BraPb8.3 gene-based Chinese cabbage clubroot-resistant molecular marker and application thereof

Abstract

The invention relates to the technical field of biotechnology, and discloses a brassica rapa clubroot-resistant molecular marker based on a BraPb8.3 gene and application of the brassica rapa clubroot-resistant molecular marker. The brassica rapa clubroot-resistant molecular marker comprises molecular markers srt8-24 and srt8-64, and the nucleotide sequence of the molecular markers srt8-24 is shown as SEQ ID NO.1. The molecular markers srt8-24 and srt8-64 are closely linked to the brassica rapa clubroot-resistant gene BraPb8.3, and compared with a traditional far-end marker, the brassica rapa clubroot-resistant molecular marker based on the BraPb8.3 gene has the advantages that the brassica rapa clubroot-resistant molecular marker based on the Compared with the prior art, the method has the advantages that the MAS genes are closer to target genes, the risk of linkage burdens is reduced, individuals carrying disease-resistant genes can be more accurately screened out when the markers are used for molecular marker-assisted selection, introduction of unnecessary adverse genetic backgrounds is avoided, and the method has the advantages of being high in practicability and enabling MAS to be more accurate and effective.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology, and in particular to a Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene and an application thereof. Background Art

[0002] Chinese cabbage faces the threat of multiple diseases during its growth process, among which clubroot is a serious soil-borne disease caused by Brassica rapa. The disease can cause tumors to form on the roots of the plant, affecting the absorption of water and nutrients, and ultimately leading to a decrease in yield or even a total loss of yield. Traditional prevention and control methods include crop rotation, soil disinfection, and the use of chemical agents, but these measures are often costly and the effects are unstable.

[0003] In the practice of breeding Chinese cabbage for clubroot resistance, the key step is to introduce disease-resistant gene loci into materials of different genetic backgrounds. The traditional method relies on field inoculation identification, which is time-consuming, inefficient, and easily affected by environmental factors, making it difficult to ensure the consistency and reliability of the results. In recent years, with the development of molecular biology technology, more and more research has focused on using molecular marker-assisted selection (MAS) to accelerate the breeding of disease-resistant varieties. MAS technology can quickly screen out individuals carrying specific disease-resistant genes at an early stage by detecting DNA sequence variations that are closely linked to the target trait, thereby significantly improving selection efficiency and shortening the breeding cycle.

[0004] However, existing molecular markers are mostly concentrated in non-coding regions, far away from the target gene, which may lead to linkage drag problems, that is, along with the introduction of beneficial genes, an unfavorable genetic background is also introduced, affecting the performance of offspring. Therefore, it is necessary to design and apply a molecular marker for clubroot resistance based on the BraPb8.3 gene in Chinese cabbage that is highly practical and makes MAS more accurate and effective. Summary of the invention

[0005] The object of the present invention is to provide a molecular marker for Chinese cabbage resistance to clubroot disease based on the BraPb8.3 gene and its application, so as to solve the problems raised in the above background technology.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions: molecular markers of Chinese cabbage resistance to clubroot based on the BraPb8.3 gene, including molecular markers srt8-24 and srt8-64, The nucleotide sequence of the molecular marker srt8-24 is shown in SEQ ID NO.1: TAACACCCCACGGAAAAGTCTATACAACTGACTTTGCCAACATAGCTCGTCTCCCATCTCTCTCTTTTTTTTCTTCTTCATCAGACACACATTTGTCTTAGTTTTGGAACGCACCATAGATATATCATCACAACCACGACGACAACAGA The nucleotide sequence of the molecular marker srt8-64 is shown in SEQ ID NO.2: TTGGCAACTGGTGACAATCTAAAAAAATAAAAAATAAATCTATTTTCCTATTATAAATTTACATTATTAGTATAGTATTTTTGTTATTGATGTTTATTTTCTAAGTTTGAGTAGATATTATTATATTTCTTTGCTTTCCCGTTTG.

[0007] According to the above technical solution, PCR specific amplification primers for molecular marker srt8-24 include: srt8-24F 5'-TAACACCCCACGGAAAAGTC-3' srt8-24R 5'-TCTGTTGTCGTCGTGGTTGT-3' PCR specific amplification primers for molecular marker srt8-64 include: srt8-64F 5'-TTGGCAACTGGTGACAATCT-3' srt8-64R 5'-CAAACGGGAAAGCAAAGAAA-3'.

[0008] According to the above technical scheme, the Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene is used in molecular marker-assisted selection.

[0009] According to the above technical scheme, the application of the Chinese cabbage clubroot disease resistance molecular marker based on the BraPb8.3 gene in the molecular marker-assisted selection of Chinese cabbage clubroot disease resistance.

[0010] The application method of the molecular marker of Chinese cabbage resistance to clubroot based on the BraPb8.3 gene comprises the following steps: S1, extracting genomic DNA of the material to be tested; S2, establish a PCR amplification reaction system using specific primers, wherein: Primer sequences specifically refer to srt8-24: Forward primer (srt8-24F) 5'-TAACACCCCACGGAAAAGTC-3' Reverse primer (srt8-24R) 5'-TCTGTTGTCGTCGTGGTTGT-3' Primer sequences specifically refer to srt8-64: Forward primer (srt8-64F) 5'-TTGGCAACTGGTGACAATCT-3' Reverse primer (srt8-64R) 5'-CAAACGGGAAAGCAAAGAAA-3' S3, executing the PCR amplification program, including preliminary denaturation, cycling (denaturation, annealing, extension), and final extension; S4, gel electrophoresis analysis of PCR products; S5, observe and record DNA bands of specific sizes. If the electrophoresis results show two specific bands of 153 bp and 298 bp, it indicates that the material to be tested carries the clubroot resistance gene BraPb8.3.

[0011] Compared with the prior art, the beneficial effects achieved by the present invention are: (1) Improving the accuracy of MAS: The molecular markers srt8-24 and srt8-64 proposed in this application are closely linked to the Chinese cabbage clubroot resistance gene BraPb8.3. Compared with traditional distal markers, they are closer to the target gene, reducing the risk of linkage drag. When using these markers for molecular marker-assisted selection, individuals carrying disease resistance genes can be screened more accurately, avoiding the introduction of unnecessary adverse genetic backgrounds; (2) Shortening the breeding cycle: The traditional method for identifying Chinese cabbage resistance to clubroot disease relies on field inoculation tests. This method is not only time-consuming and costly, but the results are easily affected by environmental factors and it is difficult to ensure consistency and reliability. In contrast, the molecular markers provided in this application can quickly identify disease resistance at the seedling stage, greatly shortening the breeding cycle and improving breeding efficiency. (3) Enhanced detection stability: In order to ensure the application effect of molecular markers, this application designs a set of specific PCR amplification primer combinations for efficient amplification of the DNA fragments corresponding to the above two molecular markers. These primers have been optimized to achieve stable amplification effects under conventional conditions, ensuring the repeatability and accuracy of the experimental results. In addition, through gel electrophoresis analysis, DNA bands of specific sizes can be intuitively observed, further verifying the stability of the detection; (4) Simplifying the breeding process of disease-resistant varieties: Since the srt8-24 and srt8-64 markers are closely linked to the BraPb8.3 gene, the use of these markers can quickly identify individuals carrying disease-resistant genes at an early stage, thereby simplifying the breeding process of clubroot-resistant varieties. This not only reduces the human and material input in the breeding process, but also reduces the risk of linkage drag, which helps to breed better disease-resistant varieties. (5) Reducing breeding costs: By using the molecular markers of this application for early screening, the workload of subsequent field trials can be significantly reduced, reducing breeding costs. This cost-saving effect is particularly evident in large-scale breeding projects, which helps promote the rapid promotion and application of disease-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings: Figure 1 This is a schematic diagram of the initial localization results of BraPb8.3 of the present invention; Figure 2 This is a schematic diagram of the BraPb8.3 fine positioning results of the present invention; Figure 3 The present invention utilizes srt8-24 to F 2 Group testing results; Figure 4 The present invention utilizes srt8-64 to F 2 Group testing results; DETAILED DESCRIPTION

[0013] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0014] See also Figure 1-2 The present invention provides a technical solution: a molecular marker for Chinese cabbage resistance to clubroot based on the BraPb8.3 gene, including molecular markers srt8-24 and srt8-64, The nucleotide sequence of the molecular marker srt8-24 is shown in SEQ ID NO.1: TAACACCCCACGGAAAAGTCTATACAACTGACTTTGCCAACATAGCTCGTCTCCCATCTCTCTCTTTTTTTTCTTCTTCATCAGACACACATTTGTCTTAGTTTTGGAACGCACCATAGATATATCATCACAACCACGACGACAACAGA The nucleotide sequence of the molecular marker srt8-64 is shown in SEQ ID NO.2: TTGGCAACTGGTGACAATCTAAAAAAATAAAAAATAAATCTATTTTCCTATTATAAATTTACATTATTAGTATAGTATTTTTGTTATTGATGTTTTATTTTCTAAGTTTGAGTAGATATTATTATATTTCTTTGCTTTCCCGTTTG; Specifically, the PCR specific amplification primers for the molecular marker srt8-24 include: srt8-24F 5'-TAACACCCCACGGAAAAGTC-3' srt8-24R 5'-TCTGTTGTCGTCGTGGTTGT-3' PCR specific amplification primers for molecular marker srt8-64 include: srt8-64F 5'-TTGGCAACTGGTGACAATCT-3' srt8-64R 5'-CAAACGGGAAAGCAAAGAAA-3'; Specifically, the application of the molecular marker for clubroot resistance in Chinese cabbage based on the BraPb8.3 gene in marker-assisted selection; Specifically, the application of the molecular marker for clubroot resistance in Chinese cabbage based on the BraPb8.3 gene in molecular marker-assisted selection for clubroot resistance in Chinese cabbage; The application method of the molecular marker of Chinese cabbage resistance to clubroot based on the BraPb8.3 gene comprises the following steps: S1, extract high-quality genomic DNA from the Chinese cabbage material to be tested to ensure the quality and purity of the template; S2, construct a PCR reaction system containing template DNA, specific primers, dNTPs, PCR Buffer and Taq DNA polymerase, with a total volume of 10 μL. The specific components are as follows: 15 ng template DNA, 5 pmol·L -1 Primer, 1.0mmol·L -1dNTP, 1.0uL 10×PCR Buffer, 0.5U Taq DNA polymerase, and ddH2O to make up to 10μL, and establish a PCR amplification reaction system through specific primers, where: Primer sequences specifically refer to srt8-24: Forward primer (srt8-24F) 5'-TAACACCCCACGGAAAAGTC-3' Reverse primer (srt8-24R) 5'-TCTGTTGTCGTCGTGGTTGT-3' Primer sequences specifically refer to srt8-64: Forward primer (srt8-64F) 5'-TTGGCAACTGGTGACAATCT-3' Reverse primer (srt8-64R) 5'-CAAACGGGAAAGCAAAGAAA-3' S3, perform the preset PCR amplification program, perform a pre-denaturation treatment at 95°C for 5 minutes; then perform 35 cycles, each cycle includes denaturation at 95°C for 30 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 30 seconds; finally, perform an extension at 72°C for 5 minutes to ensure that the DNA fragment is completely synthesized; S4, PCR products were mixed with an equal volume of loading buffer and denatured at 95°C for 6 min, followed by electrophoresis on a 6% denaturing polyacrylamide gel at 70 W for 1.5 h; S5, observe the DNA bands of specific sizes on the electrophoresis gel by visualization techniques (such as silver staining or fluorescent dyes). If bands of 153 bp and 298 bp are observed, it indicates that the probability that the tested material contains the clubroot resistance gene BraPb8.3 is 100%; Example

[0015] 1. Resistance identification at the seedling stage The susceptible pure line material 3-2 was used as the female parent and the material H04 containing the BraPb8.3 disease resistance locus was used as the male parent. The two were crossed to obtain the F 1 Group, F 1 After self-fertilization, F 2 The srt8-64 and srt8-24 markers can be used to screen out disease-resistant materials containing the BraPb8.3 gene at the seedling stage.

[0016] 2. Acquisition of polymorphic molecular markers Using the obtained F 2The population was inoculated with root-knot fungus (KEL-23), and the inoculated materials were placed in a greenhouse at a temperature of 25 degrees. Phenotypic identification was carried out 35 days after inoculation, and the disease-resistant individuals were separated from the susceptible individuals. 20 disease-resistant individuals and 20 susceptible individuals were selected, and DNA was extracted from each of them. Then, DNAs of 20 disease-resistant individuals were mixed in equal amounts, and DNAs of 20 susceptible individuals were mixed in equal amounts. The mixed DNAs were subjected to high-throughput sequencing, and after sequencing, they were assembled with the Chinese cabbage reference genome, and InDel sites were analyzed and screened out. Primers were designed based on the sequences around the InDel sites, and primers were synthesized to identify polymorphisms between the susceptible parent 3-2 and the resistant parent H04.

[0017] 3. Construction of the genetic linkage map of BraPb8.3 gene The developed polymorphic primers were used to identify the F 2 The population was genotyped and phenotypic analyzed. The JoinMap4.0 software was used to construct a genetic linkage map. The Kosambi function was used to calculate the recombination rate and the LOD value was set to 3.0. Finally, a genetic linkage map was obtained.

[0018] 4. BraPb8.3 gene fine positioning Randomly select 3000 F 2 seeds, put two layers of filter paper soaked with sterile water in a petri dish, place the seeds evenly on the filter paper, and place them in a dark place. When the radicle grows out, transfer them to a 4 ℃ refrigerator to ensure that the vernalization time is more than 30 days. After the vernalization is completed, transfer them to a 72-hole tray filled with a matrix. Sampling was carried out two weeks later. According to the initial positioning results, the BraPb8.3 gene flanking markers 333 and sau332-1 were used to identify the seeds from F 2 Recombinant plants were selected from the population, planted, and self-pollinated after flowering to obtain 96 F 3 The seeds of the family lineage.

[0019] Each F 3 Thirty seeds were selected from the first generation family for inoculation and identification to obtain their phenotypic data. In addition, the polymorphic markers between 333 and sau332-1 were used to analyze the genotype of the recombinant single plant. Combined with the obtained phenotypic data, BraPb8.3 was precisely located in the 10.16kb interval between srt8-64 and srt8-24.

[0020] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0021] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Molecular markers for Chinese cabbage resistance to clubroot based on the BraPb8.3 gene, including molecular markers srt8-24 and srt8-64, characterized in that: The nucleotide sequence of the molecular marker srt8-24 is shown in SEQ ID NO.1: TAACACCCCACGGAAAAGTCTATACAACTGACTTTGCCAACATAGCTCGTCTCCCATCTCTCTCTTTTTTTTCTTCTTCATCAGACACACATTTGTCTTAGTTTTGGAACGCACCATAGATATATCATCACAACCACGACGACAACAGA; The nucleotide sequence of the molecular marker srt8-64 is shown in SEQ ID NO.2: TTGGCAACTGGTGACAATCTAAAAAAATAAAAAATAAATCTATTTTCCTATTATAAATTTACATTATTAGTATAGTATTTTTGTTATTGATGTTTATTTTCTAAGTTTGAGTAGATATTATTATATTTCTTTGCTTTCCCGTTTG.

2. The Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene according to claim 1, characterized in that: PCR specific amplification primers for molecular marker srt8-24 include: srt8-24F 5'-TAACACCCCACGGAAAAGTC-3' srt8-24R 5'-TCTGTTGTCGTCGTGGTTGT-3' PCR specific amplification primers for molecular marker srt8-64 include: srt8-64F 5'-TTGGCAACTGGTGACAATCT-3' srt8-64R 5'-CAAACGGGAAAGCAAAGAAA-3'.

3. Use of the Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene according to claim 1 in molecular marker-assisted selection.

4. Use of the Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene according to claim 1 in molecular marker-assisted selection of Chinese cabbage clubroot resistance.

5. The application method of the Chinese cabbage clubroot resistance molecular marker based on the BraPb8.3 gene according to claim 1, characterized in that: The following steps are involved: S1, extracting genomic DNA of the material to be tested; S2, establish a PCR amplification reaction system using specific primers, wherein: Primer sequences specifically refer to srt8-24: Forward primer (srt8-24F) 5'-TAACACCCCACGGAAAAGTC-3' Reverse primer (srt8-24R) 5'-TCTGTTGTCGTCGTGGTTGT-3' Primer sequences specifically refer to srt8-64: Forward primer (srt8-64F) 5'-TTGGCAACTGGTGACAATCT-3' Reverse primer (srt8-64R) 5'-CAAACGGGAAAGCAAAGAAA-3' S3, executing the PCR amplification program, including preliminary denaturation, cycling (denaturation, annealing, extension), and final extension; S4, gel electrophoresis analysis of PCR products; S5, observe and record DNA bands of specific sizes. If the electrophoresis results show two specific bands of 153 bp and 298 bp, it indicates that the material to be tested carries the clubroot resistance gene BraPb8.3.

Images