygonatum filipes, Polygonatum franchetii, Polygonatum gracile, Polygonatum griffithii, Polygonatum hookeri, Polygonatum humile, Polygonatum hunanense, Polygonatum inflatum, Polygonatum infundiflorum, Polygonatum involucratum, Polygonatum kingianum, Polygonatum macropodum, Polygonatum multiflorum, Polygonatum nodosum, Polygonatum odoratum, Polygonatum oppositifolium, Polygonatum prattii, Polygonatum pubescens, Polygonatum punctatum, Polygonatum roseum, Polygonatum sibiricum, Polygonatum sinopubescens, Polygonatum sp. 'Guizhou', Polygonatum stenophyllum, Polygonatum tessellatum, Polygonatum verticillatum, Polygonatum wardii, Polygonatum zanlanscianense, ) completely covered SEQ ID NO:1 and generated a consensus sequence that was completely consistent with the reference sequence. Although the sequencing reads without the Jiangnan Polygonatum sample (containing only other known Polygonatum sequencing reads including Polygonatum published on NCBI) covered SEQ ID NO:1, the generated consensus sequence was inconsistent with SEQ ID NO.1.

[0031] In summary, firstly, the present invention is a powerful supplement to traditional species identification, and the sample identification process can be automated and standardized, breaking through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time. Secondly, the present invention can distinguish between Jiangnan Polygonatum and related species, and can stably and accurately identify Jiangnan Polygonatum and related species at a higher resolution level. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogenetic research of Polygonatum species, as well as the protection and utilization of Polygonatum resources.

[0032] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A DNA molecular marker for identifying Polygonatum odoratum, characterized in that: The sequence of the DNA molecular marker is shown in any sequence of SEQ ID NO.

1.

2. Primers for amplifying the DNA molecule marker according to claim 1.

3. A method for identifying Polygonatum odoratum, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) aligning the reads described in step 2) to the molecular marker described in claim 1; (4) The species of the sample to be tested is determined based on the coverage of the sequencing reads on the DNA molecular markers. If SEQ ID NO:1 can be completely covered and a consensus sequence that is completely consistent with the sequence of SEQ ID NO:1 can be generated, the species of the sample to be tested is determined to include Polygonatum odoratum.

4. A method for identifying Polygonatum odoratum, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) The reads in step 2 are assembled. If the assembled contigs contain sequences that are completely identical to the molecular markers described in claim 1, it is determined that the species of the sample to be tested includes Polygonatum odoratum.

5. A method for identifying Polygonatum odoratum, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) PCR amplification using primers; (3) Sequencing the PCR product in step 2). If the sequencing result is consistent with the molecular marker sequence described in claim 1, it is determined that the species of the sample to be tested includes Polygonatum odoratum.

6. The method according to any one of claims 3 to 5, characterized in that The sequencing is first-generation sequencing, second-generation sequencing or third-generation sequencing.

7. The method according to claim 3, characterized in that In step 3), use Geneious, Bowtie, Tophat, bwa or HISAT to align reads.

8. Any of the following uses of the DNA molecular marker according to claim 1, the primer according to claim 2, or the method according to any one of claims 3 to 7: (1) Application in identification of Polygonatum odoratum; (2) Application in identification, improvement or molecular marker-assisted breeding of Polygonatum odoratum germplasm resources in Jiangnan; (3) Application in screening or creating different varieties of Polygonatum odoratum; (4) Application in constructing a DNA fingerprint database of Polygonatum odoratum; (5) Application in the quality inspection of Polygonatum odoratum seedlings.

Images