Primer combination for detecting wild abortion type three lines of rice and application of primer combination

Abstract

The invention discloses a primer combination for detecting the purity of rice wild abortion type three lines (a sterile line, a restorer line and a maintainer line) and hybrid seeds and application of the primer combination, the primer combination comprises a specific primer mixture for identifying a wild abortion sterile gene WA352, a major restorer gene Rf4 and a reference gene Actin, and after the proportion of the six primer combinations is adjusted, the specific primer mixture is added into the rice wild abortion type three lines (the sterile line, the restorer line and the maintainer line); the four rice materials of the sterile line, the restorer line, the maintainer line and the hybrid of the wild abortion type three line can be distinguished through single-hole amplification. The specific primer combination is high in amplification efficiency and stable in detection result, genotypes can be directly interpreted through agarose, the detection method is easy and convenient to operate, extremely low in cost and environmentally friendly, and the blank that three-line hybrid purity detection lacks functional gene markers is filled.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer combination for detecting three rice wild abortion lines (sterile line, recovery line, maintenance line) and hybrid purity and an application thereof. Background Art

[0002] In the 1970s, a major invention in my country's agricultural science and technology community, three-line hybrid rice, achieved a leap in rice yield and shortened the breeding cycle by combining two rice varieties with different genetic compositions (sterile line and restorer line) to produce offspring (F1). The use of this hybrid advantage has made a huge contribution to food security in my country and even the world.

[0003] The interaction system between cytoplasmic male sterility (CMS) gene and restorer gene (Rf) is a key factor in the breeding and production application of three-line hybrid rice, and is also the basis for the utilization of hybrid advantages. There are three main CMS systems used in three-line hybrid rice breeding: wild abortion type, red lotus type and Baotai type, among which the wild abortion type is widely produced and applied in my country. After long-term research, scientists have revealed that the WA352 protein in the wild abortion type sterile line interacts with the mitochondrial localization protein COX11 expressed by nuclear genes, induces abnormal degradation of the anther tapetum, and ultimately leads to pollen abortion. The restorer gene Rf4 encodes a 782-amino acid pentapeptide repeat (PPR) protein, which restores the fertility of CMS-WA by mediating the degradation of WA352 gene mRNA. At present, rice is one of the main food crops in my country, and the emergence of hybrid rice has greatly increased rice yield. However, in the long-term breeding process, the purity and authenticity of hybrids have been reduced due to artificial doping and other reasons. Therefore, it is particularly important to identify the purity of hybrids during breeding. It has been reported that SSR markers and SCAR markers can be used to detect the wild abortion gene of WA352, but the detection of the Rf4 restoration gene requires multiple marker linkage analysis, which requires more experimental steps and technical details, increasing the complexity and cost of the experiment, and the determination method is more cumbersome.

[0004] Therefore, the development of simple, efficient and low-cost markers for functional genes in purity detection of three-line hybrids is of great significance for the application and development of hybrid rice. Summary of the invention

[0005] Based on the above technical problems existing in the prior art, one of the purposes of the present invention is to provide a primer combination for detecting the purity of three rice wild abortion lines (sterile line, restorer line, maintainer line) and hybrids. The six primer combinations are used to detect the rice wild abortion sterile gene WA352, the major effect restorer gene Rf4 and the internal reference gene Actin, and can simultaneously detect and distinguish the parents and hybrids of wild abortion in a single lane. The sequences of the forward primer and the reverse primer of the primer pair WA352-2 for detecting the WA352 gene are as shown in SEQ ID NO.1 and SEQ ID NO.2; the sequences of the forward primer and the reverse primer of the primer pair Rf4-3 for detecting the Rf4 gene are as shown in SEQ ID NO.3 and SEQ ID NO.4; the sequences of the forward primer and the reverse primer of the primer pair Actin-3 for detecting the internal reference gene are as shown in SEQ ID NO.5 and SEQ ID NO.6. The nucleotide sequences are as follows:

[0006] SEQ ID NO.1:GAGGATTTTGCCTCCCCTCC

[0007] SEQ ID NO.2: GGTGCAACCTAGCCAAGTCT

[0008] SEQ ID NO.3: CTTTAGTTCAATAATTAGCGATCT

[0009] SEQ ID NO.4:ACTAACGCGTCTTCCATCCT

[0010] SEQ ID NO.5: GAGGAACATCCAATTTTGCTGA

[0011] SEQ ID NO.6: CACATACATTGCTGGTGCATT

[0012] On the one hand, the present invention provides a primer combination for detecting three rice wild abortion lines (sterile line, restorer line, maintainer line) and the purity of hybrids, the primer combination comprising a primer pair WA352-2 for detecting the WA352 gene, a primer pair Rf4-3 for detecting the Rf4 gene, and a primer pair Actin-3 for detecting an internal reference gene; the sequences of the forward primer and the reverse primer of the primer pair WA352-2 are shown in SEQ ID No.1 and SEQ ID No.2; the sequences of the forward primer and the reverse primer of the primer pair Rf4-3 are shown in SEQ ID No.3 and SEQ ID No.4; the sequences of the forward primer and the reverse primer of the primer pair Actin-3 are shown in SEQ ID No.5 and SEQ ID No.6.

[0013] Furthermore, in the primer combination, the concentration ratio of the primer pair WA352-2, Rf4-3 and Actin-3 is 1:11:3. That is, the primer concentration ratio of SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 is 1:1:11:11:3:3.

[0014] Under the above dosage ratio, the amplified bands have uniform brightness and no mixed bands.

[0015] On the other hand, the present invention also provides a method for identifying the purity of three-line and hybrid rice wild abortion types, the method comprising the following steps:

[0016] (1) Extracting genomic DNA from rice to be tested;

[0017] (2) using the above primer combination for detecting the three wild abortion lines (sterile line, restorer line, maintainer line) and the purity of hybrids of rice, and using the genomic DNA of the rice to be tested as a template, to perform PCR amplification;

[0018] (3) The amplified products were detected in 2% agarose gel, and the genotypes of the wild abortion gene WA352, the major effect restoration gene Rf4 and the internal reference gene Actin were determined based on the size and quantity of the amplified products.

[0019] In one embodiment, the reaction system for PCR amplification is: DNA polymerase buffer 2-10 μL, MgCl2 solution (25 mM) 0.6-3.2 μL, dNTPs 0.4-2.0 μL, DNA polymerase 0.05-1.0 μL, mixed primer set 0.5-2 μL, genomic DNA 1.2-4.0 μL, ddH2O.

[0020] Preferably, the reaction system is a 10 μL reaction system, 2 μL DNA polymerase buffer, 0.6 μL MgCl2 solution (25 mM), 0.8 μL dNTPs, 0.05 μL DNA polymerase, 0.8 μL mixed primer set, 1.2 μL genomic DNA, and ddH2O filling.

[0021] In one embodiment, the PCR reaction program of the PCR amplification is pre-denaturation at 94°C to 98°C for 2 to 10 min; denaturation at 94°C to 98°C for 30s to 60s, annealing at 42°C to 65°C for 30s to 60s, extension at 72°C for 30s to 60s, 28 to 35 cycles; extension at 72°C for 3 to 10 min; cooling at 12°C for 5 to 20 min.

[0022] Preferably, the PCR reaction procedure is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 34 cycles; extension at 72°C for 7 min; cooling at 12°C for 20 min.

[0023] The method for determining the wild abortion type three-line parents and hybrids is as follows: if the amplified product is two bands of 604bp and 108bp, it is determined that the rice sample only carries the WA352 gene and is a wild abortion sterile line; if the amplified product is two bands of 267bp and 108bp, it is determined that the rice sample only carries the functional Rf4 restoration gene and is a wild abortion restoration line; if the amplified product is a single band of 108bp, it is determined that the rice sample does not carry the WA352 and Rf4 genes and is a wild abortion maintainer line; if the amplified product is three bands of 604bp, 267bp and 108bp, it is determined that the rice sample carries both the WA352 and Rf4 genes and is a wild abortion hybrid.

[0024] On the other hand, the present invention also provides a kit for detecting the purity of three-line and hybrid rice with wild abortion type, and the kit comprises the above primer combination.

[0025] On the other hand, the present invention also provides the use of the above primer combination in preparing a kit for detecting the purity of three-line and hybrid rice wild abortion types.

[0026] On the other hand, the present invention also provides the use of the primer combination in breeding new three-line wild abortive rice varieties.

[0027] On the other hand, the present invention also provides the use of the primer combination in detecting the purity of three rice wild abortion lines and hybrids.

[0028] The present invention can realize the simultaneous detection of the genotypes of the wild abortion gene WA352, the major effect restoration gene Rf4 and the internal reference gene in a single swimming lane through the 6 specific primers screened out. 28 wild abortion type three-line parents and hybrid materials in rice were identified, and it was found that the genotypes of the wild abortion type three-line parents and hybrids can be accurately distinguished. The detection method of the present invention is low in cost, easy to operate, green and environmentally friendly, and different band types are clearly distinguished in agarose gel without mixed bands. The detection method of the present invention can play a role in molecular assisted selection in the current wild abortion type three-line hybrid rice breeding process, can effectively shorten the breeding period, and can make up for the lack of functional markers in the purity detection of wild abortion type hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 : The molecular marker preliminary screening results of each genotype of WA352, Rf4 and Actin in Example 1. Among them, DNA number 1, sterile line; 2, restorer line; 3, hybrid; 4, maintainer line.

[0030] Figure 2 : Optimization results of primer combinations of different ratios in Example 2.

[0031] Among them, DNA number 1, sterile line; 2, restorer line; 3, hybrid; 4, maintainer line.

[0032] Figure 3 : The genotype detection results of the wild abortive parents and hybrids in Example 2.

[0033] Figure 4 : The test results of 28 rice materials WA352 and Rf4 genotype in Example 3.

[0034] Figure 5 : Information related to 28 rice germplasm resources in Example 3. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the examples. The following description is only a preferred embodiment of the present invention and is not intended to limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. The materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art unless otherwise specified, and can be obtained through commercial channels.

[0036] Any simple modification or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention shall fall within the protection scope of the present invention.

[0037] Example 1: Development and screening of a primer combination for detecting rice wild abortion type (sterile line, restorer line, maintainer line) and hybrid purity:

[0038] The applicant based on the literature Luo D, Xu H, Liu Z, Guo J, Li H, Chen L, Fang C, Zhang Q, BaiM, Yao N, Wu H, Wu H, Ji C, Zheng H, Chen Y, Ye S, Li X, Zhao X, Li R, LiuYG. Adetrimental mitochondrial-nuclear interaction causes cytoplasmic malesterility in rice. Nat Genet.2013May;45(5):573-7 and Zhao Z, Ding Z, Huang J, MengH, Zhang Z, Gou X, Tang H, Xie 13; 14(1):7333 describes that the WA352 gene is a gene specific to the wild-type sterile line, the Rf4 gene has multiple haplotypes, and the functional Rf4 has a specific sequence in the genome. A primer set is designed for the specific sequence.

[0039] Primers WA352-1, WA352-2 and WA352-3 are specific amplification primers designed based on the non-homologous region of the wild abortion sterility gene WA352.

[0040] Primers Rf4-1, Rf4-2, and Rf4-3 are amplification primers designed based on the specific sequence existing in the genome of the functional restoration gene Rf4.

[0041] Primers Actin-1, Actin-2, and Actin-3 are specific amplification primers designed based on the conservative region of the internal reference gene Actin. The nucleotide sequences of the detection primers are as follows (Table 1):

[0042] Table 1 Designed primer sequence information

[0043]

[0044]

[0045] The target gene was amplified using the above primers. The results showed that different primers had different effects on the target gene amplification, and some primers produced false positive amplification results. Figure 1 As shown, according to different amplification effects, the specific amplification primers WA352-2, Rf4-3, and Actin-3 were finally selected as the optimal combination after primer mixing for subsequent primer combination experiments.

[0046] Example 2: A method for detecting the purity of wild-type three-line and hybrid rice varieties

[0047] In this embodiment, the applicant optimized the PCR amplification reaction conditions, reaction system and optimal primer combination ratio.

[0048] 1. Optimization of reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 34 cycles; extension at 72°C for 7 min; cooling at 12°C for 20 min.

[0049] 2. Reaction system optimization: 10 μL reaction system, DNA polymerase buffer 2 μL, MgCl2 solution (25 mM) 0.6 μL, dNTPs 0.8 μL, DNA polymerase 0.05 μL, mixed primer set 0.8 μL, genomic DNA 1.2 μL, ddH2O filler.

[0050] 3. Primer combination: According to the competitive amplification between primers and the brightness of the band, the amplification effect is best after mixing WA352-2, Rf4-3 and Actin-3 primers. The concentration ratio of primers WA352-2, Rf4-3 and Actin-3 is 1:11:3. The band patterns of primer combinations with different ratios are shown in Figure 2 .like Figure 2 As shown, when the above primers were mixed at different concentration ratios for one-tube amplification, the mixed amplification results at different ratios showed great differences. For example, when WA352-2:Rf4-3:Actin-3 was mixed at concentrations of 1:10:3, 1:6:2, and 2:15:7, mixed bands appeared when amplifying the restorer line; when WA352-2:Rf4-3:Actin-3 was mixed at a concentration of 1:10:4, some bands were not obvious when amplifying the restorer line and the hybrid; when WA352-2:Rf4-3:Actin-3 was mixed at a concentration of 2:13:4, some mixed bands appeared when amplifying the maintainer line. Only when WA352-2:Rf4-3:Actin-3 was mixed at a concentration ratio of 1:11:3, the amplification effect was the best, the bands were obvious, and there were no mixed bands.

[0051] 4. Belt type judgment

[0052] If the amplified product is two bands of 604bp and 108bp, it is determined that the rice sample only carries the WA352 gene and is a wild-aborted sterile line; if the amplified product is two bands of 267bp and 108bp, it is determined that the rice sample only carries the functional Rf4 restoration gene and is a wild-aborted restoration line; if the amplified product is a single band of 108bp, it is determined that the rice sample does not carry the WA352 and Rf4 genes and is a wild-aborted maintenance line; if the amplified product is three bands of 604bp, 267bp and 108bp, it is determined that the rice sample carries both the WA352 and Rf4 genes and is a wild-aborted hybrid. For specific band patterns, see Figure 3 .

[0053] Example 3: Screening and verification of the detection primers in 28 rice materials

[0054] In this example, the applicant verified the practicability of the detection primers, using the reaction conditions of Example 2 and the optimal primer concentration ratio (WA352-2: Rf4-3: Actin-3 = 1: 11: 3), and using 28 wild-type rice and conventional rice materials for verification. Figure 4 As shown in Figure 1, the detection primer combination can clearly distinguish the genotypes of WA352 and Rf4 in different rice varieties. The experimental data show that the detection results of 28 rice samples are accurate and reliable, and are completely consistent with the expected results, indicating that the detection method of the present invention is fully applicable to the purity detection of three-line parents and hybrids of wild rice abortion type. Figure 4 and Figure 5 .

[0055] Although the present invention has been described in detail above with the help of general explanations and specific implementation examples, based on the structure and principles of the present invention, those skilled in the art can easily implement certain changes or optimization measures. Therefore, as long as such changes or optimizations do not deviate from the core spirit and main purpose of the present invention, they should be included in the scope of protection of the rights claimed by the present invention.

Claims

1. A primer combination for detecting the purity of three-line and hybrid rice wild abortion types, characterized in that: The primer combination includes a primer pair WA352-2 for detecting the WA352 gene, a primer pair Rf4-3 for detecting the Rf4 gene, and a primer pair Actin-3 for detecting the internal reference gene; the sequences of the forward primer and the reverse primer of the primer pair WA352-2 are shown as SEQ ID No.1 and SEQ ID No.2; the sequences of the forward primer and the reverse primer of the primer pair Rf4-3 are shown as SEQ ID No.3 and SEQ ID No.4; the sequences of the forward primer and the reverse primer of the primer pair Actin-3 are shown as SEQ ID No.5 and SEQ ID No.

6.

2. The primer combination according to claim 1, characterized in that The concentration ratio of the primer pair WA352-2, Rf4-3 and Actin-3 is 1:11:

3.

3. A method for detecting the purity of three-line and hybrid rice varieties with wild abortion characteristics, characterized in that: The steps include: (1) extracting genomic DNA from rice to be tested; (2) using the primer combination of claim 1 or 2 and using the genomic DNA of the rice to be tested as a template to perform PCR amplification; (3) The amplified products were detected in 2% agarose gel, and the genotypes of the wild abortion gene WA352, the major effect restoration gene Rf4 and the internal reference gene were determined based on the size and quantity of the amplified products.

4. The detection method according to claim 3, characterized in that The PCR reaction system of the PCR amplification is: 2-10 μL of DNA polymerase buffer, 0.6-3.2 μL of MgCl2 solution, 0.4-2.0 μL of dNTPs, 0.05-1.0 μL of DNA polymerase, 0.5-2 μL of mixed primer set, and 1.2-4.0 μL of genomic DNA.

5. The detection method according to claim 3, characterized in that: The PCR reaction program of the PCR amplification is pre-denaturation at 94°C to 98°C for 2 to 10 minutes; denaturation at 94°C to 98°C for 30s to 60s, annealing at 42°C to 65°C for 30s to 60s, extension at 72°C for 30s to 60s, 28 to 35 cycles; extension at 72°C for 3 to 10 minutes; cooling at 12°C for 5 to 20 minutes.

6. The detection method according to claim 3, characterized in that: The method for determining the wild abortion type three lines and hybrids is as follows: if the amplified product is two bands of 604bp and 108bp, it is determined that the rice sample only carries the WA352 gene and is a wild abortion sterile line; if the amplified product is two bands of 267bp and 108bp, it is determined that the rice sample only carries the functional Rf4 restoration gene and is a wild abortion restoration line; if the amplified product is a single band of 108bp, it is determined that the rice sample does not carry the WA352 and Rf4 genes and is a wild abortion maintenance line; if the amplified product is three bands of 604bp, 267bp and 108bp, it is determined that the rice sample carries both the WA352 and Rf4 genes and is a wild abortion hybrid.

7. A kit for detecting the purity of three-line and hybrid rice varieties with wild abortion type, the kit comprising the primer combination according to claim 1 or 2.

8. Use of the primer combination according to claim 1 or 2 in preparing a kit for detecting the purity of three rice wild abortion lines and hybrids.

9. Use of the primer combination according to claim 1 or 2 in detecting the purity of three rice wild abortion lines and hybrids.

10. Use of the primer combination according to claim 1 or 2 in breeding new three-line wild-type rice varieties.

Images