Molecular marker Ta4996, primer set and application of wheat temperature-sensitive stripe rust resistance gene TaEDR2-B

Abstract

This invention belongs to the field of molecular biology technology, specifically relating to a wheat temperature-sensitive stripe rust resistance gene. TaEDR2‑B The molecular marker Ta4996, primer set, and application. The nucleotide sequence of the molecular marker Ta4996 is shown in SEQ ID NO.1, wherein there is a mutation from A to G at position 107 starting from the 5' end; the wheat temperature-sensitive stripe rust resistance gene... TaEDR2‑B The nucleotide sequence is shown in SEQ ID NO.2. The molecular marker provided by this invention exhibits co-dominance; using the specific primers of this marker, it is possible to accurately and efficiently identify whether stripe rust-resistant wheat varieties contain a temperature-sensitive stripe rust resistance gene. TaEDR2‑B This marker can be used in molecular marker-assisted breeding, greatly improving the efficiency of breeding selection.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B Molecular marker Ta4996, primer set and its application. Background Technology

[0002] Wheat is one of the most widely cultivated food crops globally, providing basic food for 35% to 40% of the world's population. It is a wheat-specific strain of *Stripetra rust*. Puccinia striiformis West. f. sp. tritici Wheat stripe rust, caused by *Strombus haematous*, is a serious airborne fungal disease that threatens wheat production. It occurs in all major wheat-producing areas worldwide, and outbreaks often result in severe yield reductions or even total crop failure, posing a significant threat to wheat production and quality in my country. Long-term research and practice have proven that planting resistant varieties is the most economical and effective measure for disease control. However, in production, frequent variations in the pathogenicity of *Strombus haematous* lead to the continuous "loss" of resistance in promoted resistant varieties. Since 1950, wheat stripe rust has caused eight major epidemics in China's major wheat-producing areas, with each subsequent wheat variety replacement due to variations in *Strombus haematous*. To date, 34 physiological races of *Strombus haematous* (CYR1-CYR34) and several pathogenic groups have been identified and officially named in my country, causing most of the major cultivated varieties to lose resistance. This presents a severe challenge to my country's wheat variety development and disease-resistant breeding efforts.

[0003] With the advancement of modern biotechnology and the application of molecular marker technology, we have discovered and named a large number of stripe rust resistance genes. To date, 87 stripe rust resistance genes have been officially named. Yr1-Yr87 In addition, there are numerous temporarily named stripe rust resistance genes or QTL loci. Because different breeding units in different regions used the same type of resistance source or a single stripe rust resistance gene extensively during the same period, the widespread promotion of new varieties exerted strong selective pressure on stripe rust fungus. This favored the emergence and spread of new virulent races of stripe rust, which became dominant races, overcoming the resistance of stripe rust resistance genes and ultimately leading to the loss of resistance in varieties. Therefore, it is urgent to discover and utilize new disease-resistant gene resources from common wheat materials to further broaden the genetic basis of disease-resistant breeding materials. The common wheat variety Aikang 58 is currently a well-regarded comprehensive resistance variety in production practice. Previous studies have found that it carries a stripe rust resistance gene. Yr5b , YrAK58.1 (Yr6) ), TaEDR2-B ( Yr52 ), YrAK58.3 ( YrZH84 Of these, Yr5b located on chromosome 2BL shows good resistance to the physiological race CYR32, while Yr5b located on chromosome 7BL shows good resistance to the physiological race CYR32. Yr6and TaEDR2-B It exhibits good resistance to physiological race CYR34.

[0004] Molecular marker technology has always been an important research tool in the field of wheat stripe rust resistance gene mapping and functional research. Molecular markers can be used to assist in the breeding of wheat varieties resistant to stripe rust. Currently, most molecular markers are traditional SSR markers and AFLP markers, but these types of molecular markers still have many problems in practical application or in their own characteristics. For example, some molecular markers lack specificity, and false positive or false negative results are prone to occur in different wheat varieties or genetic backgrounds, leading to misjudgments of wheat stripe rust resistance. The detection process of some traditional molecular markers is cumbersome, requiring expensive instruments and professional technicians, which greatly increases the detection cost and time cost, limiting their widespread application in large-scale breeding practices. KASP (Kompetitive Allele Specific PCR) molecular markers are a novel SNP detection method based on PCR technology, which can solve the problems of molecular markers of the same type as SSR and AFLP markers. At the same time, it can be used for large-scale genotyping studies as well as detection of small samples, with high flexibility; the cost is low, as KASP technology does not require expensive special instruments, and can be detected with a common real-time PCR instrument. Meanwhile, its reaction system is relatively simple, the required reagents are inexpensive, and the primer design and synthesis costs are also low, resulting in a relatively low overall experimental cost, which has significant advantages in large-scale sample detection. Therefore, there is an urgent need to develop corresponding KASP molecular markers related to wheat stripe rust resistance genes.

[0005] Currently, there is limited research on the specific thermosensitive resistance to stripe rust in wheat using existing KASP molecular markers, which fails to meet practical needs. Therefore, it is necessary to develop new KASP molecular markers targeting the thermosensitive resistance to stripe rust in wheat. Summary of the Invention

[0006] To develop novel KASP molecular markers targeting the temperature-sensitive resistance to stripe rust in wheat, this invention provides a wheat temperature-sensitive resistance to stripe rust gene. TaEDR2-B The molecular marker Ta4996, primer set, and applications were described. The molecular marker Ta4996 can target the wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B To achieve accurate predictions, the present invention employs the following technical solution.

[0007] The purpose of this invention is to develop a novel KASP molecular marker targeting the temperature-sensitive resistance to stripe rust in wheat, and to provide a wheat temperature-sensitive resistance to stripe rust gene. TaEDR2-BThe molecular marker Ta4996, whose nucleotide sequence is shown in SEQ ID NO. 1, contains a mutation from A to G at position 107 starting from the 5' end.

[0008] 0-AGAGGAAGAAGAGGAGGAGGATAATCACCGATCATTGATGCGGAGAACAACAATTGGGAATGGTCCTCCGGAATCATTGCATGATTGGACTCGTGGAAATGATACG[A / G]GAATATCTGATCAGGGAAGCCCTGCCCAAGTTTTCTCTAGAGGACACTGGCGCCTTGTCAGATGCCAGAATGGTCTCCGCATTTTTGAGGAGCTCCAAGATGTTGAT-3', where A is the mutation site and G is the mutated site in [A / G].

[0009] The molecular marker Ta4996 provided by this invention can target wheat temperature-sensitive stripe rust resistance genes. TaEDR2-B Accurate prediction is crucial for understanding subsequent wheat temperature-sensitive stripe rust resistance genes. TaEDR2-B The cloning of this technology is of great significance, as it can address the problem that existing molecular markers have limited targeted research on the temperature-sensitive resistance to stripe rust in wheat, which fails to meet practical needs.

[0010] Preferably, the molecular marker Ta4996 is used to detect the wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B.

[0011] The wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The nucleotide sequence is shown in SEQ ID NO. 2.

[0012] The present invention also provides a primer set for amplifying the molecular marker Ta4996, including forward primer 1, forward primer 2 and reverse primer 3.

[0013] The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3.

[0014] The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4.

[0015] The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO. 5.

[0016] Preferably, fluorescent tag sequences are added to the 5' ends of the forward primer 1 and the forward primer 2, respectively.

[0017] Preferably, the nucleotide sequence of the forward primer 1 after adding the fluorescent tag sequence is shown in SEQ ID NO. 6; the nucleotide sequence of the forward primer 2 after adding the fluorescent tag sequence is shown in SEQ ID NO. 7.

[0018] The present invention also provides the application of the molecular marker Ta4996 or the primer set in wheat-assisted breeding.

[0019] Preferably, the molecular marker Ta4996 or the primer set is used to prepare products assisted in wheat breeding.

[0020] This invention also provides the molecular marker Ta4996 or the primer set for detecting wheat temperature-sensitive stripe rust resistance genes. TaEDR2-B Applications in [the field].

[0021] Preferably, the molecular marker Ta4996 or the primer set is used to prepare a gene for detecting wheat temperature-sensitive stripe rust resistance. TaEDR2-B Products.

[0022] Preferably, the wheat temperature-sensitive stripe rust resistance gene is detected. TaEDR2-B The steps are as follows:

[0023] Genomic DNA was extracted from the wheat to be tested.

[0024] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set.

[0025] The PCR amplification products were then subjected to genotyping detection.

[0026] The genotype of the SNP site of the molecular marker Ta4996 was determined using the primer set.

[0027] Judgment results: If the genotype is "CC" homozygous or "CT" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "TT" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

[0028] Preferably, the PCR amplification reaction system is as follows: 2 μL of HiGeno 2×Probe Mix B, 0.0448 μL of primer mixture, 50 mg to 100 ng of DNA template, and ddH2O to make up to 6 μL; the concentration of the forward primer is 12 mmol / L, and the concentration of the reverse primer is 30 mmol / L.

[0029] The primer mixture is: Ta4996-A 0.012μL + Ta4996-B 0.012μL + Ta4996-C 0.024μL.

[0030] Preferably, the PCR amplification reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s; 61℃~55℃ for 1 min, with a decrease of 0.6℃ per cycle, for 10 cycles; 94℃ for 20 s, 55℃ for 60 s, for 30 cycles.

[0031] This invention is aimed at TaEDR2-B ( Yr52 At this locus, through fine mapping and further gene annotation analysis, it was found that this region contains 5 disease resistance genes, among which... TraesAK58CH7B01G499600 The gene encoding Protein ENHANCED DISEASERESISTANCE 2 was highly expressed during stripe rust infection, suggesting it as an important candidate gene. Following gene nomenclature conventions, it was named... TaEDR2-B Based on the differential sequence of this gene between the parents Avocet S and Aikang 58, a corresponding functional marker for the KASP gene was developed. Molecular detection of KASP in natural population materials revealed that its presence significantly enhances wheat resistance to stripe rust, thereby mitigating stripe rust damage throughout the wheat's growth and development. Furthermore, it has significant potential application value for improving wheat seedling resistance to stripe rust. Therefore, developing a molecular marker for this stripe rust resistance gene is of great importance for molecularly assisted breeding of multiple disease resistance genes.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. This invention provides a wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B The molecular marker Ta4996 can accurately predict wheat temperature-sensitive stripe rust resistance genes. TaEDR2-B For subsequent wheat temperature-sensitive stripe rust resistance genes TaEDR2-B The cloning of this technology is of great significance, as it can address the problem that existing molecular markers have limited targeted research on the temperature-sensitive resistance to stripe rust in wheat, which fails to meet practical needs.

[0034] 2. This invention provides a primer set for amplifying the molecular marker Ta4996. The molecular marker Ta4996 and its primer set can be rapidly and efficiently applied to molecular-assisted breeding for wheat variety improvement, thereby accelerating the breeding process of wheat at the whole genome level. Attached Figure Description

[0035] Figure 1 This is a scatter plot showing the amplification and genotyping of the primer set for the molecular marker Ta4996 in Example 2 of this invention, targeting the resistant parent, the susceptible parent, and 388 wheat varieties; wherein, Figure 1Figure a in the figure is a scatter plot of amplification and typing of the primer set of molecular marker Ta4996 for resistant parents, susceptible parents, and 388 wheat varieties; Figure 1 Figure b in the figure is a box plot of disease response type; where FAM is located on the X-axis, HEX is located on the Y-axis, ÷÷ indicates the type consistent with the disease-resistant parent, -- indicates the type consistent with the disease-susceptible parent, and ÷- indicates the heterozygous type.

[0036] Figure 2 This is a genetic linkage map constructed from a 660K chip and SNP markers in candidate genes, as well as a map showing the positions of the SNP markers within the genetic linkage map in Example 1 of this invention; wherein, Figure 2 In the figure, 'a' represents the coarse localization map of YrAK58.2 (TaEDR2-B). Figure 2 In the image, b represents the fine localization map of YrAK58.2 (TaEDR2-B); Figure 2 c in the diagram represents the genetic integration map of chromosome 7BL, where YrAK58.2 (TaEDR2-B) is located. I, II, and III are three different disease resistance hotspot enrichment regions. Detailed Implementation

[0037] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0038] The experimental materials used in the embodiments of the present invention and their preparation are as follows:

[0039] The wheat material used in this embodiment of the invention is common wheat, specifically the dwarf and resistant 58 material and its derivative varieties bred by the Wheat Breeding Center of Henan University of Science and Technology.

[0040] The stripe rust in this invention can specifically be stripe rust caused by the currently prevalent stripe rust pathogens CYR32, CYR33 and CYR34.

[0041] Example 1: Wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Obtaining molecular markers

[0042] 1. Construction and genetic analysis of genetic populations

[0043] (1) Wheat materials tested

[0044] The parents used in constructing the genetic population were dwarf 58 and Avocet S.

[0045] Among them, the disease-resistant parent, Aikang 58, is a variety bred by the Wheat Breeding Center of Henan University of Science and Technology, exhibiting seedling resistance to the currently prevalent stripe rust race CYR34. The susceptible parent is the Australian susceptible variety Avocet S (AvS), with Avocet S (AvS) as the female parent. The disease-resistant variety Aikang 58 was used as the male parent for hybridization to obtain F1. F1 was self-pollinated to obtain F2. F2 individual plants were continuously self-pollinated to obtain a recombinant inbred line (RIL) population using the "single-seed transmission" method, which was used for genetic analysis and gene mapping.

[0046] Xiaoyan 22, a common wheat variety, can be obtained from the National Crop Germplasm Resource Bank as a susceptible control.

[0047] (2) Phenotypic assessment and phenotypic data analysis of the test group

[0048] The steps and methods for seedling resistance identification are as follows: Parental lines, susceptible controls, and 133 F6RILs were sown in the greenhouse of the Institute of Plant Pathology, Northwest A&F University. They were sown in 10cm×10cm×10cm plastic square boxes filled with substrate. For parents and RIL families, 8 seeds of each material were sown in the four corners of the square box (the materials in the four corners should be concentrated as much as possible during sowing to avoid difficulty in distinguishing which parent or family each seedling belongs to after it grows, which would be detrimental to stripe rust identification during the seedling stage). When the wheat seedlings have grown to the point where the two leaves are fully extended (generally around 15 days), they were inoculated using the powder-shaking method (stripe rust races were inoculated at a volume ratio of CYR34:talc ≈ 1:50) (ensuring that the first and second leaves of the seedlings are thoroughly powdered). After inoculation, wheat seedlings were placed in a dark and moisturized environment at 9℃~11℃ and 100% relative humidity for 24 hours. After that, they were placed in a greenhouse for cultivation with a day-night temperature cycle of 18℃ / 11℃, a light intensity of 20,000 lx, a light-dark cycle of 16h / 8h, and a relative humidity of about 80%. After the infected control had fully developed the disease (18 days after inoculation), the response patterns of AvS, Dwarf Anti-58, and the progeny genetic population were recorded. Infection type (IT) was determined using the 9-point criterion of Line and Qayoum (1991), where 0-6 were resistant (R) and 7-9 were susceptible (S) (Line, RF, and Qayoum, A.1991. Virulence, aggressiveness, evolution, and distribution of races of Pucciniastriiformis (the cause of stripe rust of wheat) in North America, 1968-87. USDep. Agric. Tech. Bull. No.1788.). Surveys were conducted every 3 days, and the highest responsive type was used as the final identification result. Based on the responsiveness of the parents and offspring, the results were expressed in Excel using the χ² method. 2 The method involves conducting a fitness test on the segregation ratio obtained from the survey to determine the most suitable segregation ratio, clarifying the number of genes, interaction modes, and resistance characteristics of the tested varieties against specific stripe rust races, and further clarifying the number of stripe rust resistance genes and their interrelationships.

[0049] The result was: in the offspring population, the ratio of resistant strains to susceptible strains was 78:49 (not conforming to a 1:1 ratio). P =0.011), indicating that seedling resistance is not controlled by one pair of genes, but by two or more pairs of genes.

[0050] 2. Genetic mapping and stripe rust resistance genes TaEDR2-B Location and candidate gene cloning

[0051] (1) Bulk segregant analysis (BSA) combined with wheat microarray analysis

[0052] When wheat reached the 3-leaf stage, the 3rd leaves of each parent and individual plant / family were collected, and DNA was extracted using the CTAB method. Based on the stripe rust resistance segregation characteristics of the F2 progeny population of AvS×AK58 and the RIL family of AvS×AK58, cluster segregation analysis was used to select 10 extremely resistant individuals / families and 10 extremely susceptible individuals / families, respectively. Equal amounts of DNA were extracted to construct two groups of resistance-susceptibility pools. After quality inspection and confirmation of no issues, the constructed resistance-susceptibility pools and parents were sent to Beijing Bio-Tech Co., Ltd. for genotyping using a wheat 660K SNP chip. Based on the chromosomes containing the differentially expressed SNPs and their concentration on those chromosomes, the locations of QTL loci were preliminarily determined. Then, polymorphic KASP markers were developed, and the RIL population was genotyped using IciMapping software to construct a genetic map. A new stripe rust resistance gene was located in this population and named... TaEDR2-B . TaEDR2-B This refers to the wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B hereinafter referred to as TaEDR2-B Its molecular marker, Ta4996, has a nucleotide sequence as shown in SEQ ID NO. 1:

[0053] 5'-AGAGGAAGAAGAGGAGGAGGATAATCACCGATCATTGATGCGGAGAACAACAATTGGGAATGGTCCTCCGGAATCATTGCATGATTGGACTCGTGGAAATGATACG[A / G]GAATATCTGATCAGGGAAGCCCTGCCCAAGTTTTCTCTAGAGGACACTGGCGCCTTGTCAGATGCCAGAAATGTCTCCGCATTTTTGAGGAGCTCCAAGATGTTGAT-3'.

[0054] (2) TaEDR2-B Fine mapping and candidate gene cloning

[0055] Further fine mapping of this locus will be carried out using the remaining heterozygous population. This will be combined with genetic analysis of the Avocet S / dwarf-resistant 58 high-generation population, using lines containing only [specific heterozygous lines]. YrAK58.2The remaining heterozygous families AAKHIF10, AAKHIF23, AAKHIF52, and AAKHIF81 were self-crossed to create F2 secondary segregating populations. Approximately 200 F2 individuals from each heterozygous line were selected as the basic segregating population. Based on the phenotype and segregation of the F2 individuals, populations where the target trait was controlled by a single gene (resistance:susceptibility segregation ratio of 3:1) were selected for preliminary and fine mapping. The fine mapping process required an F2 segregating population exceeding 5000 individuals, generated from either F2 or F3... 2:3 Derivative group composition. Using the F constructed above respectively... 2:3 Based on the identification results under various environmental conditions, families with extreme phenotypes were selected from the basic segregating population to construct a disease-resistant / susceptible mixed pool: 30 susceptible families (genotype [missing information]) were selected. yrAK58.2 / yrAK58.2 (i.e., recessive homozygous), constructing a susceptible homozygous pool; select 30 dominant homozygous resistant families (genotype: YrAK58.2 / YrAK58.2 A disease-resistant mixed pool was constructed. Genotyping and RNA-Seq sequencing of wheat using a 660K SNP chip were performed on both mixed pools and both parents. Additionally, 10× genome resequencing was performed on each parent of the segregating population. The specific procedures are as follows:

[0056] 1) For SNP microarray genotyping data: After mining differential SNPs between immune pools, the chromosomal distribution and genetic and physical location information of differential SNP loci are obtained based on the reference integrated genetic and physical maps. The number of differential SNPs per megabase pair (Mb) or per centimole of genetic distance (cM) is calculated using a Perl program to understand the enrichment of SNPs on chromosomes, thereby determining the possible range of target genes; 2) For RNA-Seq data, sequencing data is aligned to the Chinese spring reference genome sequence, and SNP calling is performed, and the index value of SNP loci (the proportion of a certain genotype to the total number of genotypes) is calculated. In most regions of the genome, due to the free assortment of genes, the index value is approximately 0.5. However, in the regions of genes controlling the target trait, there will be a significant difference in the index values ​​between the two extreme pools. This allows for rapid preliminary localization, roughly locking the target gene into a certain region on the chromosome, specifically the 690Mb~750Mb region on chromosome 7BL. 3) Since the genome of one of the parents, Dwarf Anti-58, is basically assembled, the resequencing data of other parents can be compared with it. During this process, the genome of Chinese Spring will also be referenced in order to uncover more DNA variation information.

[0057] Based on the above methods, we developed SNP-based KASP molecular markers or InDel markers based on small fragment insertions and deletions, and applied them to F... 2:3Genotyping was performed on the segregating population. After obtaining the F1 generation... 2:3 After separating phenotypic and genotypic data from populations under different environments, two methods were used to analyze the data: qualitative and quantitative traits. For qualitative traits, the recombination rate was calculated using the Kosambi function in conjunction with phenotypic and genotypic data using Joinmap software, and linkage maps were drawn. For quantitative traits, QTL mapping was performed using the inclusive composite interval mapping (ICIM) method with QTLIciMapping V4.1 software. Finally, the results of the two methods were combined to cross-validate the mapped regions. After determining the target gene region within the 710Mb~720Mb range of the Chinese Spring reference genome, appropriate flanking markers were selected at both ends, such as... AX-111521000 and AX-108746141 Key recombinants were screened in the F2 population. Genotype and phenotype analysis and confirmation of these key recombinants were conducted, and marker-phenotype (corresponding) relationships were established by combining newly developed molecular markers from the fine mapping process. YrAK58.2 The linkage between genotypes (dominant homozygous and heterozygous materials were identified based on whether the genotypes segregated in the progeny) and closer flanking markers were determined. Ultimately, the target region was narrowed down to... AX-108892862 and AX-109545885 Between these values, the corresponding interval in the Chinese Spring reference genome v.2.1 is 729.732 Mb to 730.681 Mb on chromosome 7B, and the corresponding interval in the dwarf-resistant 58 genome is 731.153 Mb to 732.309 Mb. Based on the gene annotation and transcriptional expression results of Chinese Spring, only 7 high-confidence genes are expressed, namely… TraesCS7B03G1231400.1, TraesCS7B03G1236800.1, TraesCS7B03G1238300.1, TraesCS7B03G1238700.1, TraesCS7B03G1238900.1, TraesCS7B03G1239600.1 and TraesCS7B03G1239800.1 The following proteins were annotated: Glyoxylate reductase / hydroxypyruvate reductase, Protein ENHANCED DISEASE RESISTANCE 2, receptor kinase 1, Chalcone synthase, Receptor-like protein kinase, Receptor kinase 1, and Disease resistance protein RPM1. Based on the results of the correlation between parental resequencing differences and phenotypes, it was preliminarily determined that... TraesCS7B03G1236800 This is an important candidate gene, and the corresponding genome ID number for dwarf-resistant 58 is [missing information]. TraesAK58CH7B01G499600 Its nucleotide sequence is shown in SEQ ID NO. 2:

[0058] TCATTGGTCGCCCTTACTG

[0059] Based on the sequence differences of this gene in disease-resistant materials, molecular markers for this gene were developed and designed using Primer 5.0 software. Ta4996 Its robustness was verified in the recombinant single plants of the offspring.

[0060] YrAK58.2 The results of coarse positioning are as follows Figure 2 Figure a in the diagram.

[0061] YrAK58.2 The results of fine positioning are as follows Figure 2 Figure b in the diagram.

[0062] Depend on Figure 2 As can be seen from Figure b, Ta4996 Mark and YrAK58.2 Phenotypic co-separation.

[0063] Example 2: Wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Feasibility verification of molecular markers

[0064] This invention aims to develop a temperature-sensitive stripe rust resistance gene for wheat. TaEDR2-B candidate genes TraesAK58CH7B01G499600 The feasibility of the functional molecular marker Ta4996 (hereinafter referred to as Ta4996) and its dedicated primer set was verified through the following studies:

[0065] I. Molecular detection of stripe rust resistance genes in 388 wheat cultivars

[0066] Methods: The stripe rust resistance gene in 388 wheat cultivars was detected using the primer set of Ta4996.

[0067] The primer set of Ta4996 was used to detect 388 test varieties using the method in Example 1. The template solution had a DNA concentration of 100 ng / μL. The detection steps are as follows:

[0068] Genomic DNA was extracted from the wheat to be tested.

[0069] Using the genomic DNA of the wheat as a template, PCR amplification was performed using the primer set.

[0070] The PCR amplification products were then subjected to genotyping detection.

[0071] The genotype of the SNP site of the molecular marker Ta4996 was determined using the primer set.

[0072] Judgment results: If the genotype containing the marker SNP is homozygous "CC" or heterozygous "CT", then the wheat being tested is a candidate wheat with stripe rust resistance; if the genotype containing the marker SNP is homozygous "TT", then the wheat being tested is a candidate wheat with stripe rust susceptibility. The results are as follows: Figure 1 Figure a in the diagram.

[0073] The primer set for Ta4996 is as follows:

[0074] The primer set for Ta4996 is as follows:

[0075] Forward primer 1: The nucleotide sequence of Ta4996A is shown in SEQ ID NO. 3:

[0076] 5'-GGCTTCCTGATCAGATATTCT-3''.

[0077] Forward primer 2: The nucleotide sequence of Ta4996B is shown in SEQ ID NO. 4:

[0078] 5'-GGCTTCCTGATCAGATATTCC-3'.

[0079] The nucleotide sequence of reverse primer 3: Ta4996C is shown in SEQ ID NO. 5:

[0080] 5'-GCATGATTGGACTCGTGGAAAT-3'.

[0081] In particular, fluorescent tag sequences: FAM probe sequences are added to the 5' end of forward primer 1.

[0082] The nucleotide sequence of the forward primer 1 after adding the fluorescent tag is shown in SEQ ID NO. 6:

[0083] 5'- gaaggtgaccaagttcatgctGGCTTCCCTGATCAGATATTCT-3'.

[0084] Fluorescent tag sequences and HEX probe sequences were added to the 5' end of forward primer 2.

[0085] The nucleotide sequence of the forward primer 2 after adding the fluorescent tag sequence is shown in SEQ ID NO. 7:

[0086] 5'-gaaggtcggagtcaacggattGGCTTCCCTGATCAGATATTCC-3'.

[0087] Depend on Figure 1As shown in Figure a, Ta4996 can amplify the "CC" homozygous type in disease-resistant parents, while all "CC" homozygous or "AC" heterozygous types are potential target gene carriers. Figure 1 As shown in Figure b, the "CC" homozygous material, containing the target gene, exhibits superior resistance at the adult stage compared to the "AA" homozygous material. This indicates that the molecular marker Ta4996 can be used to detect wheat resistance to stripe rust.

[0088] The genotypes and stripe rust phenotypes of 388 wheat cultivars detected by the Ta4996 primer set are shown in Table 1.

[0089] Table 1. Genotypes and stripe rust phenotypes of 388 wheat cultivars detected using the Ta4996 primer set.

[0090]

[0091] Table 1 shows that Ta4996 can amplify homozygous "CC" and homozygous "AA" phenotypes in resistant and susceptible parents, respectively. All homozygous "CC" or heterozygous "AC" phenotypes are potential carriers of the target gene, and their stripe rust resistance phenotype (reactivity phenotype) values ​​are generally lower than those of the homozygous "AA" material (which does not contain the target gene), indicating good resistance at the adult stage. This demonstrates that the molecular marker Ta4996 can be used to detect wheat stripe rust resistance.

[0092] The experimental results above show that Ta4996, as a functional molecular marker for the candidate gene TaEDR2-B, co-segregated with the stripe rust resistance phenotype in a large genetic population (more than 5000 F2 plants). This indicates that the marker is closely linked to the target gene or is the functional marker of the target gene, which is consistent with previous markers such as... Xgwm577 and Xbarc32 Equivalent (see) Figure 2 (Figure c in the figure) Its genetic distance is closer to the target gene, which means that recombination is less likely to occur, further ensuring the accuracy of the marker for detection; In addition, as a high-throughput KASP molecular marker, the molecular marker Ta4996 has another advantage: it can quickly and efficiently detect large samples, and it is easy to operate, ensuring the timeliness of field selection, which traditional SSR markers cannot achieve.

[0093] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0094] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The molecular marker Ta4996 is characterized by, The nucleotide sequence of the molecular marker Ta4996 is shown in SEQ ID NO. 1, wherein there is a mutation from A to G at position 107 starting from the 5' end.

2. A primer set for amplifying the molecular marker Ta4996 as described in claim 1, characterized in that, It includes forward primer 1, forward primer 2, and reverse primer 3; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4; The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

5.

3. The primer set according to claim 2, characterized in that, Fluorescent tag sequences are added to the 5' ends of both forward primer 1 and forward primer 2.

4. The primer set according to claim 3, characterized in that, The nucleotide sequence of forward primer 1 with added fluorescent tag sequence is shown in SEQ ID NO. 6; the nucleotide sequence of forward primer 2 with added fluorescent tag sequence is shown in SEQ ID NO.

7.

5. The application of the molecular marker Ta4996 as described in claim 1 or the primer set as described in claim 2 in wheat stripe rust resistance-assisted breeding.

6. The use of the molecular marker Ta4996 as described in claim 1 or the primer set as described in claim 2 in the preparation of products that assist in the breeding of wheat resistant to stripe rust.

7. The primer set described in claim 2 for detecting wheat temperature-sensitive stripe rust resistance genes. TaEDR2-B The application of this is characterized by, The wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The nucleotide sequence is shown in SEQ ID NO.

2.

8. The primer set described in claim 2 is used in the preparation of a primer set for detecting the wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B The application of [the product] is characterized by, The wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The nucleotide sequence is shown in SEQ ID NO.

2.

9. The application according to claim 7, characterized in that, Detection of wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The steps are as follows: Genomic DNA was extracted from the wheat to be tested; Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set; The PCR amplification products were then subjected to typing detection. The primer set was used to determine the genotype of the SNP site of the molecular marker Ta4996; Judgment results: If the genotype is "CC" homozygous or "CT" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "TT" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

Images