KASP marker and application thereof in wheat glume wax identification

Abstract

The invention discloses a KASP marker and application thereof in wheat glume wax identification, belongs to the technical field of bioengineering, and provides a QTL QGW.haust-7D with a stable and major wheat glume wax effect and a linkage marker available for breeding of the QTL QGW.haust-7D. The QTL is located in a wheat 7D chromosome, a marker AX-111847061 which is closely linked with the QTL is converted into Kasp-AX-111847061, and the QTL can be used for auxiliary selection of QGW.haust-7D. According to the method for screening the glume wax-containing gene, to-be-detected wheat genome DNA is used as a template, the KASP primer in the sequence table is used for PCR amplification, and the genotype of the marker Kasp-AX-111847061 closely linked with the QTL in an amplification product is identified. The novel wheat glume wax QTL marker and the novel wheat glume wax QTL method provided by the invention can be used for carrying out molecular marker-assisted screening on glume wax genes.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to the identification of a new wheat hull wax QTL (Quantitative Trait Locus) and its linked KASP (Kompetitive Allele-Specific PCR) marker. Background Art

[0002] Wheat is an important food crop widely grown around the world, with total output second only to corn. Against the backdrop of global warming, extreme weather and climate events are occurring frequently, and the uncertainty of the external environment has brought serious challenges to my country's wheat production.

[0003] Cuticular wax refers to a layer of lipid organic mixture covering the surface of the aerial part of the plant, mainly composed of compounds such as alkanes, alcohols, aldehydes, ketones and fatty acids (Sturaro et al., 2006). Cuticular wax is a protective barrier between plants and the environment, which can protect plants from drought, ultraviolet rays, pathogens and insects (Yeats et al., 2013). Therefore, cloning glume wax-related genes is of great significance for breeding stress-resistant crop varieties and increasing grain yields.

[0004] KASP markers have been widely used to detect SNP sites in crops such as wheat, rice and corn. They do not require electrophoresis and can achieve high-throughput genotyping. Using the genotype data of wheat SNP chips for QTL positioning and genome-wide association analysis, the linked SNPs are converted into KASP markers, which can be directly applied to molecular marker-assisted selection breeding.

[0005] Jimai 22 is a high-yield, multi-resistant, high-quality medium-gluten wheat variety. It was approved by Shandong Province and the National Huanghuai North Area in September 2006 and January 2007, respectively, and is suitable for planting in the Huaibei area and the northern part of the Huanghuai winter wheat area. Zhongmai 578 is a high-yield, multi-resistant, high-quality strong-gluten wheat variety. It was approved by the National Huanghuai North Area in June 2021, and is suitable for planting in the entire Shandong Province in the northern part of the Huanghuai winter wheat area, the southern part of Baoding City and Cangzhou City in Hebei Province and the areas to the south, and the basin irrigation areas of Yuncheng and Linfen City in Shanxi Province. Summary of the invention

[0006] In view of the above problems, the present invention aims to provide a KASP marker and its application in the identification of wheat hull wax. The present invention uses Zhongmai 578 and Jimai 22 to construct a recombinant inbred line (RIL) population including 262 families, studies molecular markers related to hull wax, and provides a QTL QGW.haust-7D with a stable major effect of wheat hull wax and a linkage marker available for breeding. The molecular marker can be used for auxiliary selection of wheat hull wax in wheat breeding.

[0007] In order to achieve the above object, the specific scheme adopted by the present invention is:

[0008] In a first aspect, the present invention provides KASP primers for screening wheat hull wax QTL, wherein the KASP primers are used to amplify the SNP marker AX-111847061 that is closely linked to the wheat hull wax QTL; The QTL was named QGW.haust-7D, located on chromosome 7D, with flanking markers AX-111847061 and AX-110237200, and a physical interval of 395.19Mb-428.06Mb.

[0009] As a further optimization of the above scheme, the primers are a set of primers consisting of primer A, primer B and primer C; The nucleotide sequence of the primer A is shown in SEQ ID NO: 01; The nucleotide sequence of primer B is shown in SEQ ID NO: 02; The nucleotide sequence of the primer C is shown in SEQ ID NO: 03.

[0010] In a second aspect, the present invention provides a kit containing the above primers.

[0011] In a third aspect, the present invention provides a method for identifying the genetic typing of wheat husk waxy traits, comprising the following steps: first, extracting the DNA of the wheat to be identified; using the extracted DNA as a template, performing PCR amplification using primers shown in SEQ ID NOs: 01 to 03; then performing light beam scanning on the obtained amplification product, and performing typing detection based on the scanning data.

[0012] Furthermore, the total volume of the amplification reaction was 5 μl, and the reaction system was as follows: 0.056 μl Primer Mix, 2.5 μl Master Mix, 2.2 μl Template DNA, 0.244 μl ddH2O; the ratio of the Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer.

[0013] Furthermore, the amplification program was as follows: 94°C for 15 min; 94°C for 20 s, 63-55°C for 1 min, decreasing 1°C in each cycle, for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles.

[0014] In a fourth aspect, the present invention provides the use of the above primers, kits or methods in any of the following: (1) Application in identifying or assisting in identifying the genotyping of wheat husk waxy traits; (2) Application in molecular marker-assisted breeding.

[0015] Beneficial effects: The present invention uses Zhongmai 578 and Jimai 22 to construct a recombinant inbred line (RIL) population including 262 families, studies molecular markers related to glume wax, and provides a QTL QGW.haust-7D with a stable major effect of wheat glume wax and a linkage marker available for breeding. The molecular marker can be used for auxiliary selection of wheat glume wax in wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the QGW.haust-7D curve diagram located in the Zhongmai 578×Jimai 22 RIL population.

[0017] Figure 2 This is the genotyping result of 363 wheat varieties using KASP marker Kasp-AX-111847061. DETAILED DESCRIPTION

[0018] The invention relates to a new wheat hull wax QTL and a molecular marker linked thereto, which can be used for molecular marker-assisted selection of hull wax in breeding.

[0019] The invention provides a tightly linked KASP marker Kasp-AX-111847061 for screening glume wax QTL, and its sequence is shown in the primer sequence table (Table 1).

[0020] Table 1 KASP primer sequences for detecting hull wax QTL QGW.haust-7D Note: GAAGGTGACCAAGTTCATGCT is the label sequence A, GAAGGTCGGAGTCAACGGATT is the label sequence B.

[0021] The principle of KASP: three primers are required for amplification, two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP and InDel at the 3' end) and one reverse common primer; the PCR reaction system contains a universal sequence modified with fluorescent groups and quenching groups (Master Mix provided by LGC), so the forward primer can specifically bind to DNA with the same genotype as it, and the two forward primers can emit two different colors of light. If the site in the template chain is homozygous, a single fluorescence that matches it will be emitted; if it is heterozygous, two fluorescences will be emitted simultaneously. KASP marker PCR amplification system, each 5μl reaction system is as follows: 0.056μl Primer Mix, 2.5μl Master Mix, 2.2μl Template DNA (50ng / μl), 0.244μl ddH2O, Master Mix purchased from LGC Company, Primer Mix ratio is: 12% HEX primer, 12% FAM primer, 30% Common primer, primers synthesized by Shanghai Yingjun Company. Amplification uses a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler), the program is as follows: 94℃15min; 94℃20s, 63-55℃1min (1℃ drop for each cycle), 10 cycles; 94℃20s, 55℃60s, 32 cycles. PCR amplification products are scanned using the Fluorophore beam of Bio-Rad CFX Manager software, and the scanning data are typed using AllelicDiscrimination typing software.

[0022] The method and the kit both belong to the protection scope of the present invention.

[0023] The present invention also protects a new wheat husk wax QTL and its linked molecular markers. The QTL is named QGW.haust-7D, located on chromosome 7D, with flanking markers AX-111847061 and AX-110237200, and a physical interval of 395.19Mb-428.06Mb; its closely linked SNP marker is AX-111847061 (see Figure 1 ), which can explain 5.8-8.1% of the phenotypic variation under the three environmental conditions tested. Specifically, the molecular marker can be obtained by amplifying the genomic DNA of Zhongmai 578 and Jimai 22 by the primer pair. The present invention provides a new marker for wheat hull wax QTL, which can be used for molecular marker-assisted screening of hull wax genes.

[0024] The molecular marker can be applied to auxiliary selection of wheat husk wax in wheat breeding.

[0025] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples can be purchased from conventional biochemical reagent stores unless otherwise specified.

[0026] In the embodiment, a novel shell wax QTL was found in wheat material wheat 578 and its KASP marker was obtained:

[0027] 1. Acquisition of phenotype

[0028] The Zhongmai 578 / Jimai 22 RIL population was planted in Xinxiang, Shangqiu, Henan and Gaoyi, Hebei in 2020-2021. A completely randomized block design was used, with three replicates, single-row areas, 1m long and 0.25m wide, 30 seeds evenly sown in each row, and routine management. Glume wax was graded and identified 20 days after flowering. The modified CTAB method (Murray et al., 1980) was used to extract genomic DNA from young leaves of 262 families, and the DNA concentration was determined using a NanoDrop2000c spectrophotometer. The DNA samples were adjusted to a standard concentration of 50 ng / ul, and then the DNA quality was detected using a 0.8% agarose gel. The qualified DNA was subjected to SNP typing. SNP analysis was performed using the 50K SNP chip jointly developed by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences and Affymetrix Axiom.

[0029] 2. Construction of linkage map

[0030] The 50K SNP chip contains a total of 54,680 markers, and there are 11,526 markers that differ between parents. After removing markers with heterozygous and missing rates greater than 10% between parents, 10,631 markers remain. After removing redundant markers using the IciMapping 4.1bin function, 9,354 markers remain. The 9,354 marker data were imported into the online tool MSTMap, and the SingleGL parameter was selected to construct a large linkage group; then the genetic distance between markers and the chromosome position information were used to group them, and 34 linkage groups were constructed, containing a total of 1,507 markers.

[0031] 3. QTL Analysis

[0032] The IciMapping 4.1ICIM-ADD method was used for QTL analysis, and the LOD value was selected as 3.0. A stable QTL was located on chromosome 7D and named QGW.haust-7D ( Figure 1). The flanking markers are AX-111847061 and AX-110237200, with a physical interval of 395.19Mb-428.06Mb. Under different environmental conditions, 5.8-8.1% of the phenotypic variation can be explained (see Table 2, Figure 1 ). Its tightly linked marker AX-111847061 was converted into Kasp-AX-111847061, and the genotypes of 363 wheat varieties were detected.

[0033] Table 2 QGW.haust-7D of Zhongmai 578×Jimai 22 RIL population detected by composite interval mapping

[0034] 4. Use of primer pairs

[0035] The experimental materials are 363 wheat varieties, see Table 3 for details.

[0036] 1. Plant each experimental material in Luoyang, Henan in 2021-2022, with 2 rows of each material and 1.5m row length, and perform routine management. Grading and identification of glume wax were performed 20 days after flowering.

[0037] 2. Use Kasp-AX-111847061 to label and detect all experimental materials.

[0038] The results are shown in Table 3 and Figure 2 Among the 363 wheat varieties, 205 varieties showed the Zhongmai 578 genotype, with a glume wax grade of 3.20; 158 varieties showed the Jimai 22 genotype, with a glume wax grade of 2.85; statistical tests showed that the gene effect of QGW.haust-7D reached a significant difference (P<0.05).

[0039] Table 3 Genotype detection results and hull wax classification of 363 wheat varieties

[0040] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. KASP marker primers for screening wheat husk wax QTL, characterized in that: The KASP marker primers are used to amplify the SNP markers closely linked to the wheat husk wax QTL. Kasp-AX-111847061 ; The QTL was named QGW.haust-7D , located on chromosome 7D, flanked by AX-111847061 and AX- 110237200 , the physical range is 395.19Mb-428.06Mb.

2. The primer according to claim 1, characterized in that: The primers are a set of primers consisting of primer A, primer B and primer C; The nucleotide sequence of primer A is shown in SEQ ID NO: 01; The nucleotide sequence of primer B is shown in SEQ ID NO: 02; The nucleotide sequence of the primer C is shown in SEQ ID NO:

03.

3. A kit containing the primers as claimed in claim 2.

4. A method for identifying genotyping of wheat husk waxy traits, characterized in that: The following steps are involved: First, the DNA of the wheat to be identified is extracted; The extracted DNA is used as a template and the primers shown in SEQ ID NO: 01-03 are used for PCR amplification; the obtained amplification product is then subjected to light beam scanning, and typing detection is performed based on the scanning data.

5. The method according to claim 4, characterized in that: The total volume of the amplification reaction was 5 μl, and the reaction system was as follows: 0.056 μl Primer Mix, 2.5 μl Master Mix, 2.2 μl Template DNA, 0.244 μl ddH2O; the ratio of the Primer Mix was: 12% HEX primer, 12% FAM primer, and 30% Common primer.

6. The method according to claim 4, characterized in that: The amplification program was as follows: 94°C for 15 min; 94°C for 20 s, 63-55°C for 1 min, decreasing 1°C each cycle, for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles.

7. Use of the primer according to any one of claims 1 to 2, the kit according to claim 3, or the method according to any one of claims 4 to 6 in any of the following: (1) Application in identification or auxiliary identification of wheat glume wax trait genotyping; (2) Application in molecular marker-assisted breeding.

Images